Abstract
Premise of the study:
Lancea tibetica (Phrymaceae), a Tibetan medicinal plant, is endemic to the Qinghai–Tibet Plateau. The over-exploitation of wild L. tibetica has led to the destruction of many populations. To enhance protection and management, biological research, especially population genetic studies, should be carried out on L. tibetica. Simple sequence repeat (SSR) markers of L. tibetica were developed to analyze population diversity.
Methods and Results:
Four thousand four hundred and forty-one SSR loci were identified for L. tibetica based on restriction-site associated DNA (RAD) sequencing on the Illumina HiSeq platform. One hundred SSR loci were arbitrarily selected for primer design, and 38 of them were successfully amplified. These markers were tested on 56 individuals from three populations of L. tibetica, and 10 markers displayed polymorphisms. The total number of alleles per locus ranged from three to eight, and observed and expected heterozygosities ranged from 0.200 to 1.000 and 0.683 to 0.879, respectively. We tested for cross-amplification of these 10 markers in the related species L. hirsuta and found that nine could be successfully amplified.
Conclusions:
The SSR markers characterized here are the first to be developed and tested in L. tibetica. They will be useful for future population genetic studies on L. tibetica and closely related species.
Keywords: Lancea tibetica, Phrymaceae, population diversity, RAD sequencing, simple sequence repeat (SSR)
Lancea tibetica Hook. f. & Thomson (Phrymaceae) is an herb endemic to the Qinghai–Tibet Plateau. It usually grows in grasslands, sparse forests, or ravines at altitudes of 2000–4500 m. As a traditional Tibetan medicinal plant, it has been used in the treatment of leukemia, intestinal angina, heart disease, and cough (Hong et al., 1998). Investigations into the chemical constituents of L. tibetica have resulted in the isolation of phenylpropanoid glycosides and lignans, which contribute to the species’ antioxidant effects (Song et al., 2011). To increase production of traditional medicine from this species, the harvest of wild populations has been greatly expanded. The serious depletion of L. tibetica through over-collecting has led to a need for proper management and a conservation plan to ensure its sustainable use into the future. A thorough study at the population level is required to evaluate the extent of remaining genetic resources and to inform management plans.
Simple sequence repeat (SSR) markers are widely used for population genetic studies due to their codominant nature, polymorphisms, and reproducibility (Litt and Luty, 1989). The development of SSR markers for L. tibetica will enable us to assess genetic diversity and contribute to a conservation strategy. The restriction-site associated DNA (RAD) method was proposed by Miller et al. (2007) as a reliable approach that reduces genome complexity. RAD sequencing has been successfully applied in many organisms, including crop species like barley (Chutimanitsakun et al., 2011). In this paper, we describe the process of isolation and characterization of 10 polymorphic SSR markers from L. tibetica based on RAD sequencing.
METHODS AND RESULTS
Plant materials and DNA extraction
In total, 56 L. tibetica individuals from three natural populations (YD, QML, and MY) were sampled (Appendix 1). Fresh leaves were collected and dried in silica gel; the voucher specimens are deposited in the Herbarium of the Northwest Institute of Plateau Biology (HNWP), Chinese Academy of Sciences, Xining, Qinghai Province, China. Total genomic DNA was extracted from dried leaves with the cetyltrimethylammonium bromide (CTAB) method (Doyle, 1987).
RAD library preparation and sequencing
We selected one individual from each of the populations and pooled them. Subsequently, the RAD library was constructed based on published methods (Barchi et al., 2011). The library was quantified with Qubit (Invitrogen, Eugene, Oregon, USA) and sequenced using the Illumina MiSeq platform (Illumina, San Diego, California, USA). Before doing any further analysis, quality control and filtering of raw data were performed to detect whether the raw reads were of high enough quality, following Zhang et al. (2014). After that, clean reads were clustered using CD-HIT-EST (Li and Godzik, 2006) and assembled de novo using VelvetOpt (Zerbino and Birney, 2008). Sequencing produced 2,764,204,500 bp of clean reads after quality control from 2,800,948,250 bp of raw reads. We obtained 1,417,277 cluster tags, but only 222,628 cut cluster tags. We obtained 401,203 high-quality contigs, with an average size of 265 bp (N50 = 361) through de novo assembly.
Subsequently, we identified the SSR repeats from the assembled contigs using Trimmomatic version 0.32 (Bolger et al., 2014) and set the parameters for detection of di-, tri-, tetra-, penta-, and hexanucleotide motifs with flanking regions in SSR pipeline version 0.951 (Miller et al., 2013). A total of 4441 perfect SSR repeats from the assembled contigs were obtained in the study. Among them, the numbers of di-, tri-, tetra-, penta-, and hexanucleotide repeats were 2026, 2081, 220, 73, and 41, respectively.
SSR primer design and genetic diversity analysis
SSR primers were designed using Primer3web (Untergasser et al., 2012) for the SSR sequences. Primers were designed according to the following criteria: amplified regions within a size range of 100–200 bp, primer annealing temperature range 55.0–62.0°C, and GC content range 45–60%. Different repeat motifs of SSR sequences were arbitrarily selected to design primers to obtain 100 pairs of qualified SSR primers. PCRs were performed with all 56 samples, with a 30-μL reaction mixture: 20–30 ng of template DNA, 5 μL 10× PCR buffer (15 mM MgCl2), 1.5 μL of each primer (5 pM), 1.0 μL Taq DNA polymerase (TaKaRa Biotechnology Co., Dalian, China), 0.5 μL dNTP mix (10 mM), and supplemented with ddH2O. The PCR program included the following steps: 94°C for 5 min, one cycle; 94°C for 35 s at the appropriate annealing temperatures (annealing temperatures for each specific primer pairs are given in Table 1) for 35 s; 72°C for 30 s, 35 cycles; 72°C for 10 min, one cycle. PCR products were visualized on 1.0% agarose gels with ethidium bromide. Of the 100 pairs of SSR primers tested, 38 amplified successfully (Table 1). These 38 primer pairs were used for PCR amplification in all 56 samples to detect polymorphism. PCR conditions are the same as those described above. PCR products were applied on agarose and then separated on 12% w/v nondenaturing polyacrylamide gels (PAGE) following Wang et al. (2014), with DL500 DNA Marker (TaKaRa Biotechnology Co.). We calculated the inbreeding coefficient (FIS), total number of alleles per locus (A), observed heterozygosity (Ho), expected heterozygosity (He), null allele frequency (r), and deviations from Hardy–Weinberg equilibrium (HWE) using GENEPOP version 4.4 (Rousset, 2008).
Table 1.
Characteristics of 38 microsatellite loci developed in Lancea tibetica.
| Locus | Primer sequences (5′–3′) | Repeat motif | Fragment size (bp) | Ta (°C) | GenBank accession no. |
| LT4 | F: ATTGATTGATTCACGTTCCAAAT | (TA)6 | 132 | 54 | KU764519 |
| R: TGAAAATGAATAACTTGGGGATCT | |||||
| LT7 | F: TTTGGAAAGCATGATCTACCACT | (AAT)5 | 151 | 56 | KU764520 |
| R: TTTCTGGACTGTTGTAATCTTGAAA | |||||
| LT9 | F: GGATTTCTAAGTGCAATCCTCAA | (GA)7 | 140 | 51 | KU764521 |
| R: CATCACTCACCAAATGAAAGACA | |||||
| LT10 | F: AATTGTTCCAGGTATGCAGTGTT | (TG)6 | 155 | 51 | KU764522 |
| R: CTATTCTGCAAGTTAATGCAGGG | |||||
| LT12 | F: GTAGACATTTTTGCAGCACCTCT | (CAT)5 | 150 | 51 | KU764523 |
| R: ATGAGGACTCAAAGACAGCTCAG | |||||
| LT15 | F: CTTATAACCTATCGTTCTCCGGC | (AG)7 | 138 | 54 | KU764524 |
| R: ATTTCGCTCTCTCTTTCACACAC | |||||
| LT16 | F: TGTATTGTCAATGGAAGAGGCAT | (AAG)4 | 155 | 51 | KU764525 |
| R: GAATGAGATGCTCCACTAACCAC | |||||
| LT18 | F: AACAAGTTTATGCAAGGAGGAGA | (TCT)5 | 160 | 51 | KU764526 |
| R: CCCAAGTCCCAAATGATATAAAA | |||||
| LT25 | F: GATGCCAAGGAATTGTTATATGC | (TA)7 | 153 | 51 | KU764527 |
| R: TTTCTAGAAGTCGGAGCTGTCC | |||||
| LT28 | F: AACAGCAATGGCAATATGGTATC | (TA)9 | 158 | 56 | KU764528 |
| R: AACTGTTCAAGTTGGCAAAACAT | |||||
| LT6 | F: TCTATCGGTGCTAAAACACCTTC | (GT)11 | 153 | 51 | KX377923 |
| R: CTCATCCTCATCATACCGATCAT | |||||
| LT11 | F: TTGCCCTTATGTTTATCAAGGAA | (CT)6 | 144 | 51 | KX377922 |
| R: CACAGAAGAAGGATGAGGAGAAA | |||||
| LT17 | F: GACAGAACCCCTCTCTGAATCTT | (TAC)4 | 152 | 51 | KX377921 |
| R: GCGCCATAAGGTATAGCACTTC | |||||
| LT19 | F: ATTACCAACTTTCAACCAAAGCA | (CCT)4 | 159 | 51 | KX377920 |
| R: GCTTGTTGTCTTCTTTCCCAATA | |||||
| LT26 | F: TGAGCAGGTGCCTTTATTGTTAT | (CT)7 | 149 | 58 | KX377919 |
| R: TCAGCAGATCCTTATTATTTGTGC | |||||
| LT30 | F: AGGTCAGGAACAACAATACCTCA | (AG)8 | 158 | 49 | KX377918 |
| R: CTATATATCTTGCTTGCAAATCCG | |||||
| LT40 | F: TCTCTCTTTCTTCCCTCTCCATC | (GA)10 | 148 | 55 | KX377917 |
| R: AAATCAAGGAATCTGTGCAATGT | |||||
| LT45 | F: GGAGAGGGAAAAGAAGAAGAAGA | (GAA)4 | 78 | 53 | KX377916 |
| R: TACCAATGTAGCCGGAAATAAAG | |||||
| LT49 | F: AACGAAAATACTTTCCGTCTACAAA | (AT)8 | 121 | 52 | KX377915 |
| R: CTTGTTCTGGTCTGGTTTAAGGA | |||||
| LT60 | F: CTATAAATACCTCCCTCCCCCTC | (CT)7 | 127 | 51 | KX377914 |
| R: GTTTACGAGCACTCCTAGGTGAA | |||||
| LT61 | F: TGCCTATTCTTTACAAGAGCACA | (AT)6 | 117 | 52 | KX377913 |
| R: TTAATTGTAAATCGCAAAAACCC | |||||
| LT65 | F: TAAATGGTTTGCATCTTGGAAAT | (TAT)5 | 119 | 51 | KX377912 |
| R: GCAAAAATAAGTTTAACCGCGTA | |||||
| LT66 | F: TTTTGCTTTGTTGGATTCTTGAT | (GAT)4 | 148 | 53 | KX377911 |
| R: GCATCCTAAACTTACCGTTTTCA | |||||
| LT67 | F: TTTTGCAGGTTTAAGACAAAGGA | (GT)7 | 106 | 51 | KX377910 |
| R: TACATCGACACTTTTCAATCCAA | |||||
| LT69 | F: AGCGTAAGAAGATGATAGAAGGG | (AAT)4 | 145 | 51 | KX377909 |
| R: TGATCCTATTAGAGTTGCAAACG | |||||
| LT72 | F: TCAAACAAGCATGGGAGTACTTT | (AGA)4 | 140 | 52 | KX377908 |
| R: TTTGAACGAATTAGAGGAGGACA | |||||
| LT75 | F: ATACCAACCTGTGGCGTATATTG | (AT)6 | 150 | 51 | KX377907 |
| R: TGAAGATGTAAGAACAACCAGCA | |||||
| LT77 | F: GATCATGTCCCATCAAATTCAAC | (AT)14 | 157 | 51 | KX377906 |
| R: TTGTGTTATCTCCTGCGGTACTC | |||||
| LT79 | F: GAAGAGGTCAAGGCAAAGATACA | (AG)6 | 144 | 51 | KX377905 |
| R: TGAAATCGAGAATTGAAGAACAAA | |||||
| LT81 | F: TAGAAAAGTGAGGAATGGGACAA | (AT)6 | 157 | 50 | KX377904 |
| R: TGGTTTAGGAAATTTAACGATTGA | |||||
| LT83 | F: CATAATTTTGTGAGATCTTGGGC | (TTG)4 | 145 | 52 | KX377903 |
| R: AATTCTCCAAATGCAGATGATGT | |||||
| LT86 | F: TACTTGCTCCCCAAGTCTTCATA | (AG)8 | 135 | 51 | KX377902 |
| R: CGAGTGTAAGGCGTTAGGAGATA | |||||
| LT87 | F: AAGTACTCGAGAAGCAGGAGTCA | (TTA)4 | 116 | 49 | KX377901 |
| R: CCACCATAAAATCCTTTCCAAAT | |||||
| LT91 | F: GTACTTAGCGTGGGACTTTGTTG | (TGA)7 | 143 | 50 | KX377900 |
| R: CCACATCATCATCAATTGCATAC | |||||
| LT93 | F: AGCCAGTCGTCTCATTACAAAAA | (CT)6 | 138 | 55 | KX377899 |
| R: TTCTGCAGAGACTGGATCTGAAT | |||||
| LT95 | F: CGCAGTAGCAGATAGTGAATGTG | (ATC)5 | 119 | 54 | KX3779898 |
| R: TCCTCAAAATCAATGTCAGTGTG | |||||
| LT97 | F: TCGGGTTTATGTCTTACACTTGAG | (AAT)4 | 148 | 53 | KX3779897 |
| R: AGATCCTTAATTTTTATGAGCAATCA | |||||
| LT98 | F: ACATTGAAGACTAAGACATGGCG | (GA)6 | 156 | 52 | KX3779896 |
| R: GAGATACAAACCCTAACCCTCGT |
Note: Ta = annealing temperature.
After PAGE analysis, 10 pairs of SSR primers were found to be highly polymorphic among the three populations of L. tibetica; the other 28 showed no significant difference. A ranged from three to eight. Ho and He ranged from 0.200 to 1.000 and from 0.683 to 0.879 (Table 2), respectively, which indicates that genetic diversity in this species is relatively high. Additionally, r ranged from 0.000 to 0.307. Some loci (LT25 in population YD, LT4 in population QML, LT7 and LT9 in population MY) showed a significant departure from HWE, which could be caused by the presence of null alleles (Chapuis and Estoup, 2007).
Table 2.
Results of initial primer screening of 10 polymorphic loci in three Lancea tibetica populations.a
| Locus | Population YD (N = 17) | Population QML (N = 20) | Population MY (N = 19) | ||||||||||||
| A | He | Ho | r | FIS | A | He | Ho | r | FIS | A | He | Ho | r | FIS | |
| LT4 | 6 | 0.800 | 0.529 | 0.131 | 0.346 | 3 | 0.683* | 0.200 | 0.307 | 0.713 | 5 | 0.758 | 0.474 | 0.141 | 0.382 |
| LT7 | 7 | 0.838 | 0.706 | 0.054 | 0.162 | 3 | 0.719 | 0.600 | 0.160 | 0.169 | 5 | 0.807* | 0.579 | 0.116 | 0.288 |
| LT9 | 7 | 0.848 | 0.706 | 0.062 | 0.172 | 5 | 0.745 | 0.800 | 0.024 | −0.076 | 8 | 0.865* | 0.789 | 0.110 | 0.089 |
| LT10 | 7 | 0.816 | 0.882 | 0.038 | −0.084 | 7 | 0.814 | 0.950 | 0.000 | −0.173 | 7 | 0.859 | 1.000 | 0.000 | −0.169 |
| LT12 | 5 | 0.779 | 0.765 | 0.000 | 0.019 | 5 | 0.768 | 0.900 | 0.000 | −0.177 | 6 | 0.831 | 0.895 | 0.000 | −0.079 |
| LT15 | 5 | 0.779 | 0.882 | 0.000 | −0.137 | 6 | 0.814 | 0.750 | 0.028 | 0.081 | 4 | 0.708 | 0.842 | 0.012 | −0.195 |
| LT16 | 8 | 0.850 | 0.765 | 0.199 | 0.103 | 8 | 0.879 | 0.850 | 0.030 | 0.034 | 6 | 0.812 | 0.632 | 0.095 | 0.223 |
| LT18 | 6 | 0.820 | 0.706 | 0.058 | 0.143 | 7 | 0.821 | 0.850 | 0.000 | −0.035 | 5 | 0.700 | 0.895 | 0.000 | −0.289 |
| LT25 | 7 | 0.872* | 0.824 | 0.165 | 0.057 | 4 | 0.781 | 0.850 | 0.034 | −0.091 | 6 | 0.797 | 0.737 | 0.046 | 0.077 |
| LT28 | 6 | 0.804 | 0.824 | 0.000 | −0.025 | 6 | 0.833 | 0.850 | 0.036 | −0.020 | 6 | 0.835 | 0.895 | 0.000 | −0.074 |
Note: A = total number of alleles per locus; FIS = inbreeding coefficient; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals sampled; r = null allele frequency.
Population and voucher information are provided in Appendix 1.
Significant departure from HWE at P < 0.01.
There are just two species in the genus Lancea Hook. f. & Thomson, L. tibetica and L. hirsuta Bonati. We tested cross-amplification in L. hirsuta for all of the polymorphic primers developed for L. tibetica. Lancea hirsuta is distributed in northwestern Sichuan and northwestern Yunnan, China. We sampled five individuals from Xinduqiao (voucher no. Zhang2015569; geographic coordinates: 30°04′N, 101°29′E; altitude: 3496 m), Sichuan, China. All of the polymorphic primers were successfully amplified in L. hirsuta with the same PCR conditions used for L. tibetica, except for marker LT28.
CONCLUSIONS
In this study, we present the first report on L. tibetica SSR marker development based on RAD sequences. A total of 4441 SSR markers were identified at the genome-wide level. The 10 SSR loci that displayed polymorphisms among L. tibetica populations also have the potential to be useful for population genetic studies on the closely related L. hirsuta.
Appendix 1.
Locality information for Lancea tibetica populations in the study.
| Population code | Location | N | Voucher no.a | Geographic coordinates | Altitude (m) |
| YD | Yadong, Xizang, China | 17 | Chen2014498 | 27°47′26″N, 99°08′52″E | 4350 |
| QML | Qumalai, Qinghai, China | 20 | Chen2014684 | 33°58′03″N, 96°34′39″E | 4570 |
| MY | Menyuan, Qinghai, China | 19 | Zhang2014341 | 37°51′00″N, 101°04′51″E | 3636 |
Note: N = number of individuals sampled.
The voucher specimens are deposited in the Herbarium of the Northwest Institute of Plateau Biology (HNWP), Chinese Academy of Sciences, Xining, Qinghai Province, China.
LITERATURE CITED
- Barchi L., Lanteri S., Portis E., Acquadro A., Valè G., Toppino L., Rotino G. L. 2011. Identification of SNP and SSR markers in eggplant using RAD tag sequencing. BMC Genomics 12: 304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bolger A., Lohse M., Usadel B. 2014. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics (Oxford, England) doi:10.1093/bioinformatics/btu170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chapuis M. P., Estoup A. 2007. Microsatellite null alleles and estimation of population differentiation. Molecular Biology and Evolution 24: 621–631. [DOI] [PubMed] [Google Scholar]
- Chutimanitsakun Y., Nipper R. W., Cuesta-Marcos A., Cistué L., Corey A., Filichkina T., Johnson E. A., Hayes P. M. 2011. Construction and application for QTL analysis of a restriction site associated DNA (RAD) linkage map in barley. BMC Genomics 12: 4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Doyle J. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15. [Google Scholar]
- Hong D. Y., Yang H. B., Jin C. L., Noel H. H. 1998. Scrophulariaceae. In Z. Y. Wu and P. H. Raven [eds.], Flora of China, vol. 18. Science Press, Beijing, China, and Missouri Botanical Garden Press, St. Louis, Missouri, USA. [Google Scholar]
- Li W., Godzik A. 2006. Cd-hit: A fast program for clustering and comparing large sets of protein or nucleotide sequences. Bioinformatics (Oxford, England) 22: 1658–1659. [DOI] [PubMed] [Google Scholar]
- Litt M., Luty J. A. 1989. A hypervariable microsatellite revealed by in vitro amplification of a dinucleotide repeat within the cardiac muscle actin gene. American Journal of Human Genetics 44: 397–401. [PMC free article] [PubMed] [Google Scholar]
- Miller M. P., Knaus B. J., Mullins T. D., Haig S. M. 2013. SSR pipeline: A bioinformatic infrastructure for identifying microsatellites from paired-end Illumina high-throughput DNA sequencing data. Journal of Heredity 104: 881–885. [DOI] [PubMed] [Google Scholar]
- Miller M. R., Dunham J. P., Amores A., Cresko W. A., Johnson E. A. 2007. Rapid and cost-effective polymorphism identification and genotyping using restriction site associated DNA (RAD) markers. Genome Research 17: 240–248. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rousset F. 2008. GENEPOP’007: A complete re-implementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8: 103–106. [DOI] [PubMed] [Google Scholar]
- Song Z. H., Wang Y. H., Qian Z. Z., Smillie T. J., Khan I. A. 2011. Quantitative determination of 10 phenylpropanoid and lignan compounds in Lancea tibetica by high-performance liquid chromatography with UV detection. Planta Medica 77: 1562–1566. [DOI] [PubMed] [Google Scholar]
- Untergasser A., Cutcutache I., Koressaar T., Ye J., Faircloth B. C., Remm M., Rozen S. G. 2012. Primer3: New capabilities and interfaces. Nucleic Acids Research 40: e115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang L., Xu J., Xia T., Zhang H., Liu D., Shen Y. 2014. Population structure and linkage disequilibrium in six-rowed barley landraces from the Qinghai-Tibetan Plateau. Crop Science 54: 2011–2022. [Google Scholar]
- Zerbino D., Birney E. 2008. Velvet: Algorithms for de novo short read assembly using de Bruijn graphs. Genome Research 18: 821–829. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang F. Q., Gao Q. B., Khan G., Luo K. M., Chen S. L. 2014. Comparative transcriptome analysis of aboveground and underground tissues of Rhodiola algida, an important ethno-medicinal herb endemic to the Qinghai-Tibetan Plateau. Gene 553: 90–97. [DOI] [PubMed] [Google Scholar]