Towards the Analysis of High Molecular Weight Proteins and Protein complexes using TIMS-MS

Abstract

In the present work, we demonstrate the potential and versatility of TIMS for the analysis of proteins, DNA-protein complexes and protein-protein complexes in their native and denatured states. In addition, we show that accurate CCS measurement are possible and in good agreement with previously reported CCS values using other IMS analyzers (<5% difference). The main challenges for the analysis of high mass proteins and protein complexes in the mobility and m/z domain are described. That is, the analysis of high molecular weight systems in their native state may require the use of higher electric fields or a compromise in the TIMS mobility resolution by reducing the bath gas velocity in order to effectively trap at lower electric fields. This is the first report of CCS measurements of high molecular weight biomolecules and biomolecular complexes (~ 150 kDa) using TIMS-MS.

Introduction

Experimental determination of biomolecular structures remains a challenging problem despite recent developments in theoretical approaches that are based on available experimental structural observations (e.g., ab initio, molecular dynamics and bioinformatics-based prediction strategies).[1] The elucidation of structural features of interest for biomolecules and biomolecular complexes is challenging because of the highly heterogeneous and dynamic character of biomolecules and their low relative concentrations within physiologically relevant conditions.[2–11] While X-ray crystallography and NMR spectroscopy excel at revealing structures of molecules at the atomic level, these approaches are limited by the fact that they often describes a single state of the biomolecule and/or biomolecular complex structure.[12–17] Moreover, since neither technology involves component separation during analysis, both require highly purified samples.[18, 19]

Recent innovations in speed, accuracy, and sensitivity have established mass spectrometry (MS) based methods as a key technology within the field of structural biology.[20] Specifically native MS techniques, which have been developed over the last two decades, permits the structural interrogation of intact biomolecules and biomolecular complexes at biologically relevant conditions, which are not accessible by other methods.[21–25] Attention has been drawn towards the characterization of intrinsically disordered proteins (IDP)[26–28], antibody therapeutics[29–32], and even massive protein complexes[33–37] that cannot be studied using traditional structural techniques. Most common gas-phase structural probing is based on, or a combination of, tandem MS (ergodic and non-ergodic), gas-phase hydrogen-deuterium exchange, ion spectroscopy, and ion mobility spectrometry.

In particular, ion mobility spectrometry (IMS) is based on the separation of ions as they drift in a bath of inert neutral molecules under the influence of a weak electric field.[38–40] The ion’s mobility gives information on their size and shape via the momentum transfer ion-neutral collision cross section (CCS).[41] This description holds true for most contemporary IMS analyzers (e.g., periodic focusing DC ion guide [42–44], segmented quadrupole drift cell [45], multistage IMS [46–48], traveling wave ion guide (TWIMS) [49, 50], and SLIM devices [51]), and a common pursuit has been to increase IMS resolving power and ion transmission.[52–60] Many different forms of IMS have been used in the analysis of biological molecules for the analysis of isotopomers[61], proteins[62, 63], protein complexes[64–71], folding pathways[72–74], unstructured/intrinsically disordered proteins[75–79], as well as collisionally activated states of peptides and proteins[69, 80–87]. It should be noted that, in the case of structural biology, gas-phase studies take advantage of the desolvation process to effectively reduce sample complexity, permitting molecular characterization in the absence of bulk solvent.

With the recent introduction of a new IMS analyzer - Trapped Ion Mobility Spectrometer (TIMS)- the possibility to decouple the time domain from the IMS separation allows for the study of conformationally trapped molecular ions in the gas-phase as a function of the desolvation time, temperature and bath gas composition. TIMS’ mode of operation and its advantages over traditional IMS are described in ref [88–90]. We have shown the use of TIMS for the study of isomerization kinetics of small molecules[91], peptides[92], and proteins[19, 93–95], the influence of the collision partner on the molecular structure[96], and the factors that affect molecular-adduct complex lifetime and stability during TIMS measurements[97]. In particular, we have shown the combination of simultaneous measurement of first principle derived collision cross sections and back-exchange HDX rates using a TIMS device with theoretical calculations for the assignment of candidate structures of kinetic intermediates as a way to study folding/unfolding pathways.[92]

In this work, we further investigate the potential of trapped ion mobility spectrometry (TIMS) for the separation and characterization of high molecular weight proteins and protein complexes. In particular, the discussion is based on the fundamental factors that affect the molecular ion trapping of high mass molecular systems, the collision cross section calculations and the differences between native and non-native states.

Experimental Methods

Material and reagents

Most proteins utilized in this study were purchased (e.g., ubiquitin, equine holomyoglobin, carbonic anhydrase from bovine erythrocytes, β-lactoglobulin, equine cytochrome C, and bovine serum albumin) from Sigma-Aldrich (St. Louis, MO, USA), or provided by collaborators (e.g., Avastin, HMGA2[98], rat Calmodulin[99] and recombinant mouse DREAM[93]) and used as received. DNA sequences FL875(CCCCCCATATTCGCGATTATTGCCCCCGCAATAATCG CGAATATGGGGGG), FL876 (GGATATTGCCCCCGCAATATCC) were purchased from Eurofin (Ebersberg, Germany). Protein solutions were prepared at a final 1–10 μM concentration in 10–100 mM ammonium acetate, 0–50% methanol, and 0–10% acetic acid. Low concentration Tuning Mix (G2421A; Agilent Technologies, Santa Clara, CA, USA) was used as a mobility calibration standard. All solvents and ammonium acetate salts used in these studies were analytical grade or better and purchased from Fisher Scientific (Pittsburg, PA, USA).

TIMS-MS Analysis

Details regarding the TIMS operation and specifics compared to traditional IMS can be found elsewhere.[88–92] Briefly, mobility separation in TIMS is based on holding the ions stationary using an electric field against a moving gas. The separation in a TIMS device can be described by the center of the mass frame using the same principles as in a conventional IMS drift tube.[41] Since mobility separation is related to the number of ion-neutral collisions (or drift time in traditional drift tube cells), the mobility separation in a TIMS device depends on the bath gas drift velocity, ion confinement and ion elution parameters. The mobility in a TIMS analyzer can be described as:

$$K_i={\mathrm{\upsilon }}_{\mathrm{g}}/{\mathrm{E}}_x(\mathrm{i})=\mathrm{A}(1/({\mathrm{V}}_{\text{out}}-{\mathrm{V}}_{\text{elu}}(\mathrm{i}))$$ (1)

where υ_g is the velocity of the bath gas in the mobility cell and E_x(i) is the electric field at which the specific packet of ions elute. These parameters can be related to the elution voltage (V_elu(i)) and the exit voltage (V_out) of the region exit. The calibration constant A was determined from previously reported mobility values for Tuning Mix calibration standard (G24221A, Agilent Technologies, Santa Clara, CA) in nitrogen (m/z = 322, K₀ = 1.376 cm² V⁻¹ s⁻¹ and m/z = 622, K₀ = 1.013 cm² V⁻¹ s⁻¹).[90, 100]From the mobility K value, the collisional cross section (CCS) can be determined by the following equation:

$$\mathit{CCS}=\frac{{(18\pi )}^{\frac{1}{2}}}{16}\frac{z}{{(k_{b}T)}^{\frac{1}{2}}}{\left[\frac{1}{m_1}+\frac{1}{m_b}\right]}^{\frac{1}{2}}\frac{1}{K}\frac{760}{P}\frac{T}{273.15}\frac{1}{N^{\ast }}$$ (2)

Where the charge of the ion is represented by z, k_b represents the Boltzman constant, m₁ and m_b are the masses of molecular ion and the bath gas and N^* is the number density.

TIMS-MS Operation Parameters

TIMS operation can be tuned for either wide range mobility analysis, with a voltage ramp of ΔV_ramp = 200 V, or for narrow mobility selection, with a narrow voltage ramp of ΔV_ramp = 10–30 V. In both cases ramp times of up to 500ms are used for analysis. Notice that TIMS mobility resolution depends on both the ramp size as well as the ramp speed, where lower speeds give higher mobility resolutions.[88–90] In addition to the ramp speed, the velocity of the gas also defines the mobility resolution and trapping efficiency of the TIMS analyzer. Increasing the velocity of the gas, by changing the pressure difference between the front (P₁ = 1.1 – 4.3 mbar) and the end (P₂= 0.6 – 3.0 mbar) of the analyzer region also increases the mobility resolution. As the velocity of the gas increases the ions experience a greater drag force, requiring higher electric fields in order to be trapped. A constant radiofrequency (RF) is applied to the entrance, analyzer and exit region of the TIMS analyzer (frequency of 880kHz with 200– 300 V peak-to-peak). Each funnel electrode is divided into four electrically insulated segments that are used to create a dipole field in the entrance and exit section, to focus the ions downstream, and a quadrupolar field in the separation region to radially confine the ions during the ion trapping and analysis. That is, in the entrance and exit funnel sections, the RF potential applied to the ion funnel is 180° out of phase between adjacent plates. This results in a pseudo-potential, which pushes the ions away from the funnel walls. However, in the analyzer section, the phase of the RF potential does not alternate between adjacent plates but only between adjacent segments. The purpose of the quadrupolar field in the analyzer section is to confine (trap) the ions radially and avoid ion losses due to diffusion. The TIMS analyzer was coupled to a maXis Impact QUHR-TOF (Bruker Daltonics Inc., Billerica, MA). Data acquisition was controlled using in-house software and synchronized with the maXis Impact acquisition program.

Atmospheric Pressure Ionization Sources

Electrospray Ionization Source (ESI)

An orthogonal, commercial ESI source based on the Apollo II design (Bruker Daltonics, Inc., MA) was used. Briefly, sample solutions were introduced into the nebulizer at a rate of 120–180 μL/min using an external syringe pump. Typical operating conditions were 4000–4500 V capillary voltage, 600 V endcap capillary offset voltage, 10 L/min dry gas flow rate, 1.0 bar nebulizer gas pressure, and a dry gas temperature 180 °C. Ions from the ESI source are introduced via a 0.6 mm inner diameter, single-bore glass capillary tube, which is resistively coated across its length, allowing the nebulizer to be maintained at ground potential, while the capillary exit was biased to around 180V.

nanoElectrospray Ionization Source (nanoESI)

A custom-built, pulled capillary orthogonal nanoESI source was utilized for all the experiments. Quartz glass capillaries (O.D.: 1.0 mm and I.D.: 0.70 mm) were pulled utilizing a P-2000 micropipette laser puller (Sutter Instruments, Novato, CA) and loaded with 10 μL aliquot sof the sample solution. A typical nanoESI source voltage of 600–1200 V was applied between the pulled capillary tips and the TIMS-MS instrument inlet. Ions were introduced into the TIMS cell via a stainless steel tube (1/16 x 0.020″, IDEX Health Science, Oak Harbor, WA), which was held at room temperature.

Theoretical Calculations

Theoretical collisional cross sections were calculated from X-ray structures for myoglobin (pdb: 1YMB), cytochrome C (pdb: 1HRC), β-lactoglobulin (pdb:4GNY), and ubiquitin (pdb:1UBQ), and were used as is.[100–103] Ion mobilities were calculated for the X-ray structures using the trajectory method (TM) utilizing IMoS (v.106W64dsoftware.[104–108] This calculation software allows the calculation of collisional cross sections of ions using both traditional methods as well as new methods such as Diffuse Hard Sphere Scattering and Diatomic Trajectory Method. For molecules without defined partial charges the charge is centered at the center of mass of the protein. Gas particles originate from a bounding box from the x, y, and z planes and are diagonalized in order to determine the collisional cross section of the ions. Calculations were performed with 3 TM rotations, with 300,000 gas molecules, and 92% Maxwell distributed remission velocity. Mobility calculations were performed for all experimentally observed charge states.

RESULTS AND DISCUSSION

Ion mobility spectrometry (IMS) combined with molecular dynamic simulations has proven to be a versatile technique for the analysis of intermediate and equilibrium structures of biomolecules enabling the correlation of ion-neutral, collision cross sections (CCS) with candidate structures.[109–115] In particular, it has been shown that by using soft ionization techniques (e.g., ESI) the evaporative cooling of the solvent leads to a freezing of multiple conformations, which has permitted the study of the conformational space dependence on the solvent conditions (e.g., native vs denatured), bath gas collision partner, and temperature.[116, 117] For example, changes in the starting solution conditions (e.g., pH, organic content, etc.) can induce changes in the charge state distribution and the conformational space that is accessible during the IMS-MS measurements.[118–121] In addition, changes in the conformational space can be observed as a function of the desolvation process and upon activation prior to the IMS-MS measurements. Previous work using TIMS-MS has shown the possibility to trap a wide mobility range from small molecules to small proteins[122, 123]; however, it was also demonstrated that the trapping efficiency is a function of the electrode geometry, bath gas profile and electrical confining parameters (e.g., radiofrequency value and amplitude).

Biomolecules can exist in several conformational states inside the cell and their functions are directly related to the folding/unfolding mechanism. Thus, to better understand the structural properties of biomolecules there is a need to accurately measure the CCS, which changes as a function of their conformational state. Biomolecular ions can be introduced in the TIMS analyzer in native and denatured states (see Figure 1). The increase in charge state is generally accompanied by the observation of more denatured conformational states with higher CCS values. That is, the degree of folding/unfolding can be observed as the charge state changes, reflecting biomolecular structural changes and any major transitions. For example, in the case of globular proteins (e.g., cytochrome C 12 kDa and myoglobin 17 kDa), a change from single native state to multiple molten globule and unfolded conformational states are observed. Notice that while the CCS values agree with previously reported CCS using DT-IMS-MS and TWIMS-MS, within 5%, the higher resolution of the TIMS permits, for the first time, the separation of a larger number of conformations. Moreover, in the case of barrel proteins (e.g., Ubiquitin 8.5 kDa and β-Lactoglobulin 18.4kDa) in addition to the unfolding trend, abrupt changes in the CCS can be correlated to significant conformational transitions. When compared to other structural measurements (e.g., solution NMR and X-ray crystallography, solid line in Figure 1), it can be seen that the increase in CCS with the charge state is not merely due to the charge dependence of the CCS, but a consequence of structural changes in the molecular ion (see equation 2). A more detailed list of CCS values as a function of the charge state is shown in Table 1 for protein, DNA-protein complexes, and protein-protein complexes using both ESI and nanoESI sources.

Figure 1.

Ion-neutral collisional cross section dependence on the m/z for globular proteins (myoglobin and cytochrome C) and barrel proteins (β-lactoglobulin and ubiquitin) in their native and denature states. In black, theoretical values obtained from reported tridimensional structures based on X-ray measurements.

Table 1.

Ion-neutral collisional cross sections measured by nanoESI-TIMS-MS in nitrogen as a bath gas for proteins, protein – DNA complexes and protein-protein complexes.

Protein	m/z (charge), CCS;
Avastin	5960 (+25), 6709; 5731 (+26), 6997; 5519 (+27), 7031;
BSA Dimer	5870 (+23), 6208; 5625 (+24), 6454; 5400 (+25), 6699;
BSA	4467 (+15), 4200, 4188 (+16), 4291, 3941 (+17), 4351; 3722 (+18), 4476;
β-Lactoglobulin Dimer	2831 (+13), 3430;
DREAM*	2455 (+12), 3025, 3181; 2266 (+13), 3561, 3756, 4078; 2104 (+14), 4029, 4195, 4315, 4526; 1964 (+15), 4243, 4459, 4809; 1841 (+16), 4526, 4829, 5024; 1733 (+17), 4663, 4829, 5102; 1636 (+18), 4751, 5317; 1473 (+20), 5151, 5639; 1403 (+21), 5756, 5912, 6253, 6467; 1339 (+22), 5951, 6184, 6340,6526; 1281 (+23), 6223, 6585, 6818; 1227 (+24), 6760, 6917, 7062
Carbonic Anhydrase	2887 (+10), 2530; 2625 (+11), 2606; 1444 (+20), 5422; 1375(+21), 5510; 1312 (+22), 5863; 1255 (+23), 6625; 1203 (+24), 6809; 1155 (+25), 6962; 1110 (+26), 7144, 1069 (+27), 7317; 1031 (+28), 7475; 996 (+29), 7596; 962 (+30), 7710; 931 (+31), 7831; 902 (+32), 7943; 875 (+33), 8139; 849 (+34), 8276; 825 (+35), 8380; 802 (+36), 8559; 780 (+37), 8692; 760 (+38), 8755; 740 (+39), 8906
Myoglobin	2147 (+8), 2187; 1908 (+9), 2399,2465; 1717 (+10), 2749, 2805, 2882, 2937; 1561 (+11), 2992, 3052, 3125, 3228, 3300; 1431 (+12), 3123, 3192, 3209, 3300, 3337, 3385, 3446, 3374, 3446, 3531, 3591; 1227 (+13), 3809; 1145 (+14), 3945; 1073 (+15), 4084; 1010 (+16), 4245; 954 (+16), 4222; 904 (+17), 4266
β-Lactoglobulin	3680 (+5), 1422; 3067 (+6), 1636; 2629 (+7), 1773; 2300 (+8), 1995; 2044 (+9), 2155, 2381; 1840 (+10), 2867, 1673 (+11), 3343; 1533 (+12), 3449; 1415 (+13), 3518; 1314 (+14), 3655; 1227 (+15), 3795; 1150 (+16), 3937; 1082 (+17), 4076; 1022 (+18), 4207; 968 (+19), 4867; 876 (+21), 5152
Ubiquitin	2125 (+4), 1149; 1700 (+5), 1229; 1417 (+6), 1699; 1214 (+7), 1794; 1063 (+8), 1975; 944 (+9), 2069; 850 (+10), 2213; 773 (+11), 2292; 708 (+12), 2468; 654 (+13), 2624
Cytochrome C	2064 (+6), 1289, 1438; 1769 (+7), 1307, 1574, 1922, 2083; 1548 (+8), 1686, 1925, 2249, 2468, 2496; 1376 (+9), 1637, 2024, 2258, 2358, 2388, 2631; 1238 (+10), 2181, 2365, 2508, 2652, 2717; 1125 (+11) 2403, 2553, 276, 2813, 2861; 1032 (+12), 2678, 2805, 2877, 3189; 952 (+13), 2794, 2969, 2998, 3044; 825.6 (+14), 3279, 3318, 3358; 774 (+16), 3036, 3311, 3382, 3465, 3557; 728 (+17), 3516, 3611, 3663, 3724; 688 (+18), 3598, 3689, 3743, 3778; 651 (+19), 3727, 3798; 619 (+20), 3885, 589 (+21), 3907,3954
Calmodulin	2405 (+7), 1860; 2104 (+8), 1915, 2103, 2378; 1870 (+9), 2256, 2396, 2750, 2933; 1684 (+10), 2741, 2981; 1530, (+11), 2957, 3097, 3256, 3323; 1403 (+12), 3170, 3323, 3402; 1295 (+13), 3512, 3591, 3707; 1202 (+14), 3695, 3749, 3847; 1122 (+15), 3841, 3944; 1052 (+16), 1091; 990 (+17) 4212, 935 (+18), 4341
HMGA2	1477 (+8), 2114; 1313 (+9), 2353; 1181 (+10), 2511; 1074 (+11), 2704; 984 (+12), 2869, 2890; 909 (+13), 2998; 844 (+14), 2967, 3059, 3130; 787 (+15), 3236, 3334; 739 (+16), 3339
FL876+HMGA2 (GGATATTGCCCCCGCAATATCC)	2639 (+7), 1624; 2309 (+8), 1658; 2053 (+9), 1741, 2003; 1847 (+10), 1769, 1621, 2082, 2169, 2286; 1680 (+11), 2148, 2423; 1540 (+12), 2582, 2748; 1421 (+13), 2706, 2886; 1320 (+14), 2810, 3031, 3258; 1232 (+15), 2921, 3204; 1155 (+16), 3300, 3548; 1087 (+17) 3651, 4003;
FL875+HMGA2 (FL875: CCCCCCATATTCGCGATTATTGCCCCCGCAATAATCGCGAATATGGGGGG)	3401 (+8), 1991; 3023 (+9), 2069; 2721 (+10), 2098, 2140, 2246, 2459

The charge state dependence with the CCS shows that, as the protein mass increases, there is a need to measure higher m/z in order to sample native conformations. Previous work has shown that with extended mass range MS analyzers, larger proteins and protein complexes can be studied by IMS-MS.[124] In the case of TIMS-MS, a similar approach can be taken but different from other IMS variants, the experimental conditions for molecular ion trapping and efficiency in the TIMS analyzer plays a major role. For example, nanoESI-TIMS-MS can separate larger molecular ions based on both mobility and m/z (see example in Figure 2 for the BSA dimer 132 kDa and the Avastin monomer 149 kDa) under native conditions. However, it should be noted that the TIMS-MS experiment can be performed under multiple trapping conditions. That is, in TIMS ion trapping is based on compensating the drift force (defined by the pressured difference in the tunnel region or bath gas velocity) with an electric field (see equation 1). However, there are practical limitations on the value of the applicable voltage difference across the tunnel region and therefore the mobility range that can be studied (see examples in Figure 3 for TIMS measured and for predicted K values based on other IMS techniques [50, 70]). As we mentioned before, the higher the velocity of the gas the higher the electric field required for the analysis. For example, when TIMS-MS is operated at an A ~200 (v_g ≈ 93 m/s), the required field strength to trap the high mass protein ions in their native state is V_elution − V_base < 360 V. Although this electric field is technically achievably, the trapping efficiency is typically low for high mass species. Nevertheless, under these conditions, ion mobility resolutions (R= CCS/ΔCCS) of up to 400 have been achieved for lower mass systems (see example in the separation of hydroxylated polybrominated-diphenyl ethers[125]). In the case of larger mass systems, a factor of <2x in the resolving power can be compromised in order to achieved higher trapping efficiencies. For example, when TIMS-MS is operated at an A ~150 (v_g ≈ 70 m/s) and A ~100 (v_g ≈ 45 m/s), the required field strength to trap the high mass protein ions in their native state is V_elution − V_base < 275 and <185 V, respectively. Under these conditions large mass proteins like glutamate dehydrogenase, and massive protein complexes, such as Groel can be analyzed. Notice that although certain proteins and protein complexes typically have a very high mass (~800 kDa for Groel), a m/z range of up to 12,500 will suffice to perform TIMS-MS experiments of proteins and protein complexes in their native state.

Figure 2.

a) 2D-IMS-MS contour plot for a mixture of Avastin antibody and BSA dimer. Mass spectra projections for Region 1 (Avastin) and Region 2 (BSA dimer).

Figure 3.

Dependence of the trapping potential for a m/z up to 12,500 for several TIMS measured and reported biomolecular systems as a function of the bath gas velocity. Notice that as the velocity of the gas decreases, the lower the trapping potential required in the TIMS analyzer.

CONCLUSIONS

In the present work we demonstrate the potential and versatility of TIMS for the analysis of proteins, DNA-proteins, and protein-protein complexes in their native and denatured states. In addition, it was shown that accurate CCS measurements are possible and are in good agreement with previously reported CCS values using other IMS analyzers (<5% difference). The main challenges for the analysis of high mass proteins and protein complexes in the mobility and m/z domain were described. That is, the analysis of high mass systems in their native state will require the use of higher electric fields or a compromise in the TIMS mobility resolution by reducing the bath gas velocity. This is the first report of CCS measurements of high mass biomolecules and biomolecular complexes (~ 150 kDa) using TIMS-MS.