Abstract
Glycogen synthesis by mink uterine glandular and luminal epithelia (GE and LE) is stimulated by estradiol (E2) during estrus. Subsequently, the glycogen deposits are mobilized to near completion to meet the energy requirements of pre-embryonic development and implantation by as yet undetermined mechanisms. We hypothesized that progesterone (P4) was responsible for catabolism of uterine glycogen reserves as one of its actions to ensure reproductive success. Mink were treated with E2, P4 or vehicle (controls) for three days and uteri collected 24h (E2, P4 and vehicle) and 96h (E2) later. To evaluate E2 priming, mink were treated with E2 for three days, then P4 for an additional three days (E2→P4) and uteri collected 24h later. Percent glycogen content of uterine epithelia was greater at E2+96h (GE=5.71±0.55; LE=11.54±2.32) than E2+24h (GE=3.63±0.71; LE =2.82±1.03), and both were higher than controls (GE=0.27± 0.15; LE=0.54±0.30; P < 0.05). Treatment as E2→P4 reduced glycogen content (GE=0.61±0.16; LE=0.51±0.13), to levels not different from controls, while concomitantly increasing catabolic enzyme (glycogen phosphorylase and glucose 6 phosphatase) gene expression and amount of phosphoglycogen synthase protein (inactive) in uterine homogenates. Interestingly, E2→P4 increased glycogen synthase 1 mRNA and hexokinase mRNA (and protein). Our findings suggest to us that while E2 promotes glycogen accumulation by the mink uterus during estrus and pregnancy it is P4 that induces uterine glycogen catabolism releasing the glucose that is essential to support pre-embryonic survival and implantation.
Keywords: Progesterone, estradiol, glycogen, uterus, mink
INTRODUCTION
Pre-embryonic growth, implantation and early fetal development are dependent upon uterine glandular and luminal epithelial cell secretions (histotroph) containing glucose, glycogen, amino acids, fats, ions and hormones (Gray et al. 2001; Burton et al. 2002; Hempstock et al. 2004). Although gluconeogenesis does not occur in the uterus (Zimmer & Magnuson 1990; Yánez et al. 2003) glucose is taken up, transported into the uterine lumen, metabolized as an energy substrate and when in excess, stored as glycogen.
Glycogen synthesis begins with phosphorylation of glucose by hexokinase (Hk), producing glucose-6-phosphate, which is isomerized to glucose-1-phosphate and converted to uridine diphosphate glucose (Ferrer et al. 2003). Glucosyl units from the latter are transferred to non-reducing ends of glycogen molecules by glycogen synthase (Gys). Glycogen is catabolized by glycogen phosphorylase (Pyg), releasing glucose-1-phosphate, which may be isomerized to glucose-6-phosphate and enter the glycolytic pathway, or be dephosphorylated by glucose-6-phosphatase (G6pc), releasing glucose for export to the systemic circulation and/or uterine lumen.
Uterine glycogen content in rodents peaks during proestrus to estrus, and is mobilized during implantation and pregnancy (Demers et al. 1972; Greenstreet & Fotherby 1973a). Similarly, the human uterus stores large amounts of glycogen during the late proliferative to early secretory phases, that is mobilized by the late secretory phase (Verma 1983; Cornillie et al. 1985; Spornitz 1992). In mink, uterine glandular and luminal epithelial glycogen content decreased 99% between estrus and the peri-implantation period (Dean et al. 2014). Mink are seasonal breeders exhibiting obligatory embryonic diapause and may have blastocysts (as many as 17) in a state of arrested development for 50–60 days post coitum, resulting in delayed implantation (Hansson 1947; Enders 1952). It is likely that mink uterine glycogen reserves are a potential source of energy that supports pre-embryonic survival and implantation. In support of this contention, the uterine glycogen content of sterile women or those exhibiting spontaneous abortions, was greatly diminished when compared to normal women and in some cases absent (Hughes et al. 1963,1969; Rubulis et al. 1965; Maeyama et al. 1977; Zawar et al. 2003; Girish et al. 2012).
Uterine glycogen synthesis is stimulated by estradiol (E2) in rats, rabbits, guinea pigs (Demers et al. 1972; Demers et al. 1973a,b; Greenstreet & Fotherby 1973b) and mink (Rose et al. 2011). In the ovariectomized rat, exogenous E2 increased uterine glycogen content as expected (Paul & Duttagupta 1973). However, when treated concomitantly with E2 and progesterone (P4), uterine glycogen concentrations were reduced when compared to E2 alone. Demers and Jacobs (1973) treated ovariectomized rabbits and guinea pigs with E2 followed by P4 (E2→P4) to simulate E2 priming and reported a reduction in uterine glycogen content and a 2-fold increase in glycogen phosphorylase activity, compared to E2 alone. These findings suggest that P4 promotes uterine glycogen catabolism and/or antagonizes the glycogenic actions of E2.
Circulating E2 concentrations in mink increase after mating, then decline during the variable period of embryonic diapause and increase again during the peri-implantation period (Lagerkvist et al. 1992). Plasma P4 concentrations in mink remain low until the vernal equinox (regardless of the time of mating), then increase concomitantly with E2 during the peri-implantation period. It is possible that E2 promotes glycogen accumulation during proestrus and estrus, and that after mating and ovulation, P4 induces glycogen mobilization. If this is true, the mink uterus must be extremely sensitive to P4 at this time, since circulating concentrations of the steroid, while increasing, are very low until late diapause (Lagerkvist et al. 1992). Nevertheless, increased uterine sensitivity to P4, in response to E2 induced up regulation of P4 receptors, may result in a uterus that responds to low (perhaps unchanging) P4 concentrations.
To determine if P4 might induce glycogen catabolism and/or decrease glycogen synthesis in the mink uterus, animals were bilaterally ovariectomized and treated with E2 and P4 alone or to simulate E2 priming, E2 followed by P4 (E2→P4). Uteri were analyzed for, (1). Glycogen content of endometrium, myometrium, stroma, glandular and luminal epithelia, (2). Relative mRNA expression levels for glycogen synthase 1 (Gys1), glycogen phosphorylase (Pygm), hexokinase 1(Hk1),and glucose-6-phosphatase 3 (G6pc3), and (3). Protein levels for Gys1 and Hk1.
MATERIALS AND METHODS
Animals
Twenty-five adult (18 to 19 month old) dark premiparous female mink (6–8 offspring per litter), were moved from outdoor ranch conditions to the indoor animal facility at Idaho State University in early November. Mink were housed individually, fed a mixture of chicken and fish by-products daily and received water ad libitum. Animals were exposed to a daily photoperiod approximating natural photoperiodic changes for southeastern Idaho (Rose 1995), at room temperatures between 22–28°C. All procedures involving animal care, surgery and hormone treatments were approved by the Institutional Animal Care and Use Committee of Idaho State University (ISU), and conformed to the Guide for the Care and Use of Laboratory Animals (Protocol #6410909).
Hormones
Estradiol 17 beta (E2; R187933; Sigma Chemical Co., St. Louis, MO, USA), and Progesterone (P4; P0130: Sigma Chemical Co.) were initially dissolved in 95% EtOH and then mixed in sesame oil as a vehicle for SC injection.
Treatments
On Day 0 (Nov 17) all mink were bilaterally ovariectomized through a single mid-ventral incision while under ketamine hydrochloride anesthesia (50 mg/kg body weight; Fort Dodge Animal Health, Fort Dodge, IA, USA). Animals were subsequently returned to their cages and for 11 days, allowing for recovery and natural elimination of residual ovarian hormones. On Day 12, animals were assigned at random to one of five groups (Fig. 1; N = 5/group). Mink in groups 2, 3, and 4 were each injected once daily on days 12, 13 and 14 with E2 (50 μg/kg body weight). Mink in group 5 each received daily injections of P4 (25 mg/kg body weight) on days 12, 13 and 14 while mink in group 4 each received P4 injections on days 15, 16 and 17. Animals in group 3 each received daily injections of vehicle on days 15, 16 and 17 while mink in group 1, received injections of vehicle only on days 12, 13 and 14 and represented controls. Twenty-four hours after the last perturbation, animals were killed with a lethal dose of Sleep-A-Way (Fort Dodge Animal Health), uteri were collected and quick frozen in liquid nitrogen.
Figure 1.
Twenty-five adult female mink were bilaterally ovariectomized on Nov 17 (Day 0). On Day 12, mink were assigned at random to one of 5 groups (N = 5/group) and treatments initiated. Mink in groups 2, 3 and 4 were each injected once daily, on days 12, 13 and 14 with estradiol 17beta (E2; 50 μg/kg body weight). On the same days, mink in group 5 each received daily injections of progesterone (P4; 25 mg/kg body weight). Mink in group 3, received daily injections of vehicle on days 15, 16 and 17 while mink in group 4 received daily injections of P4 on the same days to simulate E2 priming. Mink in group 1 received injections of vehicle only on days 12, 13 and 14 and represented controls. All animals were sacrificed 24h after the last perturbation (▼) with a lethal dose of Sleep-AWay (Fort Dodge Animal Health, Fort Dodge, IA, USA), the uteri collected and quick frozen in liquid nitrogen.
Glycogen Concentrations in Uterine Homogenates
Glycogen concentrations were determined using a modified procedure of Good et al. (1933). Uterine tissue (70–120 mg) from each mink was lyophilized for 3 days and homogenized in 20 volumes of 30% KOH. A 125 μL aliquot of the homogenate was incubated at 100°C for 30 min to denature enzymes and destroy free glucose. To isolate glycogen, samples were diluted with 1.2 vol (150 μL) 95% EtOH, frozen at −80°C for 60 min, thawed and centrifuged at 9,600 × g for 10 min. After discarding the supernatant, tubes were inverted and the pellet dried overnight. Subsequently, 100 μL of 1.0 N HCL was added to the pellet, heated at 100°C for 2.5 h to break down glycogen to D-glucose. Glucose concentrations, as an indicator of glycogen content, were determined using Wako Glucose Auto Kit (439–90901; Wako Chemicals USA, Inc., Richmond, VA, USA) according to the manufacturer’s instructions. Glucose was quantified spectrophotometrically (λ = 505 nm) by comparing unknowns against a standard curve of increasing glucose concentrations. All samples were analyzed in duplicate, in a single assay with an intra-assay coefficient of variation of 2.0%
Localization of glycogen deposits in uterine cross-sections
Uterine samples were fixed in 10% neutral buffered formalin, dehydrated and mounted in paraffin blocks. Transverse uterine sections (7 μm) were incubated with Periodic Acid Schiff (PAS) reagent and counter stained with hematoxylin. Images were captured digitally at 25, 200 and 400 × and analyzed using ImageJ software (Abramoff et al. 2004). For quantification of endometrial and myometrial glycogen content, three consecutive uterine cross-sectional images from each mink were analyzed at 25 × (whole uterine cross section) whereas for glandular and luminal epithelial glycogen content, a portion (at 400 ×) of each of three consecutive uterine cross sections were analyzed. Because PAS stains carbohydrates in addition to glycogen, an additional cross-section was pre-treated with diastase (A8220; Sigma Chemical Co.), to digest glycogen prior to PAS staining and served as a negative control. Glycogen content of each tissue was quantified by subtracting negative control values from sections stained with PAS without diastase and then expressed as a percentage of the area that stained positive for glycogen.
RNA isolation and conversion to cDNA
Total RNA was isolated from 20–30 mg uterine tissue from each mink using Qiagen RNeasy Fibrous Tissue Mini Kit (74104; QIAGEN, Valencia, CA, USA) as previously described (Rose et al. 2011). Samples were screened for protein contamination by measuring light absorption of each sample at 260 nm (DNA and RNA) and 280 nm (protein). Only RNA preparations with 260/280 ratio of 1.9 or greater were used for qPCR analysis. To eliminate any contaminating DNA, samples were treated with genomic (gDNA) wipeout buffer prior to the reverse-transcription reaction. Conversion of unstable RNA to stable cDNA transcripts (first strand transcripts) was achieved using QuantiTect Reverse Transcription Kit (205311; QIAGEN) according to the manufactures instruction.
Primer design
To produce primers specific to mink cDNA, we first used the Basic Local Alignment Search Tool (BLAST) from the National Center of Biotechnology Information (NCBI; NIH http://www.ncbi.nlm.nih.gov/sites/entrez?dbgenome), and designed conventional PCR primers for each gene of interest based on regions of homology between rats and other species. Using these primers, we amplified mink cDNA using the Qiagen HotSTarTaq® Master Mix Kit (203443; QIAGEN). We separated the resulting cDNA fragments by gel-electrophoresis and the band containing the gene fragment of interest were purified using a Millipore Ultra Free DNA Centrifugal Filter (42600; Millipore Corporation, Billerica, MA, USA). The nucleotide sequence for each gene of interest was then determined using Biosystems 3130XL Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Based on the resulting mink nucleotide sequence for each target gene of interest, primers were designed for qPCR (Table 1), and purchased from Integrated DNA Technologies (Coralville, IA, USA).
Table 1.
Primers for qPCR of mink uterine gene transcripts and amplicon characteristics
| Genes | Forward and reverse primers (5' to 3') | Amplicon (bp) | Melt temperature (°C) | Accession No. |
|---|---|---|---|---|
| Gys1 | AAGATGGCAGCCACGGACAAATTC TCAATAGTAGTGCCGACAGGGTCA |
110 | 87.5 ± 0.50 | KM084858 |
| Pygm | TCATCACCCTGTACAACCGCATCA AGCCTTCCCTCCAATCATCACAGT |
80 | 79.0 ± 0.35 | KM084856 |
| Hk1 | AATGCCAAAGAAATCCTGACCCGC TGGGTGTGCCCTTGTTATCTCGAA |
163 | 84.1 ± 0.43 | KM026508 |
| G6pc3 | CCCTACTGCCTCGCCCAGGT TGGGCTTGTGAGCTGGCCCTA |
117 | 86.4 ± 0.50 | KM015512 |
| Gapdh | AGGTCATCCATGACAACTTCGGCA ACCAGTGGAAGCAGGGATGATGTT |
152 | 84.8 ± 0.45 | KM025344 |
Gys1, glycogen synthase 1; Pygm, glycogen phosphorylase-muscle; Hk1, hexokinase 1; G6pc3, glucose 6-phosphatase 3; Gapdh, glyceraldehyde 3-phosphate dehydrogenase.
Quantitative PCR (qPCR)
All qPCR reactions were carried out in triplicate using QuantiTect SYBR® Green PCR Kit (204143; QIAGEN) as per the manufacture’s instructions. Forward and reverse primer concentrations were previously optimized and were added to 5 μl cDNA template (100–200 ng) per reaction. The PCR products were detected in real time by measuring SYBR-green fluorescence during the annealing stage using MJ Research Chromo4 Real-Time PCR System (Bio-Rad Laboratories, Hercules, CA, USA). Efficiency of amplicon doubling during each PCR cycle was, Gapdh: 97%, Gys1: 103%, Pygm: 98%, G6pc3: 97%, and Hk1: 100%. Negative controls contained no template and amplification was never above background. Primer specificity was determined using melt curve analysis, which resulted in a single melting temperature for each amplicon.
Fold changes in gene expression were determined using the relative standard curve method (Pfaffl 2001). Standard curves were generated from 3 pooled control mink uteri. The cDNA from these uteri was diluted (1:10, 1:100, 1:1,000 and 1:10,000) or undiluted to construct standard curves (cDNA ng/mL versus quantification cycle, Cq) for each gene of interest (R2 = 0.98–0.99). Data were averaged by treatment group (n = 5 mink/group, each assayed in triplicate) and expressed in terms of relative fold-difference compared to controls.
We chose Gapdh with which to normalize our data, as it showed the least variation in expression (Gapdh Cq for E2+24h = 21.59 ± 0.22, for E2+96h, Cq = 21.54 ± 0.38, for E2→P4, Cq = 21.64 ± 0.55, for P4 +24 h = 21.72 ± 0.33 and for controls, Cq = 22.28 ± 0.22), as compared to 18s rRNA (18s rRNA Cq for E2+24h, = 17.47 ± 0.58. for E2+96h, Cq = 18.34±0.39, for E2→P4, Cq = 17.97 ± 0.07, for P4 +24 h = 18.60 ± 0.56 and for Controls, Cq = 23.05 ± 0.48).
Western blot analysis
Uterine proteins were isolated using RIPA Lysis Buffer (sc-24948 Santa Cruz Biotechnology, Dallas, TX, USA) according to the manufacturer’s instructions. Protein concentrations were determined using Pierce BCA Protein Assay Kit (23225; Thermo Scientific, Rockford, IL, USA). Enzyme proteins of interest were resolved by molecular weight using SDS-PAGE, transferred to nitrocellulose membranes, and blocked for 1h in 5% milk buffer containing TBS-Tween 20 (BP337-100; Invitrogen, Pittsburgh, PA, USA) to reduce non-specific binding. Membranes were subsequently incubated overnight at 4°C with primary antibodies specific for Gys (3886S; Cell Signaling Technology, Danvers, MA, USA, 1:500 dilution), phosphorylated Gys (pGys: 3891S; Cell Signaling Technology, Danvers, MA, USA, 1: 500 dilution), Hk1 (2024S; Cell Signaling Technology, Danvers, MA, USA, 1:1000 dilution). Subsequently the membranes were washed in TBS-T to remove excess primary antibodies. At that time we incubated the membranes with secondary antibody (anti rabbit IgG conjugated to horseradish peroxidase; 7074, Cell Signaling Technology, 1:1000 dilution) for 2 h to detect the enzyme proteins of interest. Concomitantly (as a loading control) we incubated membranes with a primary antibody conjugated to horseradish peroxidase against beta-actin (Actb-HRP, 5125S; Cell Signaling Technology, 1:10,000 dilution) for 2 h. To blots with HRP conjugated to the secondary antibody we added Immobilon Western Chemiluminescent HRP Substrate (WBKLS0100; Millipore Corporation), while samples that were incubated with Actb-HRP were incubated with Novex HRP Chromogenic Substrate (100002903; Invitrogen, Grand Island, NY, USA). The resulting blots were photographed using Bio-Rad VersaDoc 3000 Imager (Bio-Rad Laboratories). The relative amount of each protein of interest was determined using ImageJ gel analyzer to quantify band density and then normalized to beta actin as a loading control. Data was then expressed as number of pixels per unit area, with all samples for each mink measured in triplicate.
To validate the use of primary antibodies against mink proteins, both mink and rat proteins were analyzed concurrently. For each protein assayed we detected only a single band corresponding to the correct molecular weight of each protein (Gys, pGys and Hk1) in both rat and mink uterine tissue (data not shown). All primary antibodies were produced against human proteins and validated by the manufacturer against rat proteins. Antibodies against Gys were not specific to a single isoform and would therefore bind to both Gys1 (muscle) and Gys2 (liver).
Statistical Analysis
All data were analyzed by one-way ANOVA, followed by Tukey’s post- hoc test (SigmaPlot, version 12.5; Systat Software Inc., San Jose, CA, USA). Differences were considered significant at P ≤ 0.05.
RESULTS
Uterine endometrial area was 4-fold greater at 24h and 6-fold greater at 96h after the last E2 injection when compared to ovariectomized controls (Table 2; P < 0.05). The endometrial area of mink treated as E2→P4, was less than E2+96h treated animals (P < 0.05), but did not differ from E2+24h mink. Although the endometrial area of E2→P4 and P4+24h treated mink tended to be greater than controls, the differences were not significant. Myometrial area was greater at 24 h (3.5 fold) and 96 h (2.5 fold) after the last E2 injection when compared to controls (Table 2; P < 0.05). The myometrial area of mink treated as E2→P4, did not differ from mink treated with E2 only (24 and 96h), and was greater when compared to controls (P < 0.05). Myometrial area of mink treated with P4+24h did not differ from ovariectomized controls.
Table 2.
Mean (± SE) uterine endometrial and myometrial areas (pixels × 104). Mink in Groups 2, 3 and 4 were each injected once daily on days 12, 13 and 14 with estradiol 17beta (E2; 50μg/kg body weight). On the same days, mink in Group 5 each received daily injections of progesterone (P4; 25mg/kg body weight). Mink in Group 3 received vehicle only on days 15, 16 and 17 while mink in Group 4 received daily injections of P4 on the same days. Mink in group 1 received vehicle only on days 12, 13 and 14 and represented controls. All mink were sacrificed approximately 24h after the last perturbation
| Group | Treatment | Endometrial area, (pixels × 104) | Myometrial area (pixels × 104) |
|---|---|---|---|
| 1 | Control | 3.87 ± 0.65a | 7.13 ± 0.57a |
| 2 | E2 + 24h | 16.14 ± 1.83b | 24.96 ± 4.00b |
| 3 | E2 + 96h | 24.87 ± 3.64c | 19.58 ± 1.20bc |
| 4 | E2→P4 | 11.55 ± 1.37ab | 20.31 ± 4.14bc |
| 5 | P4 + 24h | 8.59 ± 0.45ab | 9.67 ± 0.54ac |
Within a column, means without a common superscript differ (P ≤ 0.05)
Gross uterine glycogen concentrations in mink treated as E2+24h were higher than for all other treatments (Table 3, P≤0.05). In E2+96h treated mink, uterine glycogen concentrations were higher than controls (P≤0.05), but approximately 50% less than for E2+24h treated mink (P≤0.05). For E2→P4 treated mink uterine glycogen content was 70% less than for E2+24h treated animals (P≤0.05) and 40% less than mink treated as E2+96h. Treatment with P4+24h had no affect on gross uterine glycogen content when compared to controls.
Table 3.
Mean (± SE) glycogen concentrations (mg/g dry weight) in whole uteri, and percent glycogen content of endometrium and myometrium (% area PAS positive × 10). Mink in groups 2, 3, and 4 were each injected once daily, on days 12, 13 and 14 with estradiol 17beta (E2; 50 μg/kg body weight). On the same days, mink in group 5 each received daily injections of progesterone (P4; 25 mg/kg body weight). Mink in group 3 received vehicle only on days 15, 16 and 17 while mink in group 4 received daily injections of P4 on the same days. Mink in group 1 received vehicle only on days 12, 13 and 14 and represented controls. All mink were sacrificed approximately 24h after the last perturbation. Relative fold-increase above controls are given in parentheses
| Group | Treatment | Glycogen (mg/g dry weight) | Endometrial glycogen (% Area PAS+) | Myometrial glycogen (% Area PAS+) |
|---|---|---|---|---|
| 1 | Control | 2.72 ± 0.29a | 0.62 ± 0.39a | 2.79 ± 1.57a |
| 2 | E2 + 24h | 21.91 ± 3.09b (8) | 25.00 ± 4.77b (40) | 25.50 ± 4.82b (9) |
| 3 | E2 + 96h | 11.27± 2.04c (4) | 17.39 ± 2.75b (28) | 15.70 ± 3.67b (5) |
| 4 | E2 →P4 | 6.80 ± 0.44c (2) | 4.39 ± 1.33a (7) | 1.69 ± 0.31a |
| 5 | P4 + 24h | 3.79 ± 0.54a | 0.02 ± 0.01a | 1.68 ± 0.57a |
Within a column, means without a common superscript differ (P ≤ 0.05).
ImageJ analyses revealed that both endometrial and myometrial glycogen content were higher in E2+24h and E2+96h treated mink, when compared to all other treatments (Table 3, P≤0.05). The glycogen content of both tissues tended to be lower in E2+96h mink when compared to E2+24h animals but the differences were not significant. Mink treated as E2→P4 had endometrial and myometrial glycogen concentrations that did not differ from controls or mink treated as P4+ 24h.
Glycogen content of the glandular and luminal epithelia was highest in E2+96h mink when compared to all other treatments (Table 4; P ≤ 0.05). In E2+24h mink, glycogen content of both epithelia was less than for E2+96h mink, but higher than mink treated with P4+24h, E2→P4 or as controls (P ≤ 0.05). There was no difference in glycogen content of glandular and luminal epithelia among mink treated as E2→P4, P4+24h or controls. Stromal cell glycogen content was highest in E2+96h treated mink when compared to all other treatments (P ≤ 0.05). There was no difference in stromal cell glycogen content among mink treated as E2→P4, E2+24h or controls. Stromal glycogen content was lowest in response to P4+24h when compared to all other groups (P ≤ 0.05).
Table 4.
Mean (± SE) percent glycogen content of uterine glandular and luminal epithelia and stroma (% area PAS positive × 10). Mink in groups 2, 3 and 4 were each injected once daily, on days 12, 13 and 14 with estradiol 17beta (E2; 50 μg/kg body weight). On the same days, mink in group 5 each received daily injections of progesterone (P4; 25 mg/kg body weight). Mink in group 3 received vehicle only on days 15, 16, and 17 while mink in group 4 received daily injections of P4 on the same days. Mink in group 1 received vehicle only and represented controls. All animals were sacrificed approximately 24h after the last perturbation. Relative fold-increase above controls are given in parentheses.
| Group | Treatment | Glandular epithelia | Luminal epithelia | Stroma |
|---|---|---|---|---|
| 1 | Control | 0.27 ± 0.15a | 0.54 ± 0.30a | 0.089 ± 0.014a |
| 2 | E2 + 24h | 3.63 ± 0.71b (13) | 2.82 ± 1.03b (5) | 0.055 ± 0.013a |
| 3 | E2 + 96h | 5.71 ± 0.55c (20) | 11.54 ± 2.32c (21) | 0.141 ± 0.036b |
| 4 | E2→P4 | 0.61 ± 0.16a (2) | 0.51 ± 0.13a | 0.054 ± 0.018a |
| 5 | P4 + 24h | 0.01 ± 0.01a | 0.14 ± 0.05a | 0.013 ± 0.008c |
Within a column, means without a common superscript differ (P ≤ 0.05)
Uterine hexokinase 1 mRNA expression in E2+24h mink was 30% greater than controls (P ≤ 0.05; Fig. 3). There was no difference in expression of the gene in E2+96h mink or in response to P4 + 24h, when compared to controls. When mink were primed with E2 and subsequently treated with P4 (E2→P4) Hk1 mRNA expression was higher than for all other treatments (P ≤ 0.05).
Figure 3.
Relative (mean ± SE) mRNA expression levels for hexokinase 1, glycogen synthase 1, glycogen phosphorylase m and glucose 6-phosphatase in mink uterine homogenates. Animals were injected with E2 for three days and sacrificed 24h (E2+24) and 96h (E2+96) after the last injection. To simulate E2 priming, mink were treated for three days with E2 and then an additional three days with P4 and sacrificed 24h later (E2→P4). Mink were also treated with P4 for three days and sacrificed 24h later (P4+24). Controls (CON) received injections of vehicle only for three days and were sacrificed 24h later. Expression levels represent the mean of five mink, each analyzed in triplicate. Groups without a common letter differ at P ≤ 0.05.
Uterine glycogen synthase 1 mRNA expression was greatest in response to E2→P4 when compared to all other treatments, followed by E2+96h and P4 +24h (Fig. 3; P ≤ 0.05). Mink treated as E2+24h exhibited Glycogen synthase 1 mRNA expression levels that did not differ from controls.
Expression of glycogen phosphorylase m mRNA by whole uterine homogenates for E2+24h and E2+96h treated mink did not differ from controls (Fig. 3). Mink primed with E2 and then treated with P4 (E2→P4) or P4+24h had higher glycogen phosphorylase m gene expression levels when compared to mink treated as E2+24h, E2+96h or as controls (P ≤0.05).
Uterine glucose 6 phosphatase 3 mRNA expression was greater for E2+96h treated mink when compared to E2+24h or controls (Fig. 3: P ≤ 0.05). Mink treated as E2→P4 showed the highest level of glucose 6-phosphatase 3 gene expression, followed by treatment with P4+24h.
Hexokinase 1 and glycogen synthase proteins in whole uterine homogenates for mink treated as E2 +24h and E2 +96h or in response to P4 +24h did not differ from controls (Fig. 4). The amount of both proteins in response to E2→ P4 was greater when compared to all other treatments (P ≤ 0.001). Similarly, the amount of phospho-glycogen synthase protein was greater in response to E2→ P4 when compared to all other treatments (P ≤ 0.05). Mink treated as E2 +24h had lower phospho-glycogen synthase protein content when compared to E2→ P4 or E2 +96h treatments (P ≤ 0.05), and tended to be lower than mink treated with P4 +24h.
Figure 4.
Western blot analyses for hexokinase 1, phosphoglycogen synthase 1 and glycogen synthase proteins in mink uterine homogenates. Animals were injected with E2 for three days and sacrificed 24h (E2+24) and 96h (E2+96) after the last injection. To simulate E2 priming, mink were treated for three days with E2 and then an additional three days with P4 and sacrificed 24h later (E2→P4). Mink were also treated with P4 for three days and sacrificed 24h later (P4+24). Controls (CON) received injections of vehicle only for three days and were sacrificed 24h later. Expression levels represent the mean of five mink, each analyzed in triplicate. Groups without a common letter differ at P ≤ 0.05.
DISCUSSION
Glycogen content of the mink uterine myometrium, endometrium, stroma, luminal and glandular epithelia were increased by exogenous E2 at 24 and 96 h after the last injection when compared to controls (P ≤ 0.05; Tables 3 and 4, Fig. 2). These findings support our previous observations for mink (Rose et al. 2011) and agree with those for rats, rabbits and guinea pigs (Bitman et al. 1965; Bitman & Cecil 1967; Gregoire et al. 1967; Hall & Khaligh 1968; Demers et al. 1973a; Tripathi 1983).
Figure 2.
Mink uterine cross-sectional images. Animals were injected with E2 for three days and sacrificed 24h (E2+24h) and 96h (E2+96h) after the last injection. To simulate E2 priming, mink were treated for three days with E2 and then an additional three days with P4 and sacrificed 24h later (E2→P4). Mink were also treated with P4 for three days and sacrificed 24h later (P4+24h). Controls (CON) received injections of vehicle only for three days and were sacrificed 24h later. All sections (7 μm) were stained with Periodic Acid Schiff (PAS) and counterstained with hematoxylin. Images were captured at 25 × (left column), 200 × (middle column) and 400 × (right column). Arrows identify areas of positive PAS staining within the glandular lumens. M, myometrium; E, endometrium, GE, glandular epithelium; LE, luminal epithelium
Because circulating E2 concentrations in mink are increasing for weeks prior to proestrus and estrus, (Pilbeam et al. 1979), it would appear that part of the effects of E2 on the mink uterus are to promote glycogen accumulation in preparation for the breeding season. Our recent findings of peak uterine glycogen content in mink during estrus, that diminished throughout implantation and pregnancy (Dean et al. 2014) supports this hypothesis. It would not seem unreasonable to propose that without adequate uterine glycogen reserves, and their subsequent mobilization, mink pre-embryos may fail to survive and/or develop to the blastocyst stage. This could have a very negative impact on resulting litter sizes.
The glycogen content of whole uteri of E2+96h treated mink was less than for E2+24h treated animals (P ≤ 0.05; Table 3). Similarly, the glycogen content of the endometrium and myometrium exhibited the same trend, although the differences were not significant. Such findings might suggest that glycogen catabolism predominated over glycogen synthesis between hours 24 and 96, and that elevated E2 concentrations must be maintained above some critical level to maintain a higher glycogen synthesis to catabolism ratio. And yet, the glycogen content of the glandular epithelia, luminal epithelia and stroma were greater in mink treated as E2+96h than E2+24h (P ≤ 0.05; Table 4). We reasoned that glycogen determinations made by ImageJ analysis of the endometrium, myometrium, stroma and whole uterine glycogen measurements were low at 96 h after the last E2 injection, as a result of being diluted by the relatively large amount of extracellular material and cells not containing glycogen (Fig. 2). As mentioned previously, the endometrial area was approximately 4-fold greater at 24h and 6-fold greater at 96 h after the last E2 injection (Table 2).
Even after using ImageJ to isolate the stromal compartment of the endometrium, the glycogen content for the stroma was orders of magnitude below that detected for the glandular and luminal epithelia. Because of the small amount of glycogen detected within such a large area, we believe that our glycogen content measurements for the stroma may approach the limits of detection by ImageJ analysis and may not be an accurate representation of glycogen content of the stromal cells. By contrast, the epithelia can be very precisely delineated with ImageJ. As a result we believe that glycogen content determinations for glandular and luminal epithelia are the most accurate, and physiologically meaningful measurements, since the epithelia is the immediate source of uterine histotroph.
The glycogen content of the glandular epithelia, luminal epithelia and stroma was significantly greater in E2+96h than E2+24h treated animals (Table 4). This illustrates that E2 had prolonged affects on glycogen synthesis in these cells. In agreement with this finding, glycogen synthase 1 mRNA levels in uterine homogenates were higher in E2+96h mink when compared to E2+24h or controls (Fig. 3; P ≤ 0.05). Although we could detect no difference in glycogen synthase 1 protein by WBA among E2+24h, E2+96h and controls (Fig. 4), the amount of phospho-glycogen synthase protein (inactive) was significantly lower in E2+24h mink, when compared to controls, which could have contributed to increased glycogen synthesis.
Exogenous E2 had no affect on glycogen phosphorylase m gene expression at 24 or 96 h after the last injection (Fig. 3). This agrees with the general consensus that E2 is glycogenic in the uterus. However, when mink were treated as E2→P4, or P4+24h, uterine glycogen phosphorylase m gene expression was higher than E2+24h, E2+96h or controls (Fig. 3; P ≤ 0.05). Moreover, phosphor-glycogen synthase protein and glucose 6 phosphatase 3 mRNA were also highest in response to E2→P4 treatment (Figs 3 and 4). In agreement with this observation we previously showed that expression of glucose 6 phosphatase 3 mRNA was five-fold greater during late diapause (as P4 levels are increasing) and three-and-a-half-fold greater during pregnancy when compared to estrus (Dean et al. 2014). Collectively, these findings suggest that P4 promotes glycogen catabolism in the mink uterus.
It is well known that glycogen synthesis and catabolism occur concomitantly within cells and that net glycogen content reflects the relative levels of anabolic and catabolic processes. Thus, even though glycogen reserves in the mink uterus are almost depleted prior to implantation, the level of anabolic activity could still be very high at this time and play a significant role in sequestering maternal glucose to the uterus. In agreement with this supposition, we show that hexokinase 1 mRNA and protein were higher in mink in response to E2→P4 when compared to all other treatments (Figs 3 and 4). Recently, we showed that hexokinase 1 protein, detected by immunohistochemistry in mink uterine epithelia was high during estrus and peri-implantation (Dean et al. 2014). It is possible that increased hexokinase expression in response to P4 contributes to increased trapping of glucose, from the maternal circulation; even after uterine glycogen reserves are depleted. Similarly, increased glycogen synthase expression in response to E2→P4, (even if catabolism predominated over anabolism) could serve to divert maternal glucose to the uterus. It was therefore, not surprising to discover that some glycogenic processes in the uterus were enhanced in E2→P4 treated mink.
In summary, we conclude that mink pre-embryonic survival and development to the blastocyst stage depends in part, upon P4 induced uterine glycogen catabolism and release of glucose. During implantation, as circulating E2 and P4 concentrations are increasing, P4 actions may predominate over E2, resulting in a greater level of glycogen catabolism than synthesis. Nevertheless, E2 independently or in combination with P4 may still promote glycogen synthesis at this time. This latter affect could promote the continued sequestration of glucose from the maternal circulation to the uterus ensuring adequate nutritional support for embryo implantation and early pregnancy. Moreover, we believe that circulating P4 concentrations must be above some critical level, between mating and implantation, to ensure reproductive success, and maximize litter sizes. As evidence we recently showed that fecal P4 concentrations from mated female mink increased earlier and were significantly greater in all animals that whelped when compared to those that failed to whelp (Cao et al. 2015). We propose that reproductive failures in mink may in part be due to (1): an insufficient quantity of glycogen being accumulated by the uterus during pro-estrus and estrus, (2): inadequate mobilization of uterine glycogen reserves during pre-embryonic development and implantation, and/or (3): failure to divert sufficient amounts of glucose from the maternal circulation to the uterus during early pregnancy. In addition to the many documented actions of P4 on the uterus, it would now seem that regulation of uterine glycogen metabolism by the hormone should attract the attention of investigators as a potential target for increasing reproductive performance as well as the development of newer and perhaps safer means of birth control.
Acknowledgments
This publication was made possible by (a): the INBRE Program, NIH Grant Nos. P20 RR016454 (National Center for Research Resources) and P20 GM103408 (National Institute of General Medical Sciences), (b): awards from the Mink Farmers Research Foundation (Fur Commission USA; Coronado, CA, USA) and (c): the College of Science and Engineering at Idaho State University to Jack Rose. Mink were generously donated by Messrs Lee and Ryan Moyle, of Moyle Mink and Tannery, Heyburn, Idaho.
References
- Ambramoff MD, Magalhães PJ, Ram SJ. Image processing with ImageJ. Biophotonics International. 2004;11:36–42. [Google Scholar]
- Bitman J, Cecil HC, Mench ML, Wrenn TR. Kinetics of in vivo glycogen synthesis in the estrogen-stimulated rat uterus. Endocrinology. 1965;76:63–69. doi: 10.1210/endo-76-1-63. [DOI] [PubMed] [Google Scholar]
- Bitman J, Cecil HC. Mechanism of estrogen action in glycogen synthesis. Archives of Biochemistry and Biophysics. 1967;118:424–427. doi: 10.1016/0003-9861(67)90370-0. [DOI] [PubMed] [Google Scholar]
- Burton GJ, Watson AL, Hempstock J, Skepper J, Jauniaux E. Uterine glands provide histiotrophic nutrition for the human fetus during the first trimester of pregnancy. Journal of Clinical Endocrinology and Metabolism. 2002;87:2954–2959. doi: 10.1210/jcem.87.6.8563. [DOI] [PubMed] [Google Scholar]
- Cao X, Wei H, Xue H, Li X, Zhao W, Xu C, Wang S, Diao Y, Rose J, Xu B. Fecal progesterone concentrations as an indicator of reproductive success in Mink. Animal Reproduction Science. 2015 doi: 10.1016/j.anireprosci.2015.11.023. In Press. [DOI] [PubMed] [Google Scholar]
- Cornillie FJ, Lauweryns JM, Brosens IA. Normal human endometrium. An ultrastructural survey. Gynecology Obstetrics Investigation. 1985;20:113–129. doi: 10.1159/000298983. [DOI] [PubMed] [Google Scholar]
- Dean M, Hunt J, McDougall L, Rose J. Uterine glycogen metabolism in mink during estrus, embryonic diapause and pregnancy. Journal of Reproduction and Development. 2014;60:438–446. doi: 10.1262/jrd.2014-013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Demers LM, Jacobs RD. Hormonal regulation of rat uterine glycogen metabolism. Biology of Reproduction. 1973;9:272–278. doi: 10.1093/biolreprod/9.3.272. [DOI] [PubMed] [Google Scholar]
- Demers LM, Jacobs RD, Greep RO. Comparative effects of ovarian steroids on glycogen metabolism of rat, rabbit and guinea pig uterine tissue. Proceedings of the Society for Experimental Biology and Medicine. 1973a;143:1158–1163. doi: 10.3181/00379727-143-37491. [DOI] [PubMed] [Google Scholar]
- Demers LM, Macdonald GJ, Greep RO. Hormonal control of endometrial glycogen metabolism in the Macaca arcoides. American Journal of Physical Anthropology. 1973b;38:183–187. doi: 10.1002/ajpa.1330380207. [DOI] [PubMed] [Google Scholar]
- Demers LM, Yoshinaga K, Greep RO. Uterine glycogen metabolism of the rat in early pregnancy. Biology of Reproduction. 1972;7:297–304. doi: 10.1093/biolreprod/7.2.297. [DOI] [PubMed] [Google Scholar]
- Enders RK. Reproduction in the mink (Mustela vison) Proceedings of the American Philosophical Society. 1952;96:691–755. [Google Scholar]
- Ferrer JC, Favre C, Gomis RR, Fernández-Novell JM, Gracía-Rocha M, de la Iglesia N, Cid E, Guinovart JJ. Control of glycogen deposition. Federation of European Biochemical Societies Letters. 2003;546:127–132. doi: 10.1016/s0014-5793(03)00565-9. [DOI] [PubMed] [Google Scholar]
- Girish CJ, Kotur NS, Nagarajappa AH, Manjunath ML. A correlative study of endometrial glycogen content and other contributory factors on female infertility. International Journal of Biomedical and Advance Research. 2012;3:30–35. [Google Scholar]
- Good CA, Kramer H, Somogyi M. The determination of glycogen. Journal of Biological Chemistry. 1933;100:485–491. [Google Scholar]
- Gray CA, Taylor KM, Ramsey WS, Hill JR, Bazer FW, Bartol FF, Spencer TE. Endometrial glands are required for preimplantation conceptus elongation and survival. Biology of Reproduction. 2001;64:1608–1613. doi: 10.1095/biolreprod64.6.1608. [DOI] [PubMed] [Google Scholar]
- Greenstreet RA, Fotherby K. Carbohydrate metabolism in the rat uterus during early pregnancy. Steroids Lipids Research. 1973a;4:48–64. [PubMed] [Google Scholar]
- Greenstreet RA, Fotherby K. Carbohydrate metabolism in the rat uterus during the oestrous cycle. Steroids Lipids Research. 1973b;4:341–350. [PubMed] [Google Scholar]
- Gregoire AT, Ramsey H, Adams A. The effect of various doses of oestradiol 17-beta on glycogen deposition in the rat uterus, cervix and vagina. Journal of Reproduction and Fertility. 1967;14:231–234. doi: 10.1530/jrf.0.0140231. [DOI] [PubMed] [Google Scholar]
- Hall K, Khaligh HS. The action of ovarian steroids and relaxin on glycogen and some enzyme activities in the uterus of the hamster. The Journal of Endocrinology. 1968;40:353–362. doi: 10.1677/joe.0.0400353. [DOI] [PubMed] [Google Scholar]
- Hansson A. The physiology of reproduction in mink (Mustela vison, schreb.) with special reference to delayed implantation. Acta Zoologica. 1947;28:1–136. [Google Scholar]
- Hempstock J, Cindrova-Davies T, Jauniaux E, Burton GJ. Endometrial glands as a source of nutrients, growth factors and cytokines during the first trimester of human pregnancy: a morphological and immunohistochemical study. Reproductive Biology and Endocrinology. 2004;2:58. doi: 10.1186/1477-7827-2-58. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hughes EC, Demers LM, Csermely T, Jones DB. Organ culture of human endometrium. Effects of ovarian steroids. American Journal of Obstetrics and Gynecology. 1969;105:707–720. doi: 10.1016/0002-9378(69)90007-6. [DOI] [PubMed] [Google Scholar]
- Hughes EC, Jacobs RD, Rubulis A, Husney RM. Carbohydrate pathways of the endometrium. Effects on ovular growth. American Journal of Obstetrics and Gynecology. 1963;85:594–609. doi: 10.1016/0002-9378(63)90306-5. [DOI] [PubMed] [Google Scholar]
- Lagerkvist G, Einarsson EJ, Forsberg M, Gustafsson H. Profiles of oestradiol-17 beta and progesterone and follicular development during the reproductive season in mink (Mustela vison) Journal of Reproduction and Fertility. 1992;94:11–21. doi: 10.1530/jrf.0.0940011. [DOI] [PubMed] [Google Scholar]
- Maeyama M, Sudo I, Saito K, Matsuo I, Nakahara K. Glycogen estimation by a rapid enzymatic method in very small samples of human endometrium: glycogen content in the endometrium of infertile patients during the menstrual cycle. Fertility and Sterility. 1977;28:159–162. doi: 10.1016/s0015-0282(16)42375-7. [DOI] [PubMed] [Google Scholar]
- Paul PK, Duttagupta PN. Inhibition of oestrogen-induced increase in hepatic and uterine glycogen by progesterone in the rat. Acta Endocrinologica. 1973;72:762–770. doi: 10.1530/acta.0.0720762. [DOI] [PubMed] [Google Scholar]
- Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acid Research. 2001;29:e45. doi: 10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pilbeam TE, Concannon PW, Travis HF. The annual reproductive cycle of the mink (Mustela vison) Journal of Animal Science. 1979;48:578–584. doi: 10.2527/jas1979.483578x. [DOI] [PubMed] [Google Scholar]
- Rose J. Bilateral adrenalectomy induces early onset of summer fur growth in mink (Mustela vison) Comparative Biochemistry and Physiology. 1995;111:243–247. doi: 10.1016/0742-8413(95)00043-n. [DOI] [PubMed] [Google Scholar]
- Rose J, Hunt J, Shelton J, Wyler S, Mecham D. The effects of estradiol and catecholestrogens on uterine glycogen metabolism in mink (Neovison vison) Theriogenology. 2011;75:857–866. doi: 10.1016/j.theriogenology.2010.10.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rubulis A, Jacobs RD, Hughes EC. Glycogen synthethase in mammalian uterus. Biochimica et Biophysica Acta. 1965;99:584–586. doi: 10.1016/s0926-6593(65)80222-3. [DOI] [PubMed] [Google Scholar]
- Spornitz UM. The functional morphology of the human endometrium and decidua. Advances in Anatomy, Embryology, and Cell Biology. 1992;124:1–99. doi: 10.1007/978-3-642-58099-4. [DOI] [PubMed] [Google Scholar]
- Tripathi G. Effect of estradiol dipropionate on uterine and vaginal glycogen content of Parkes (P) mice. Indian Journal of Physiology and Pharmacology. 1983;27:317–322. [PubMed] [Google Scholar]
- Verma V. Ultrastructural changes in human endometrium at different phases of the menstrual cycle and their functional significance. Gynecology Obstetrics Investigations. 1983;15:193–212. doi: 10.1159/000299412. [DOI] [PubMed] [Google Scholar]
- Yánez AJ, Nualart F, Droppelmann C, Bertinat R, Brito M, Concha II, Slebe JC. Broad expression of fructose-1,6-bisphosphatase and phosphoenolpyruvate carboxykinase provide evidence for gluconeogenesis in human tissues other than liver and kidney. Journal of Cell Physiology. 2003;197:189–197. doi: 10.1002/jcp.10337. [DOI] [PubMed] [Google Scholar]
- Zawar MP, Deshpande NM, Gadgil PA, Mahanta AA. Histopathological study of endometrium in infertility. Indian Journal of Pathology and Microbiology. 2003;46:630–633. [PubMed] [Google Scholar]
- Zimmer DB, Magnuson MA. Immunohistochemical localization of phosphoenolpyruvate carboxykinase in adult and developing mouse tissues. The Journal of Histochemistry and Cytochemistry. 1990;38:171–178. doi: 10.1177/38.2.1688895. [DOI] [PubMed] [Google Scholar]




