Abstract
Premise of the study:
Microsatellite primers were developed to investigate population genetic structure in Lindera glauca (Lauraceae).
Methods and Results:
Twenty-five microsatellite primers were developed and optimized for L. glauca using Illumina’s Solexa sequencing technology. These novel primers were found to be polymorphic in nine wild L. glauca populations with 81 total alleles confirmed and genotyped via capillary gel electrophoresis. The total number of alleles, observed heterozygosity, and expected heterozygosity for each population ranged from one to four, from 0.00 to 0.90, and from 0.00 to 0.79, respectively. In addition, the 25 primers were tested in 10 additional individuals of the related species L. communis, and all but four markers showed good amplification results.
Conclusions:
This set of microsatellite primers is the first specifically developed for L. glauca and will facilitate studies of genetic diversity and evolution among populations of this species.
Keywords: genetic diversity, Lauraceae, Lindera glauca, microsatellite, polymorphism
Lindera glauca Blume is a deciduous shrub or small tree that belongs to the family Lauraceae. It is extensively distributed in mountainous regions at low altitudes in central and southern China and is also found in Japan, Korea, and Taiwan. It is of potentially great economic value and ecological importance owing to its various valuable properties, including its natural abundance, the medicinal value of its leaves and roots, its high-quality wood, and the wide applications of its volatile oil in the biochemical and medicinal industries (Liu et al., 1992; Seki et al., 1994; Wang et al., 1994, 2011; Sun et al., 2011; Huh et al., 2014). However, few studies have investigated its population genetic diversity and genetic relationships among germplasms and breeding populations. Male individuals of L. glauca trees are very rare in China, and only female individuals are found in Japan (Dupont, 2002), although male individuals have been known from continental Asia in the past several decades (Wang, 1972; Li, 1982). Consequently, understanding the genetic diversity of this species is relevant to the utilization and conservation of its germplasm resources, to population genetic studies, and to the evolution of apomixis in this dioecious species.
Microsatellites, or simple sequence repeats (SSRs), have been widely used as genetic markers owing to their multiallelic nature, codominant inheritance, and thorough genome coverage (Powell et al., 1996). They are a powerful tool and an effective way to analyze population genetic structure, marker-assisted breeding, gene flow, levels of inbreeding, and germplasm identification (Varshney et al., 2005). However, no studies have previously published SSR markers for this species. Therefore, we used a next-generation transcriptome sequencing approach (Illumina’s Solexa sequencing technology) to develop microsatellites specifically for L. glauca.
METHODS AND RESULTS
Plant materials and DNA extraction
Leaves and fruits of wild L. glauca were collected from nine locations in China in 2014 and 2015 (Appendix 1). Genomic DNA was extracted from the leaves of one individual from each of nine total populations using a modified cetyltrimethylammonium bromide (CTAB) method (Doyle and Doyle, 1987).
Development of SSRs and primer design
In this study, we used transcriptome data from Niu et al. (2015) to develop microsatellite markers. We used the 163,427 unigenes from the transcriptome data for SSR exploitation using QDD version 3.1 software (Meglécz et al., 2014) with at least five, five, four, four, three, and two SSR motif repeat units for di-, tri-, tetra-, penta-, hexa-, and heptanucleotide and higher-order nucleotides, respectively. A total of 8969 putative SSRs (excluding mononucleotide repeats) were detected, with the majority of repeats being dinucleotide (66.83%), followed by trinucleotide (33.77%), tetranucleotide (1.87%), pentanucleotide (0.50%), and hexanucleotide (1.04%). With this detailed information, the program PRIMER 5 (PRIMER-E, Auckland, New Zealand) was then used to design 27,350 primer pairs with primer lengths of 18–25 bp, amplification product sizes of 100–400 bp, GC contents from 40% to 60%, and annealing temperatures ranging from 55°C to 65°C.
PCR amplification and fragment analysis
An initial polymorphism screening of 120 primer pairs, including 50 primer pairs for dinucleotide motifs, 40 for trinucleotide motifs, 15 for tetranucleotide motifs, 10 for pentanucleotide motifs, and five for hexanucleotide motifs, was performed using polyacrylamide gel electrophoresis. We hand-selected 120 loci based on desired criteria (representative loci with different repeat unit lengths), of which 25 (20.83%) were successfully amplified and found to be polymorphic in the nine wild L. glauca populations (Appendix 1, Table 1), while 71 (59.17%) primer pairs produced no product, 21 (17.50%) amplified monomorphic markers or identical heterozygotic genotypes, and three (2.50%) produced larger or smaller products than the expected size. Forward primers of the 25 primer pairs were further labeled with fluorescently labeled nucleotides (M13: 5′-TGTAAAACGACGGCCAGT-3′). PCR reactions were performed in a total reaction volume of 15 μL, which contained 7.5 μL of 2× Taq PCR MasterMix (Aidlab, Beijing, China), 1.0 μL of 30 ng/μL DNA, 5.5 μL of ddH2O, 0.5 μL of 10 μM reverse primer, 0.2 μL of 10 μM forward primer, and 0.3 μL of 10 μM fluorescent dyes (M13F-FAM, M13F-HEX, M13F-TAM, and M13F-ROX). Thermocycling program conditions included a 5-min melting step of 94°C; then 35 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 35 s; and a final extension step of 72°C for 10 min. Ten microliters each of all M13F-labeled PCR products were sent to the Ruibo Biotechnology Center DNA Sequencing Facility (Beijing, China) for fragment analysis using an ABI 3730XL DNA Analyzer with a GeneScan 500 LIZ Size Standard (Applied Biosystems, Changping, Beijing, China). Allele genotyping was performed using GeneMarker version 2.2.0 software (SoftGenetics, State College, Pennsylvania, USA).
Table 1.
Characteristics of 25 microsatellite loci developed for Lindera glauca.
| Locus | Primer sequences (5′–3′) | Fluorescent dye | Repeat motif | Allele size (bp) | Ta (°C) | GenBank accession no. |
| XBLG-013 | F: CGAGGGAGAGATCGACGC | FAM | (AG)5 | 190 | 58 | KX545436 |
| R: ATGGCACCACGAAGTGTGTT | ||||||
| XBLG-033 | F: CGGGATGACAATTTGCATGT | HEX | (AG)5 | 259 | 58 | KX545437 |
| R: TGGAGCAGATTATGGTTTCCA | ||||||
| XBLG-036 | F: CATCACCTCCCTCAAATCCC | FAM | (AG)7 | 263 | 58 | KX545438 |
| R: GTTTCCGAAATTCTCGAGGC | ||||||
| XBLG-049 | F: TTTCACAACCAGGGTGGCTA | TAM | (AC)6 | 191 | 58 | KX545439 |
| R: CACTGGGACTAAGACACGGC | ||||||
| XBLG-051 | F: CAAACAGAACCAAGACATCCAA | HEX | (ATAC)6 | 148 | 55 | KX545440 |
| R: ATGGAGGAGCATGATTCGAG | ||||||
| XBLG-053 | F: TCCTCTTATTCTCTTTCCTTTCTGA | TAM | (AT)7 | 268 | 55 | KX545441 |
| R: TCAGACCAACAGGAACATGC | ||||||
| XBLG-055 | F: CCTCTTCAAACCAAACCTCC | FAM | (AAG)5 | 236 | 55 | KX545442 |
| R: CTGCAACTCCATGTGAGGG | ||||||
| XBLG-056 | F: CAACTGTACGTGCTGTGGGT | ROX | (AG)8 | 283 | 55 | KX545443 |
| R: AGCCCACACCAGATCTTCAC | ||||||
| XBLG-058 | F: AGTCCAGGCTAACCAGACTCC | HEX | (AAC)6 | 277 | 55 | KX545444 |
| R: CCCAGTTTGCCAGGTAAGAA | ||||||
| XBLG-060 | F: ATTCCACCCATTCCCTTCTT | FAM | (AAG)6 | 197 | 55 | KX545445 |
| R: GATTCTAAGAAGAAGAAGAAAGTACCC | ||||||
| XBLG-062 | F: AACATCATTCCCTCCATCCA | ROX | (AATCC)5 | 192 | 55 | KX545446 |
| R: CCAGCCAGTTAGGGTTTCAC | ||||||
| XBLG-063 | F: CATGGCAACGCAAATCCTAT | TAM | (ATC)6 | 196 | 55 | KX545447 |
| R: CTAGATCCTTTGGCCATGTTT | ||||||
| XBLG-066 | F: GTCGACGAGGACGAGGAC | HEX | (CCG)5 | 187 | 55 | KX545448 |
| R: TCGAATGAGGAAAGTTTGGC | ||||||
| XBLG-073 | F: ACCACAAAGATAAGCTACAATGC | FAM | (ACGC)5 | 219 | 55 | KX545449 |
| R: GGGCCTTAATGTCTATGGCA | ||||||
| XBLG-076 | F: GGATGCTCTAAGGTGCTTGC | ROX | (AG)7 | 182 | 55 | KX545450 |
| R: GGAATCGCCATTCTCCCT | ||||||
| XBLG-082 | F: TGTGGAAACAGAACCCATGA | TAM | (AGC)5 | 168 | 55 | KX545451 |
| R: ACAAAGCAGAGCTGCTGACA | ||||||
| XBLG-083 | F: CTCTCTCATCGATCCACCG | HEX | (AAG)5 | 186 | 55 | KX545452 |
| R: AAACCCAACACTGTACAACCTAAA | ||||||
| XBLG-084 | F: AAGTGAGGCGATACGATTGG | FAM | (AGG)5 | 144 | 55 | KX545453 |
| R: ACATGACCATAAACATGGGTGA | ||||||
| XBLG-086 | F: TTGGGACTAGGCTTTGATCG | TAM | (ACC)6 | 190 | 55 | KX545454 |
| R: CCCATCATCAATGTGGTTATAGA | ||||||
| XBLG-089 | F: TGTCTTGTGATCGAAATCAGG | FAM | (AG)7 | 177 | 55 | KX545455 |
| R: ACTTCAGAGGCATTCCAGCA | ||||||
| XBLG-092 | F: CTCAAGCCGATTGATGATCC | TAM | (AG)8 | 144 | 55 | KX545456 |
| R: TCATAACATGTCACATTCAAAGGA | ||||||
| XBLG-097 | F: TTTGGGAAAGTCCCATGAAA | TAM | (ATC)6 | 193 | 55 | KX545457 |
| R: GGGTACAAGTGGATACAATGAGG | ||||||
| XBLG-099 | F: TGCAAGGGTACATGCCATAG | ROX | (AC)7 | 165 | 55 | KX545458 |
| R: CCAAACATTTGCCCACTTCT | ||||||
| XBLG-111 | F: GAGAGGTACAACCACCCACG | HEX | (ACT)6 | 192 | 58 | KX545459 |
| R: GCCCGAAGTTAAGTAAATGGAT | ||||||
| XBLG-119 | F: GCATGGTGTGTTTGGTCAAG | ROX | (AAG)5 | 350 | 58 | KX545460 |
| R: TCTCAACAGACCCTCGTCG |
Note: Ta = annealing temperature.
Detection of SSR polymorphism and data analysis
The 25 novel polymorphic SSRs yielded 81 total alleles confirmed and genotyped via capillary gel electrophoresis. Using GENEPOP 3.2 software (Rousset, 2008) for each population, the resulting genotypic data from the capillary gel electrophoresis were analyzed to obtain standard descriptive statistics and to test for deviations from Hardy–Weinberg equilibrium (HWE) assumptions (Table 2). The total number of alleles ranged from one to four with a mean of 3.240. The observed and expected heterozygosity ranged from 0.00 to 0.90 and from 0.00 to 0.79 with averages of 0.201 and 0.479, respectively. HWE and linkage disequilibrium using Bonferroni correction were tested for every locus. Less than half of the loci (five, five, 12, nine, eight, seven, eight, seven, and seven loci in populations ATM, JGS, LDZ, SJG, NTB, YTH, DBS, HMF, and TMS, respectively) showed significant departure from HWE (P < 0.001). Significant linkage disequilibrium was not detected between any pair of loci (P < 0.001).
Table 2.
Descriptive statistics of the 25 newly developed polymorphic microsatellites of Lindera glauca.a
| Locus | ATM (n = 10) | JGS (n = 10) | LDZ (n = 10) | SJG (n = 10) | NTB (n = 10) | YTH (n = 10) | DBS (n = 10) | HMF (n = 10) | TMS (n = 10) | |||||||||||||||||||||||||||
| A | Ho | He | HWEb | A | Ho | He | HWEb | A | Ho | He | HWEb | A | Ho | He | HWEb | A | Ho | He | HWEb | A | Ho | He | HWEb | A | Ho | He | HWEb | A | Ho | He | HWEb | A | Ho | He | HWEb | |
| XBLG-013 | 3 | 0.30 | 0.54 | ** | 1 | 0.00 | 0.00 | M | 2 | 0.00 | 0.19 | *** | 4 | 0.00 | 0.69 | *** | 4 | 0.00 | 0.69 | *** | 4 | 0.20 | 0.67 | ** | 2 | 0.00 | 0.51 | *** | 2 | 0.00 | 0.34 | *** | 4 | 0.00 | 0.61 | *** |
| XBLG-033 | 1 | 0.00 | 0.00 | M | 3 | 0.00 | 0.65 | *** | 2 | 0.40 | 0.51 | n.s. | 3 | 0.00 | 0.59 | *** | 1 | 0.00 | 0.00 | M | 1 | 0.00 | 0.00 | M | 2 | 0.10 | 0.39 | ** | 2 | 0.00 | 0.51 | *** | 2 | 0.20 | 0.19 | n.s. |
| XBLG-036 | 2 | 0.30 | 0.52 | n.s. | 2 | 0.20 | 0.19 | n.s. | 2 | 0.00 | 0.19 | *** | 3 | 0.00 | 0.59 | *** | 2 | 0.10 | 0.27 | * | 2 | 0.00 | 0.19 | *** | 2 | 0.00 | 0.19 | *** | 2 | 0.10 | 0.10 | n.s. | 3 | 0.10 | 0.68 | *** |
| XBLG-049 | 3 | 0.20 | 0.56 | n.s. | 3 | 0.40 | 0.69 | n.s. | 3 | 0.10 | 0.65 | *** | 3 | 0.10 | 0.53 | *** | 2 | 0.20 | 0.19 | n.s. | 2 | 0.10 | 0.27 | * | 3 | 0.50 | 0.68 | n.s. | 3 | 0.10 | 0.64 | ** | 2 | 0.00 | 0.51 | *** |
| XBLG-051 | 3 | 0.20 | 0.61 | *** | 2 | 0.70 | 0.48 | n.s. | 3 | 0.90 | 0.65 | ** | 2 | 0.30 | 0.27 | n.s. | 3 | 0.30 | 0.43 | n.s. | 3 | 0.30 | 0.54 | n.s. | 3 | 0.00 | 0.36 | *** | 2 | 0.20 | 0.34 | n.s. | 3 | 0.10 | 0.68 | n.s. |
| XBLG-053 | 3 | 0.40 | 0.47 | n.s. | 2 | 0.40 | 0.34 | n.s. | 3 | 0.60 | 0.69 | n.s. | 2 | 0.00 | 0.51 | *** | 2 | 0.00 | 0.44 | *** | 3 | 0.10 | 0.62 | *** | 2 | 0.20 | 0.19 | n.s. | 3 | 0.10 | 0.59 | *** | 3 | 0.50 | 0.43 | n.s. |
| XBLG-055 | 3 | 0.30 | 0.69 | * | 3 | 0.60 | 0.57 | *** | 2 | 0.00 | 0.19 | *** | 2 | 0.00 | 0.51 | *** | 2 | 0.00 | 0.19 | ** | 3 | 0.00 | 0.48 | *** | 3 | 0.30 | 0.54 | ** | 3 | 0.00 | 0.65 | *** | 3 | 0.80 | 0.69 | * |
| XBLG-056 | 1 | 0.00 | 0.00 | M | 1 | 0.00 | 0.00 | M | 2 | 0.00 | 0.19 | *** | 3 | 0.20 | 0.35 | n.s. | 2 | 0.00 | 0.19 | *** | 2 | 0.30 | 0.48 | n.s. | 2 | 0.00 | 0.19 | *** | 2 | 0.00 | 0.34 | *** | 2 | 0.00 | 0.34 | *** |
| XBLG-058 | 3 | 0.30 | 0.53 | *** | 4 | 0.60 | 0.50 | n.s. | 2 | 0.70 | 0.48 | n.s. | 4 | 0.60 | 0.66 | n.s. | 4 | 0.30 | 0.72 | *** | 4 | 0.30 | 0.62 | *** | 4 | 0.40 | 0.69 | ** | 3 | 0.20 | 0.61 | ** | 4 | 0.20 | 0.65 | ** |
| XBLG-060 | 3 | 0.30 | 0.43 | *** | 1 | 0.00 | 0.00 | M | 4 | 0.20 | 0.36 | ** | 4 | 0.70 | 0.79 | n.s. | 3 | 0.20 | 0.57 | *** | 4 | 0.20 | 0.36 | ** | 2 | 0.20 | 0.34 | n.s. | 2 | 0.10 | 0.10 | n.s. | 2 | 0.10 | 0.27 | * |
| XBLG-062 | 1 | 0.00 | 0.00 | M | 1 | 0.00 | 0.00 | M | 1 | 0.00 | 0.00 | M | 3 | 0.30 | 0.28 | n.s. | 2 | 0.10 | 0.10 | n.s. | 4 | 0.30 | 0.44 | *. | 1 | 0.00 | 0.00 | M | 1 | 0.00 | 0.00 | M | 3 | 0.20 | 0.19 | n.s. |
| XBLG-063 | 2 | 0.20 | 0.44 | n.s. | 3 | 0.10 | 0.43 | *** | 2 | 0.00 | 0.19 | *** | 2 | 0.20 | 0.21 | * | 3 | 0.30 | 0.59 | *** | 3 | 0.30 | 0.56 | n.s. | 3 | 0.20 | 0.35 | n.s. | 2 | 0.00 | 0.51 | *** | 2 | 0.10 | 0.52 | ** |
| XBLG-066 | 1 | 0.00 | 0.00 | M | 1 | 0.00 | 0.00 | M | 2 | 0.00 | 0.19 | *** | 2 | 0.10 | 0.10 | n.s. | 1 | 0.00 | 0.00 | M | 2 | 0.10 | 0.10 | n.s. | 2 | 0.90 | 0.52 | * | 2 | 0.50 | 0.39 | n.s. | 2 | 0.50 | 0.39 | n.s. |
| XBLG-073 | 1 | 0.00 | 0.00 | M | 2 | 0.20 | 0.19 | n.s. | 2 | 0.00 | 0.19 | *** | 1 | 0.00 | 0.00 | M | 1 | 0.00 | 0.00 | M | 2 | 0.10 | 0.27 | n.s. | 1 | 0.00 | 0.00 | M | 2 | 0.30 | 0.27 | n.s. | 2 | 0.10 | 0.10 | n.s. |
| XBLG-076 | 1 | 0.00 | 0.00 | M | 1 | 0.00 | 0.00 | M | 2 | 0.60 | 0.44 | n.s. | 2 | 0.50 | 0.39 | n.s. | 2 | 0.30 | 0.27 | n.s. | 2 | 0.40 | 0.34 | n.s. | 3 | 0.40 | 0.35 | n.s. | 2 | 0.50 | 0.39 | n.s. | 3 | 0.20 | 0.54 | n.s. |
| XBLG-082 | 3 | 0.20 | 0.19 | n.s. | 3 | 0.20 | 0.19 | n.s. | 3 | 0.30 | 0.42 | n.s. | 3 | 0.50 | 0.54 | n.s. | 3 | 0.30 | 0.62 | * | 3 | 0.30 | 0.59 | *** | 2 | 0.00 | 0.34 | *** | 3 | 0.30 | 0.62 | ** | 3 | 0.20 | 0.66 | ** |
| XBLG-083 | 3 | 0.30 | 0.54 | n.s. | 2 | 0.30 | 0.27 | n.s. | 3 | 0.00 | 0.36 | *** | 3 | 0.30 | 0.58 | * | 3 | 0.10 | 0.42 | ** | 3 | 0.10 | 0.56 | * | 2 | 0.00 | 0.19 | *** | 2 | 0.10 | 0.10 | n.s. | 2 | 0.00 | 0.19 | *** |
| XBLG-084 | 2 | 0.10 | 0.52 | * | 2 | 0.00 | 0.44 | *** | 2 | 0.00 | 0.53 | *** | 3 | 0.00 | 0.61 | *** | 2 | 0.40 | 0.51 | n.s. | 2 | 0.30 | 0.48 | n.s. | 2 | 0.00 | 0.34 | *** | 3 | 0.10 | 0.53 | *** | 3 | 0.20 | 0.54 | n.s. |
| XBLG-086 | 1 | 0.00 | 0.00 | M | 1 | 0.00 | 0.00 | M | 2 | 0.20 | 0.34 | n.s. | 2 | 0.10 | 0.27 | * | 2 | 0.20 | 0.34 | n.s. | 2 | 0.00 | 0.51 | *** | 3 | 0.20 | 0.54 | * | 3 | 0.20 | 0.65 | ** | 2 | 0.30 | 0.27 | n.s. |
| XBLG-089 | 2 | 0.30 | 0.27 | n.s. | 1 | 0.00 | 0.00 | M | 1 | 0.00 | 0.00 | M | 1 | 0.00 | 0.00 | M | 2 | 0.40 | 0.51 | n.s. | 1 | 0.00 | 0.00 | M | 1 | 0.00 | 0.00 | M | 2 | 0.60 | 0.44 | n.s. | 2 | 0.20 | 0.53 | * |
| XBLG-092 | 2 | 0.40 | 0.51 | n.s. | 3 | 0.80 | 0.57 | n.s. | 2 | 0.00 | 0.19 | *** | 4 | 0.40 | 0.76 | * | 2 | 0.10 | 0.39 | ** | 3 | 0.50 | 0.67 | * | 2 | 0.20 | 0.34 | n.s. | 3 | 0.10 | 0.51 | ** | 4 | 0.50 | 0.66 | * |
| XBLG-097 | 3 | 0.60 | 0.68 | * | 3 | 0.90 | 0.59 | n.s. | 3 | 0.10 | 0.28 | *** | 3 | 0.40 | 0.48 | *** | 3 | 0.20 | 0.57 | n.s. | 4 | 0.30 | 0.60 | n.s. | 3 | 0.20 | 0.19 | n.s. | 3 | 0.20 | 0.19 | n.s. | 4 | 0.70 | 0.66 | n.s. |
| XBLG-099 | 3 | 0.20 | 0.57 | *** | 3 | 0.20 | 0.56 | n.s. | 2 | 0.10 | 0.10 | n.s. | 2 | 0.00 | 0.51 | *** | 3 | 0.00 | 0.65 | *** | 3 | 0.10 | 0.69 | *** | 2 | 0.10 | 0.39 | ** | 3 | 0.50 | 0.47 | n.s. | 4 | 0.30 | 0.75 | *** |
| XBLG-111 | 3 | 0.20 | 0.36 | *** | 3 | 0.10 | 0.43 | *** | 3 | 0.60 | 0.65 | ** | 3 | 0.20 | 0.62 | ** | 2 | 0.00 | 0.19 | *** | 2 | 0.20 | 0.53 | ** | 2 | 0.00 | 0.44 | *** | 3 | 0.20 | 0.28 | * | 2 | 0.30 | 0.52 | n.s. |
| XBLG-119 | 2 | 0.30 | 0.48 | n.s. | 2 | 0.10 | 0.39 | ** | 2 | 0.10 | 0.48 | ** | 2 | 0.30 | 0.39 | n.s. | 2 | 0.10 | 0.52 | ** | 2 | 0.20 | 0.53 | * | 2 | 0.10 | 0.52 | ** | 2 | 0.10 | 0.52 | ** | 2 | 0.00 | 0.19 | *** |
| Mean | 2.20 | 0.20 | 0.36 | 2.00 | 0.23 | 0.30 | 2.14 | 0.20 | 0.34 | 2.64 | 0.21 | 0.46 | 2.32 | 0.14 | 0.37 | 2.64 | 0.22 | 0.44 | 2.24 | 0.16 | 0.34 | 2.40 | 0.18 | 0.40 | 2.72 | 0.27 | 0.47 | |||||||||
Note: A = total number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; HWE = Hardy–Weinberg equilibrium; n = number of individuals sampled.
Locality and voucher information are provided in Appendix 1.
Asterisks indicate significant deviation from Hardy–Weinberg equilibrium (*P < 0.05, **P < 0.01, ***P < 0.001); M = monomorphic; n.s. = not significant.
Cross-species amplifications
The 25 primers were tested in 10 individuals of L. communis Hemsl. under the same PCR conditions as above. All 25 were found to amplify in at least 21 of the species (Table 3).
Table 3.
Cross-amplification results for the 25 polymorphic cDNA-SSR loci developed for Lindera glauca in 10 individuals of L. communis.a
| Locus | LC001 | LC002 | LC004 | LC005 | LC009 | LC010 | LC011 | LC019 | LC021 | LC022 |
| XBLG-013 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 1 | 0 |
| XBLG-033 | 0 | 1 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 |
| XBLG-036 | 1 | 0 | 0 | 1 | 0 | 1 | 1 | 0 | 0 | 0 |
| XBLG-049 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 0 | 1 |
| XBLG-051 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
| XBLG-053 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
| XBLG-055 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | 1 | 1 |
| XBLG-056 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 1 |
| XBLG-058 | 0 | 0 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
| XBLG-060 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 1 |
| XBLG-062 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
| XBLG-063 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
| XBLG-066 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 0 |
| XBLG-073 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 0 | 1 |
| XBLG-076 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 |
| XBLG-082 | 1 | 0 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
| XBLG-083 | 1 | 1 | 1 | 0 | 0 | 1 | 0 | 1 | 1 | 1 |
| XBLG-084 | 1 | 0 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 0 |
| XBLG-086 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | 1 | 1 |
| XBLG-089 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 1 |
| XBLG-092 | 0 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 1 |
| XBLG-097 | 1 | 0 | 1 | 0 | 1 | 1 | 1 | 1 | 1 | 1 |
| XBLG-099 | 0 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
| XBLG-111 | 1 | 0 | 1 | 0 | 1 | 1 | 1 | 0 | 1 | 0 |
| XBLG-119 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 |
Note: 1 = successful amplification; 0 = failed amplification.
LC = population names of Lindera communis. Samples were collected in Longjiang County, Yunnan Province, China (geographic coordinates: 24°46′33″N, 98°39′25″E; elevation: 1219 m) and identification codes are kept at the Laboratory of Systematic Evolution and Biogeography of Woody Plants, School of Nature Conservation, Beijing Forestry University, Beijing, China.
CONCLUSIONS
In the current study, we developed 25 novel cDNA-SSR markers that were highly polymorphic in L. glauca and used these markers to successfully investigate genetic distances within nine wild populations of L. glauca. The collection of SSRs presented herein provide a means to assess genetic diversity and to further investigate large-scale and fine-scale population genetic structure in L. glauca. These markers may also be useful for germplasm identification and breeding programs in both this species and other species in the genus Lindera Thunb.
Appendix 1.
Location and sampling information for Lindera glauca individuals used in this study.a
| Population | Sample accession no. | Geographic coordinates | Elevation (m) | Province in China | County | n | |
| Latitude | Longitude | ||||||
| ATM | A14-10 | 31°13′30″N | 115°51′35″E | 646–834 | Anhui | Jinzhai | 10 |
| JGS | J13-09 | 31°52′15″N | 114°05′13″E | 203–317 | Henan | Xinyang | 10 |
| LDZ | L14-04 | 31°56′47″N | 114°15′26″E | 154–261 | Henan | Dongzhai | 10 |
| SJG | S14-10 | 31°44′58″N | 115°32′29″E | 243–476 | Henan | Shangcheng | 10 |
| NTB | N14-04 | 32°19′45″N | 113°25′24″E | 241–256 | Henan | Tongbai | 10 |
| YTH | Y14-04 | 31°03′24″N | 115°51′54″E | 647–734 | Hubei | Yingshan | 10 |
| DBS | D14-09 | 31°00′32″N | 115°50′12″E | 834–1003 | Hubei | Yingshan | 10 |
| HMF | H14-09 | 28°26′51″N | 113°00′22″E | 224–257 | Hunan | Wangcheng | 10 |
| TMS | T14-09 | 30°19′28″N | 119°26′56″E | 359–432 | Zhejiang | Linan | 10 |
Note: n = number of individuals sampled.
Sample accession numbers refer to voucher specimens deposited in the Herbarium of the Beijing Forestry University (BJFC), Beijing, China; geographic coordinates and elevation were obtained with a portable GPS receiver.
LITERATURE CITED
- Doyle J. J., Doyle J. L. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15. [Google Scholar]
- Dupont Y. L. 2002. Evolution of apomixis as a strategy of colonization in the dioecious species Lindera glauca (Lauraceae). Population Ecology 44: 293–297. [Google Scholar]
- Huh G. W., Park J. H., Kang J. H., Jeong T. S., Kang H. C., Baek N. I. 2014. Flavonoids from Lindera glauca Blume as low-density lipoprotein oxidation inhibitors. Natural Product Research 28: 831–834. [DOI] [PubMed] [Google Scholar]
- Li X. W. 1982. Flora Reipublicae Popularis Sinicae, Vol. 31: Lauraceae and Hernandiaceae, 393–394. Science Press, Beijing, China. [Google Scholar]
- Liu L. D., Gu J., Chen J. 1992. Studies on the chemical constituents of the leaf of Lindera glauca (Sieb et Zucc) Bl and their uses. Jiangxi Science 1: 007. [Google Scholar]
- Meglécz E., Pech N., Gilles A., Dubut V., Hingamp P., Trilles A., Grenier R., Martin J.-F. 2014. QDD version 3.1: A user-friendly computer program for microsatellite selection and primer design revisited: Experimental validation of variables determining genotyping success rate. Molecular Ecology Resources 14: 1302–1313. [DOI] [PubMed] [Google Scholar]
- Niu J., Hou X. Y., Fang C. L., An J. Y., Ha D. L., Qiu L., Ju Y. X., et al. 2015. Transcriptome analysis of distinct Lindera glauca tissues revealed the differences in the unigenes related to terpenoid biosynthesis. Gene 559: 22–30. [DOI] [PubMed] [Google Scholar]
- Powell W., Machray G. C., Provan J. 1996. Polymorphism revealed by simple sequence repeats. Trends in Plant Science 1: 215–222. [Google Scholar]
- Rousset F. 2008. GENEPOP’007: A complete re-implementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8: 103–106. [DOI] [PubMed] [Google Scholar]
- Seki K., Sasaki T., Haga K., Kaneko R. 1994. Two methoxybutanolides from Lindera glauca. Phytochemistry 36: 949–951. [Google Scholar]
- Sun H. L., Wang J. X., Gu X. Z., Kang W. Y. 2011. Analysis of volatile compounds from leaves and fruits of Lindera glauca. Chinese Journal of Experimental and Traditional Medical Formulae 7: 033. [Google Scholar]
- Varshney R. K., Graner A., Sorrells M. E. 2005. Genic microsatellite markers in plants: Features and applications. Trends in Biotechnology 23: 48–55. [DOI] [PubMed] [Google Scholar]
- Wang R., Tang S., Zhai H., Duan H. 2011. Studies on anti-tumor metastatic constituents from Lindera glauca. China Journal of Chinese Materia Medica 36: 1032–1036. [PubMed] [Google Scholar]
- Wang W. C. 1972. Higher plants iconography of China. In W. C. Wang , Vol. 1, 853. Science Press, Beijing, China. [Google Scholar]
- Wang Y., Gao X., Yu X., Cheng S., Kong L. 1994. Study on the resource and its utilizations of Lindera glauca in China. Henan Science 12: 331–334. [Google Scholar]