Abstract
The major histocompatibility complex I (MHC-I) presents antigenic peptides to tumor-specific CD8+ T cells. The regulation of MHC-I by kinases is largely unstudied, even though many patients with cancer are receiving therapeutic kinase inhibitors. Regulators of cell surface HLA amounts were discovered using a pooled human kinome shRNA interference–based approach. Hits scoring highly were subsequently validated by additional RNAi and pharmacologic inhibitors. MAP2K1 (MEK), EGFR, and RET were validated as negative regulators of MHC-I expression and antigen presentation machinery in multiple cancer types, acting through an ERK output–dependent mechanism; the pathways responsible for increased MHC-I upon kinase inhibition were mapped. Activated MAPK signaling in mouse tumors in vivo suppressed components of MHC-I and the antigen presentation machinery. Pharmacologic inhibition of MAPK signaling also led to improved peptide/MHC target recognition and killing by T cells and TCR-mimic antibodies. Druggable kinases may thus serve as immediately applicable targets for modulating immunotherapy for many diseases.
Keywords: Immunotherapy, Kinases, Antigen presentation, TCR mimic, T cell therapy, MAPK
Introduction
Major histocompatibility complex class I molecules (MHC-I) generally present short peptides from either foreign or native intracellular proteins on the cell surface in an HLA-restricted manner for recognition by CD8+ T cells via their T cell receptor (TCR) (1). MHC-I is an essential protein for CD8+ cytotoxic T cell responses, effective vaccination, adoptive T cell therapies, hematopoietic stem cell transplantation, and organ rejection, among many important physiologic processes and therapeutic manipulations. In addition, recently developed therapeutic TCR-based constructs and TCR-mimic antibodies are directed to MHC/peptide complexes (2–5).
Although immunotherapies for cancer, infectious disease, and autoimmune disease continue to gain use as effective therapeutic strategies, the mechanisms underlying the control of presentation of foreign antigens or self-tumor antigens are only partially understood and currently not exploited clinically (6). Reduced cell surface presentation of tumor antigens on MHC-I is an important obstacle to effective immunotherapy with adoptively transferred T cells, TCR constructs, tumor vaccines, and TCR-mimic antibodies (7–12).
We hypothesized that signaling pathways driven by kinases also may regulate surface MHC-I expression and that these could identified in loss- or gain-of-function genetic screens using specific antibodies to detect MHC-I cell surface expression. Previously, a genome-wide screen provided evidence that regulators of MHC-II could be identified by RNAi knockdown (13). We decided to target a mesothelioma cell line for our proof of concept, due to its robust expression of HLA and the need for more effective therapies for this disease. Moreover, immunotherapies, such as the CTLA-4 blocking antibody tremelimumab, that rely on antigen presentation on MHC-I, are currently being tested in mesothelioma (14). To identify signaling pathways that regulate HLA expression in this model, we conducted an shRNA screen of currently annotated human kinases, as it affords the immediate possibility of targeting identified kinases for which inhibitors already exist. Among ‘hits’ identified in the screen were kinases that negatively regulate HLA, including MAP2K1 (MEK1) and EGFR. In addition, we discovered that DDR2 and MINK1 increase surface MHC-I. These pathways, the effects of their inhibition, and the positive consequences of inhibition on MHC antigen presentation, TCR-based recognition of the MHC/peptide complexes and subsequent killing were explored. The use of loss- and gain-of-function screens to uncover regulators of MHC-I could have broad implications for understanding and treating multiple diseases with pathophysiology related to antigen presentation.
Materials and Methods
Cell lines and culture conditions
After informed consent on Memorial Sloan-Kettering Cancer Center (MSK) Institutional Review Board–approved protocols, peripheral blood mononuclear cells (PBMCs) from HLA-typed healthy donors and patients were obtained by Ficoll density centrifugation. The sources for obtaining human mesothelioma cell lines JMN and Meso34 are described previously and were verified as unique cell lines by IMPACT sequencing (Supplementary Table 1) (3). HEK293T, PC9, SKMEL5, UACC257, SW480, CFPAC1, H827, H1975, H1299, and A549 were obtained from ATCC between the years 2012 and 2016 and were not further validated. The TPC1 cell was obtained from Dr. James Fagin lab, where the cell line was validated by IMPACT sequencing, and used from 2014–2016. (Memorial Sloan-Kettering Cancer Center). The B16-F10 melanoma line was originally obtained from I. Fidler, and used from 2015–2016, and was not further validated (MD Anderson Cancer Center). Cell lines were maintained 2–3 months in RPMI supplemented with 10% FBS and 2 mM L-glutamine unless otherwise mentioned. HEK293T were grown in Dulbecco’s modified media with 10% FBS and 2 mM L-glutamine. Cells were checked regularly for mycoplasma.
ADCC
The HLA-A*02:01 positive mesothelioma cell lines JMN and Meso34, along with the melanoma cell line SK-MEL5 were used in the ADCC assay as a target. Antibodies (3 μg/ml) ESKM (15), PRAME, or its isotype control hIgG1 were incubated with target cells and fresh healthy donor PBMCs at different effector/target ratios for 6 hours, along with indicated doses of vehicle or trametinib in RPMI supplemented with 10% FBS. The supernatant was harvested, and the cytotoxicity was measured by a 51Cr release assay (Perkin Elmer).
Clonogenic killing assay
B16F10 cells were treated with either 0.1% DMSO or 1 uM trametinib for 72 h. B16F10 cells (1 × 104) were then used as targets and in vitro–activated Pmel T cells (5 × 104) as effectors isolated from the spleen of pmel (GP100) B6.Cg-Thy1a/Cy Tg(TcraTcrb)8Rest/J mice (Jackson Labs).
Pooled RNAi screening
A custom shRNA library targeting the full complement of 526 human kinases was designed using miR30-adapted DSIR predictions refined with “sensor” rules (six shRNAs per gene) and constructed by PCR-cloning a pool of oligonucleotides synthesized on 12k customized arrays (Agilent Technologies and CustomArray) as previously described (16). The list of genes was obtained from KinBase Database (http://kinase.com/human/kinome/) and was manually curated. After sequence verification, 3156 shRNAs (5–6 per gene) were combined with positive control HLA-A– and negative-control Renilla–targeting shRNAs at equal concentrations in one pool. JMN mesothelioma cells stably expressing the Tet-On rt-TA3 gene were used. This pool was subcloned into the TRMPV-Neo vector and transduced in triplicates into Tet-on JMN mesothelioma cancer cells using conditions that predominantly lead to a single retroviral integration and represent each shRNA in a calculated number of at least 1,000 cells (Fig. 1A). Transduced cells were selected for 6 days using G418 (1 mg ml−1, Invitrogen); at each passage more than 3 × 107 cells were maintained to preserve library representation throughout the experiment. After induction, T0 samples were obtained (~3 × 107 cells per replicate, n = 3) and cells were subsequently cultured in the presence of doxycycline (2 μg ml−1) to induce shRNA expression. After four days (Tf), about 3 × 106 shRNA-expressing (dsRed+/Venus+) cells were sorted for each replicate using a FACSAriaII (BD Biosciences). DAPI negative, dsRed+/Venus+ cells were sorted by FACS into three populations of BB7 low, BB7 middle, and BB7 high binding (Fig. 1). Genomic DNA from Tf samples was isolated by two rounds of phenol extraction using PhaseLock tubes (5prime) followed by isopropanol precipitation. Deep-sequencing template libraries were generated by PCR amplification of shRNA guide strands as previously described (10). Libraries were analyzed on an Illumina Genome Analyzer at a final concentration of 8 pM; 50 nucleotides of the guide strand were sequenced using a custom primer (miR30EcoRISeq, TAGCCCCTTGAATTCCGAGGCAGTAGGCA). Hits with lower than 100 reads from the Illumina HiSeq were eliminated because they were not above background.
Relative representations of each individual shRNA were determined and compared in each given sorted population. We separated hits phenotypically into negative regulators (the population one standard deviation below the mean fluorescence intensity) or positive regulators (the population one standard deviation above the mean fluorescence intensity) of HLA-A*02:01. The ratio of the shRNA ranking between the high and low population was compared, with a high ratio indicating a putative negative regulator of surface HLA-A*02:01. The scoring criteria for a gene being a negative regulator of HLA-A*02:01 was based on having two or more shRNA constructs score in the top 5% for fold difference in relative representation between BB7 high population and BB7 low population, with other constructs scoring within 1 SD of the mean fold change. The gene products with at least two shRNA sequences in the top 5% ratio were selected for further validation by other methods. The same discovery pipeline was used for identifying positive regulators of HLA-A*02:01. For validation, the LT3GEPIR shRNA vector was used (17) (Supplementary Table S2). Cells were transduced and selected with puromycin, then induced with doxycycline (2 μg/ml) for 96 h before evaluating BB7, W6/32, ESK, or PRAME expression by flow cytometry.
Antibodies
Antibodies used for flow cytometry and western blot analysis are described in Supplementary Table S3. Monoclonal antibodies (mAbs) used for flow cytometry were specific for HLA-A02 (BB7.2), pan–HLA-ABC (W6/32), WT1 peptide RMF bound to HLA-A02 (ESK1), PRAME peptide ALY bound to HLA-A02 (Pr20), H2-Kb (AF6-88.5.5.3), and H2-Kq (KH114). Other antibodies used in this report are also listed in Supplementary Table S3.
Real-Time PCR
Total RNA was extracted using Qiagen RNA Easy Plus(Qiagen; #74134) after cells were treated for 48 h with indicated inhibitor. RNA was converted into cDNA using qScript™ cDNA SuperMix (Quanta Biosciences Gaithersburg, MD USA). Real-time assays were conducted using TaqMan realtime probes (Life Technlogies) for human HLA-A (Hs01058806_g1), B2M (Hs00187842_m1), TAP1 (Hs00388677_m1), TAP2 (Hs00241060_m1), and TBP (Hs00427620_m1) with 50 ng cDNA. For assessment of gene expression using RT-PCR PerfeCTa. FastMix. II (Quanta), reactions were carried out in triplicates using standard thermocycling conditions (2 min at 50 °C, 10 min at 95 °C, 40 cycles of 15 sec at 95.C, and 1 min at 60 °C). TBP was used as internal control and the ΔΔCT method was used for relative mRNA calculations.
Promoter based studies
GLuc luciferase promoter was obtained from Genecoepia (GeneCoepia Rockville, MD USA) with the B2M promoter cloned upstream of the GLuc enzyme. Normalization was done to SEAP (under the constitutively active SV40 promoter). Cells were seeded at 5E3 cells/well and treated with indicated drugs for 72 hours. Luminescence quantitation was assayed using the Secrete-Pair Dual Luminescence Assay Kit (GeneCoepia Rockville, MD USA).
Flow cytometric studies
Cell lines were seeded in triplicate in a 6-well tissue culture plate at a density of 1E5 cells/well, and allowed to adhere overnight. The next day, cells were treated with either vehicle control (0.1% DMSO), drugs or inhibitors at indicated concentrations. Cells were then isolated at 72 hours after inhibitor treatment, and washed with PBS. Cells were subsequently stained with BB7.2 (HLA-A02–specific mAb), W6/32 (HLA-ABC–specific mAb), or AF6-88.5.5.3 (H2-Kb–specific mAb, Ebiosciences). Cells were stained with propidium iodide for viability. Cells were analyzed on BD Accuri C6 flow cytometer.
Overexpression of β2M
Human β2M cDNA was cloned into the MSCV Puromycin vector.
Overexpression of mutant EGFR and NRAS
The pBABE retroviral vector encoding either EGFR harboring the L858R mutation was used to stably transduce H1299 cell line using HEK293T/Amphoteric cells and were selected in puromycin (2.5 μg/ml) for 5 days. EGFR L858R was a gift from Matthew Meyerson (Addgene plasmid # 11012). For overexpression of NRAS the pBABE NRAS Q61K plasmid was used to transduce H827 cells similar to described above, and selected in puromycin (2 μg/ml). pBabe N-Ras 61K was a gift from Channing Der (Addgene plasmid # 12543).
Small molecule inhibitor studies
Compounds were obtained from SelleckChem (Houston, TX USA). Drugs were used at sub-cytostatic doses by titration using the Cell Titer Glo assay (Promega). All drugs were used in vitro at indicated doses in 1% DMSO. Experiments were performed at least twice with similar results, and data shown are representative.
siRNA knockdown
The JMN cell line was treated with a control scrambled siRNA, or siRNA against STAT1, STAT3, and RelA. Cells were treated with the indicated drug 24 h after siRNA knockdown for 72 h before assaying for surface HLA-A by flow cytometry. shRNA construct details are in Supplementary Table S2.
Transgenic EGFR L858R mouse model
FVB CC10-rtTA/EGFR-L858R mice were obtained as a kind gift from the Harold Varmus lab. Mice were bred in accordance with MSKCC institutional review board under protocol 96-11-044. Mice used for the experiment were heterozygous for CC10-rtTA and EGFR-L858R as detected by quantitative PCR genotyping. At 4–6 weeks of age, mice were put on doxycycline via food pellets (625 mg/kg) (Harlan-Teklad) for > 6 weeks. Mice were imaged by anesthetizing under 2% isoflurane and lung field images were acquired on a Bruker 4.7T Biospec scanner (Bruker Biospin Inc.) magnetic resonance imager (MRI) in the small animal imaging core at MSKCC. Images were analyzed with Osirix Imaging Software (Geneva, Switzerland). Once confirmed to have reticulonodular appearances and consolidations by axial and coronal MR images, consistent with previous data published on the transgenic mice (18).
Mice were sacrificed once confirmed to have lung tumors (non induced control mice were also used, which genotypically were identical but did not receive dox diet). The lungs were isolated and treated with collagenase IV in HBSS with Ca2+ and Mg2+ for 1 h 37°C. Cells were then collected, blocked with mouse FcR block (Miltenyi), counted, and stained with mouse CD45 (30-F11, Biolegend), human EGFR(AY13 clone, Biolegend), and mouse H2-Kq (KH114, clone Abcam) antibodies. Flow cytometry analysis was performed on Fortessa (BD Biosciences).
CC10/L858R microarray data
Expression data from tissue isolated from WT and EGFR L858R transgenic mice were obtained from a previous study (GSE17373) and were selected for statistically significant data (P < 0.05) for PDCD1 (PD-1), CD274 (PD-L1), TAP1, TAP2, H2-Kd, and B2M gene expression between tumor bearing EGFR L858R lung tissue and normal lung tissue (19,20).
Results
Pooled shRNA screen identified gene products regulating surface HLA-A*02:01
Loss or gain of function screens serve as starting points for identifying new regulators of protein expression and function. We used an shRNA library against the 550 currently annotated human kinases to perform a custom pooled screen. For each gene, six shRNA constructs were cloned into the TRMPV retroviral vector, a tetracycline regulated vector that couples a mir30 based shRNA to a red fluorescent protein, which allows easy tracking and sorting of cells productively expressing an shRNA (Fig. 1A) (16). Knockdown of HLA-A*02:01 by use of an shRNA to this gene product in the same vector was tested as a positive control and caused strong knockdown by both western blot analysis and flow cytometry (Fig. 1B).
The amount of MHC-I and antigen presentation on surface HLA-A*02:01 is an important determinant of efficacy for certain immunotherapies (21). We decided to use the human mesothelioma cell line JMN as the target for these studies, which has stable HLA-A*02:01 expression and which has been used as a target of MHC-I directed therapies in vitro and in vivo (22). As a tool to show the impact of HLA modulation on antigen recognition and potential for TCR-based killing, we used TCR mimic antibodies that recognize peptide/MHC-I complexes. Knockdown of HLA-A substantially decreased the killing efficacy of the TCR mimic antibody ESKM against the JMN mesothelioma cell line (Supplementary Fig. S1). JMN was analyzed for presence of a predefined subset of mutations using the MSK IMPACT platform (Supplementary Table S1). No mutations or significant copy number alterations were observed in the HLA-A*02:01 or B2M genes.
The JMN cell line was screened with an shRNA library against the human kinome, as described in the Methods, for genes acting as negative or positive regulators of surface HLA-A, detected by flow cytometry with the HLA-A*02:01 specific mAb BB7.2 and fluorescence-activated cell sorting was used to sort populations based on HLA expression (illustrated as in Fig. 1C). The top 5 hits are listed (Supplementary Table S4).
Based on this analysis, MAP2K1 and EGFR were identified as important negative regulators of surface HLA-A*02:01. We chose to further investigate EGFR and MEK because of the availability of clinically approved drugs targeting these kinases both in NSCLC and metastatic melanoma respectively (23), as well as extensive use of immunotherapy.
EGFR is a receptor tyrosine kinase that binds epidermal growth factor and is frequently found to be activated by mutation in NSCLC. Activated EGFR signals through multiple downstream pathways, including the MAPK pathway. shRNA constructs against MAP2K1 and EGFR showed a large increase in relative representation in the BB7-high sorted population versus the BB7-low population, indicative of a negative regulator of HLA-A*02:01 surface expression (Fig. 1D). We validated each of these genes with independent shRNA knockdown to the gene products and saw significant increases in HLA-A*02:01 by flow cytometry (Fig. 1E). These effects were seen not only with HLA-A*02:01, but with total HLA-A, B, and C, suggesting coordinated control of all HLA surface expression, as measured with the W6/32 mAb (Supplementary Fig. S4). These findings were reproduced in multiple mesothelioma cell lines (Supplementary Fig. S3A and B). The RET protooncogene was also identified as potential target, but was not further studied at this time because no inhibitor of adequate specificity was available (Supplementary Fig. S3C).
We identified examples of positive genetic regulators of HLA-A, including two putative positive regulators DDR2 and MINK1 (Supplementary Table S4; Supplementary Fig. S4A and S4B), and confirmed their activity as well using siRNA knockdown (Supplementary Fig. S4C). Therefore, the kinase screen discovered multiple positive and negative regulators of HLA expression, each of which in principle could be explored further for mechanism and clinical utility. The top five negative regulators evaluated were confirmed by additional study, whereas three of the five top positive regulators were validated (Supplementary Table S2).
The MAPK pathway regulates MHC-I
Multiple potent small molecule inhibitors exist for EGFR and MEK, with several already FDA approved, and others currently in clinical trials for various cancers (23). Of note, the initial screen was performed in a cell line with EGFR activation and an identified EGFR mutation (Supplementary Table S1) (24). We tested, in multiple cell lines, the ability of inhibitors to phenocopy the loss of kinase expression leading to increased HLA-A expression seen with shRNA. Cell surface HLA-A*02:01 expression increased in response to MEK inhibition for 72 h with the selective MEK inhibitor trametinib in mesothelioma cell lines with activated MAP kinase signaling (Fig. 2A). JMN and PC9, a NSCLC cell line with an activating EGFR mutation (del E746-A750), responded to the EGFR inhibitor afatinib, whereas the Meso34 cell line without an EGFR mutation did not respond to afatinib at the same dose, demonstrating selectivity for activation mutations in the MAPK pathway leading to a response to HLA-A upregulation (Supplementary Table 1). We detected an effect of MAP kinase pathway inhibition on upregulation of HLA-A in the context of gain-of-function mutations or activation of other targets in the MAP kinase pathway, such as the KRAS G12V mutation in the SW480 and CFPAC-1 cell lines, the RET/PTC1 gene rearrangement in the TPC1 thyroid cell line, and the BRAF V600E mutation seen in the UACC257 and SK-MEL-5 melanoma cell lines (Fig. 2A). The MEKi trametinib did not affect surface HLA-A expression on normal PBMC cells, showing that this effect is specifically seen in cells with activated signaling.
To confirm that the increased HLA expression on the cell surface had important functional significance for enhanced presentation of antigens, we quantified the cell surface MHC/peptide epitope density by use of TCR mimic mAb selective for two well-validated tumor-associated epitopes presented by HLA-A*02:01, a WT1 peptide and a PRAME 300 peptide (25,26). Consistent with the increased surface HLA-A*02:01 expression, we also observed increased binding of the two TCR-mimic antibodies upon inhibition of MEK and EGFR (Fig. 2B).
We confirmed the regulatory activity of the pathway in a gain-of-function experiment by further stimulating the ERK pathway with EGF. The binding of EGF to the EGFR suppressed surface HLA-A and HLA-A, B, C, providing additional confirmation of the importance of the MAPK pathway in regulating surface MHC (Fig. 2C).
The mechanism by which the MAP kinase pathway suppresses HLA-A was unknown. Given that many cancers have activating mutations in specific genes in the MAP kinase pathway, we investigated inhibition of the identified hits in cell lines harboring mutations in EGFR, or downstream in Ras. We used a panel of NSCLC cell lines with activating mutations in EGFR, such as the delE746-A750 in H827, or L858R/T790M mutation in H1975. The delE746-A750 confers sensitivity to erlotinib, whereas the T790M confers resistance to erlotinib and to other first generation EGFR inhibitors, but is sensitive to afatinib (27). We also used EGFR wild-type NSCLC lines with downstream mutations, such as activating NRAS Q61K in H1299 or KRAS G12S in A549.
Use of the EGFRi erlotinib and afatinib upregulated surface MHC-I if the cell line had the sensitizing mutation, whereas all responded to trametinib MEKi (Fig. 2D and 2E). The sensitivity to EGFRi erlotinib and afatinib upregulating surface MHC-I was not observed with downstream activating RAS mutations. Expression of the activating EGFR mutation L858R suppressed MHC-I in H1299 NRAS Q61K mutant cell lines (Fig. 2F).
H827 responded more strongly to EGFRi by erlotinib than MEKi by trametinib, despite their similar suppression of pERK, a downstream marker of MEK activity. The combination MEKi and EGFRi was equivalent to EGFRi alone. (Fig. 2G). We introduced the NRAS Q61K mutation, shown to cause resistance to EGFRi and persistent activation of the MAPK pathway in H827. Use of the EGFRi still had an effect on surface MHC-I despite no change in pERK output on the H827 NRAS Q61K cell line (Fig. 2H). This could be due to activation of parallel signaling pathways in EGFR mutant cancers or differential stimulation of ERK. Thus, the MAPK pathway is not the only determinant of EGFR-mediated regulation of surface MHC-I. Given that both EGFR and MEK are involved in signaling via the MAP kinase pathway, these data validate the importance of this pathway in regulating surface HLA-A and MHC-I.
Interferon-γ (IFNγ) is a well-known regulator of MHC-I via the JAK/STAT pathway (28,29). We asked whether a combination of IFNγ with the kinase inhibitors would have additive effects on HLA expression (Supplementary Fig. S5A, B, C). Both IFNγ and afatinib (in EGFR mutant H1975 lung cancer cells), and IFNγ and trametinib (in Braf mutant SK-MEL5 and UACC257 melanoma cells), alone, each increased expression of cell surface HLA molecules, as measured by antibodies to HLA-A*02:01 or pan HLA-A, B, C. The combination of the IFNγ and the drug had greater effects than either alone, consistent with the involvement of two different pathways. PCR analysis of TAP1 showed that this internal component of the antigen presentation machinery was also upregulated by IFNγ by 10 to 25 fold in all three cell lines. β2-Microglobulin was also upregulated 4 to 7 fold with IFNγ treatment in all three lines. There were minimal increases in these two proteins in response to the two kinase inhibitors in H1975 and UACC257. However in SK-MEL5, trametinib increased both proteins alone and was additive with interferon.
HLA-E is another component of the antigen presentation pathway that presents MHC molecule–bound peptides and may be involved in downregulating NK cell immune responses to cancers (30). IFNγ and afatinib (in EGFR mutant lung cancer cells) did not affect HLA-E levels (Supplementary Fig. S5D). Trametinib, in Braf mutant SK-MEL5 melanoma cells, increased cell surface HLA-E molecules, but did not do so in UACC257 cells. IFNγ also variably upregulated HLA-E in the two melanoma lines, and the combination of drugs was more effective in increasing HLA-E in UACC257 cells (Supplementary Fig. S5E and F). Although an upregulation of HLA-E might be expected to partially counter the effects of upregulation of classic MHC seen in these cells, the net effect was to improve cytolytic activity.
Improving immunotherapy by inhibiting MAPK pathway
We next tested the effects of modulating HLA-A*02:01 expression on the efficacy of immunotherapies that depend on HLA-A*02:01 upregulation and antigen presentation, by use of pmel-1 T cells expressing a TCR that reacts with gp100 and use of two different TCR mimic antibodies whose function also depend on peptide/MHC-I expression. The TCR mimic antibody ESKM, which targets a peptide from WT1 in the context of HLA-A*02:01, and Pr20m, which targets a peptide from PRAME, were used as easily quantifiable surrogate tools for measuring the potential therapeutic consequences of upregulation of HLA-A*02:01-based antigen targets as a consequence of MEK inhibition. The cytotoxicity of ESKM against the JMN and Meso34 human mesothelioma cell lines were increased by MEK inhibition with trametinib (Fig. 3A and B), which was used at a non-cytotoxic dose (Supplementary Fig. S6). Increased cytotoxicity of the Pr20m mAb was also observed with use of the MEKi trametinib in the SK-MEL-5 human melanoma cell line, validating this observation with multiple targets in multiple cell lines (Fig. 3C).
Finally, specific killing by T cells increased after upregulatingMHC-I with MEKi. The pmel-1 gp100-specific mouse T cells were more effective at killing of the gp100 positive target B16F10 melanoma cells following trametinib treatment, which correlated with pERK inhibition and MHC-I upregulation (Fig. 3D, E, and F) (31). Therefore, improved recognition as a result of the increased expression of MHC-I and its presented peptides using three different target antigens by TCR or TCR mimics had significant consequences for cytotoxic activity.
Mechanism of MAPK regulation of MHC-I
We hypothesized that the inhibition of the MAP kinase pathway might act on other components of the antigen presentation machinery in addition to MHC-I molecules, thus allowing increased epitope expression in the more abundant cell surface HLA molecules. Indeed, EGFR and MEK inhibition produced an increase in mRNA gene expression of HLA-A along with other key components of the antigen presentation pathway and MHC-I structure, such as TAP1, TAP2, and β2M, (Fig. 4A). The JMN and Meso34 cells at t = 1 h were sensitive to trametinib at doses less than 10 nM as previously reported, but required higher doses to sustain inhibition of pERK at t = 72 h due to strong feedback (Supplementary Fig. S7A vs B). Doses of trametinib were chosen over the IC50 of MEK by using pERK as a readout of MEK inhibition at 72 h (Supplementary Fig. S7B and C). These data correlated with previous findings that BRAF mutant cell lines are the most sensitive to MEK inhibition, when compared to BRAF wild-type cell lines harboring further upstream mutations (32). A time course showed maximal inhibition of MEK at 3 h, with maximal increases of HLA-A and β2M at 72 h (Supplementary Fig. S8). Surface HLA-A increased in a dose dependent manner with increasing MEK inhibition in both melanoma and mesothelioma (Fig. 4B). The phenotypes observed are unlikely from off-target effects of the drug, given the dose response on pERK expression and the plateau of the dose response of surface HLA-A.
Antibodies against pERK, along with total ERK1/2, were used to show dose-responsive increases in response to trametinib inversely correlated with HLA-A protein expression. The increase of β2M much greater than that of HLA complexes in multiple cell lines, consistent with the gene expression data (Fig. 4C). EGFRi with erlotinib also caused a dose-dependent increase in HLA-A and β2M (Fig. 4D). Because β2M is required for surface presentation of HLA, A, B, C and stability of the MHC-I molecules on the cell surface, we investigated the potential role of β2M in controlling cell surface HLA-A expression. Overexpression of β2M increased cell surface HLA-A and pan HLA-ABC, phenocopying the effect of MEK inhibition (Fig. 4E), which was regulated by multiple regulatory domains in the promoter region, including the ISRE site, E box, and NF-κB sites. Using a luciferase-based promoter assay, we demonstrated that upon addition of MEKi, a dose-dependent increase in activity on the HLA-A and B2M promoters was observed (Fig. 4F). Knockdowns of STAT1, STAT3, and RelA (a component of NF-κB complex) were performed on JMN cells, along with treatment with MEKi. STAT1 knockdown had the largest inhibition of upregulation of surface HLA-A after MEKi, suggesting a role for STAT1 in responses to MEKi (Fig. 4G).
MAPK activation causes in vivo suppression of MHC-I and increased PD-1/L1
We confirmed that these observations on MHC regulation and antigen presentation machinery were not limited to in vitro models. Microarray profiling of the lung bearing tumors from transgenic EGFR L858R, which activates the MAPK pathway, compared to normal lungs, demonstrated suppression of mouse MHC-I and antigen presentation components H2-K/D, and β2M, thereby confirming the effects of this pathway in vivo (Fig. 5A) (19). Upregulation of PD-1 and PD-L1 markers in the tumors was also observed as previously published (20).
Expression of EGFR L858R in the transgenic mice, given doxycycline for > 6 wk, was demonstrated by increased binding of a human EGFR-specific fluorescently labeled mAb (Fig. 5B). Mice were confirmed to have development of lung adenocarcinoma by MR, with development of a reticulonodular infiltrate in the lung, consist with previous publications (18). The CD45−hEGFR+ population in the lung in the EGFR L858R–expressing mice demonstrated decreased binding of a MHC-I–specific mAb by flow cytometry, when compared to a wild-type mouse which did not express the EGFR L858R mutation (Fig. 5C).
Discussion
Immunotherapy of cancer is emerging as a successful and important component of treatment. MHC molecules presenting antigens are the target of multiple therapeutic strategies that involve vaccines, T cells or TCRs, TCR mimic antibodies, or T cell checkpoint blockade. The latter, a highly effective recent example in cancer therapy, appears to require presentation of neoantigens on MHC-I on the surface of cancer cells (33–35). Most immunotherapies have focused on enhancing intrinsic effector cell mechanisms for modulating the immune response, either by directly activating the effector T cells or by relieving their suppression. In distinct contrast, here we propose an alternative approach, whereby the antigenic targets on the cancer cells themselves are modulated to improve TCR-based killing. The ability to regulate such responses by selectively affecting target cells could have an important impact on both disease and therapy. We propose that kinases are a readily druggable pathway that might be used in conjunction with immunotherapy to enhance efficacy. The beneficial effect of the combination of immunotherapy with kinase inhibition was shown in mouse models of combined PD-1/PD-L1 blockade with MEKi (36). A second model, of adoptive T cell therapy in combination with MEKi in BRAF mutant murine melanoma, has demonstrated superiority to single agents alone (37). Our work has provided a new understanding of another mechanism why these combination therapies may be more effective, wherein upregulated MHC-I and antigen presentation on the target cells, essential for the adaptive immune response, improves TCR-based recognition and killing. Indeed, many of the patients treated currently with immunotherapies also receive kinase inhibitor therapies as distinct treatments.
The loss- and gain-of-function screen described here allowed unbiased interrogation of the currently annotated human kinases for their regulation of cell surface MHC-I. We then explored mechanistically how such kinase regulators could be inhibited for altering surface expression of MHC-I, as a way of validating the screen, understanding the process, and also for extending the findings to functional modulation of a model immunotherapy proof of concept that directly depends on MHC-I presentation. In this case, we were able to specifically isolate the MHC as the sole target of the therapy by use of therapeutic TCR mimic antibodies directed to antigens presented by MHC.
This study also provides support for the use of a flow cytometry–based loss-of-function pooled shRNA screen in the study of the regulation of other cell surface molecules, and potentially intracellular antigens as well. This technique will allow many laboratories without robotics and high-throughput flow cytometry equipment to investigate pathways that can be easily perturbed with loss-of-function RNAi screens or other techniques, such as CRISPR loss-of-function.
Here we have demonstrated the effect of the MAPK pathway on MHC-I, in vitro and in vivo. However, therapeutic applications in humans of the combination of available immunotherapies and pharmacologic kinase inhibition, to increase MHC-I surface expression and antigen presentation, will be complicated and difficult to predict, because T cells and NK cells also rely on similar kinase signaling pathways for activation. More work needs to be done to determine optimal pathways or schedules or doses to target MHC in tumor cells specifically, while sparing signaling pathways of the effector cells (38). Some studies suggest conflicting effects of MEKi on T cell effector function, which may be dependent on the tumor model evaluated (39,40). These effects cannot be simply modeled in mice. Empirically derived optimal dosing and schedules will be needed in in vivo models and in humans to show that use of kinase inhibition to regulate immunotherapy has therapeutic benefits while sparing immune effector cells of the detrimental effects (40–42). These investigations will be complicated by the effects of some of the drugs on the cellular effectors themselves, the variable effects on the cancer cells depending on their specific mutations, the time frames required to upregulate the responses (about 3 days in the experiments here) and the time required for the effects to wash out of the cancer cells and the effectors.
The data provide a mechanistic explanation of how MHC-I is regulated by the MAPK pathway. MHC-I mRNA expression is regulated through upstream enhancer elements, with involvement of the NF-κB transcription factor (43,44). MHC-I is also induced by TNF, IL1, IFNβ, and IFNγ, which upregulates HLA-A via the JAK/STAT pathway (28,29). The CIITA transcription factor can also act on MHC-I gene expression (45). IFNγ can increase MHC-I and antigen presentation, but thus far its use has had limited applications (46). We show here that combining the kinase inhibitors with IFNγ in vitro can have additive effects on HLA expression, TAP1, and β2M. This may be of benefit in vivo as IFNγ may be elaborated locally at tumor sites from tumor infiltrating lymphocytes at steady state or in response to other immunotherapies, such as check point blockade.
MEK has been proposed by others to be a regulator of MHC-I expression. EGFR inhibition can augment MHC-I and MHC-II expression in keratinocytes (47). MEK was previously identified as a negative regulator of HLA-A*02:01 in esophageal and gastric cancer by Mimura et al. (48). We validated these targets in the screen as important negative regulators of MHC-I and discovered a mechanistic role of the MAP kinase pathway in regulating surface levels of MHC-I. Our data directly link to immune-oncologic applications in humans, by demonstrating potent upregulation of MHC-I in a wide variety of cancers, including melanoma and NSCLC, which are currently the subject of FDA-approved therapies which depend upon on antigen presentation, such as checkpoint blockade with mAbs ipilibumab, pembrolizumab, and nivolibumab. In addition, by demonstrating that an FDA-approved MEKi upregulated MHC-I, the results support the clinical testing of combination therapies, which could advance this concept into human therapy. We characterized these effects on MHC-I in cells with activating mutations in the MAP kinase pathway with various genotypic lesions, such as activating EGFR mutations, BRAF mutations, and RAS mutations. Finally we also showed the mechanism was active in RET-translocated thyroid cancer. The sum of these data support the importance of MAPK pathway in regulating MHC-I quite broadly, while providing new mechanistic insights.
Finally, our findings are immunologically significant. Upregulation induced by MEK inhibition resulted in superior cytotoxic activity of TCR mimic antibodies (directed to specific MHC presented antigens) and TCR-based therapy with a pmel-specific murine T cell model. We further show, in a transgenically engineered mouse model in vivo, that activating this pathway reduces expression of the components of the antigen presentation machinery, along with MHC-I. This gain-of-function experiment is crucial to proving that activation of MAPK can cause decreased MHC-I in vivo.
Activating EGFR mutations may contribute to immune escape, due to PD-L1 expression. Downregulation of MHC-I, which was observed from our study, may also contribute to this finding (20). While demonstrating combination therapy with EGFRi and checkpoint blockade would be rational, the transgenic EGFR mice have shown dramatic tumor reduction and cures with EGFRi as monotherapy, leaving little window to show synergism in currently existing mouse models with checkpoint blockade (18). Our data also suggest that using combination therapy with MAP kinase inhibition can be powerful, not only as a direct cancer therapy to prevent growth, but also indirectly to promote immunotherapy.
HLA genes are a risk factor for autoimmune diseases such as ankolysing spondylitis and multiple sclerosis (49–51). In addition to upregulation by certain kinases, we showed downregulation of MHC-I through new kinase targets. These targets are not currently addressed by immunosuppressive therapies, which inhibit the effector arm of the immune response with concomitant toxicity. These new targets warrant additional investigation into altering the course of autoimmune diseases by investigating the efficacy of specific kinase inhibitors and developing appropriate mouse models.
A requirement of many immunotherapies therapies, particularly checkpoint blockade, is the availability of recognizable antigens that are presented on MHC-I. Tumors can decrease MHC-I expression, to avoid immune system detection of the rare neoantigens created in tumors by mutations, and increase inhibitory receptor expression. By modulating expression of these limited antigens, improved clinical efficacy may be seen with certain immunotherapies in conjunction with current FDA-approved small molecules targeting EGFR and MEK. The inhibition of kinase pathways also caused a more general upregulation of the antigen presentation machinery, including Tap (responsible for transporting peptides) and β2M (responsible for stabilizing MHC-I). Many of the recently approved immunotherapies, such as blockade of CTLA-4 or PD-1, release the T cell inhibition promoted by target tumor cells. These immunotherapies provide a promising approach to addressing multiple malignancies. By rationally combining them with targeted small molecule inhibitors, novel synergistic treatment strategies may be developed.
Acknowledgments
We thank T. Dao, L. Dubrovsky, D. Pankov, P Lito, D. Solit, E. Pamer, R. Brentjens, M. Will, A. Lujambia and A. Scott for their helpful discussions. We thank Y. Li and A. Younes for use of their equipment.
Funding: The study was supported by US National Institutes of Health grant R01 CA 55349 (D.A.S.), P01 CA23766 (D.A.S.), Diversity Research Supplement for the P01CA023766 (E.J.B., D.A.S), MARF (D.A.S.), P30 CA008748, NCI Grant NIH T32CA062948 (C.Y.O.), NIGMS T32GM07739 (E.J.B), Memorial Sloan Kettering Cancer Center’s (MSKCC’s) Experimental Therapeutics Center and the Lymphoma Foundation and Tudor and Glades funds.
Footnotes
Competing interests: D.A.S. is an inventor of the ESKM technology described in this paper and licensed by Memorial Sloan Kettering Cancer Center to Novartis.
References
- 1.Agrawal S, Kishore MC. MHC Class I Gene Expression and Regulation. J Hematother Stem Cell Res. 2000;9:795–812. doi: 10.1089/152581600750062237. [DOI] [PubMed] [Google Scholar]
- 2.Morgan RA, Dudley ME, Wunderlich JR, Hughes MS, Yang JC, Sherry RM, et al. Cancer regression in patients after transfer of genetically engineered lymphocytes. Science. 2006;314:126–9. doi: 10.1126/science.1129003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Dao T, Yan S, Veomett N, Pankov D, Zhou L, Korontsvit T, et al. Targeting the intracellular WT1 oncogene product with a therapeutic human antibody. Sci Transl Med. 2013;5:176ra33. doi: 10.1126/scitranslmed.3005661. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Yee C, Thompson JA, Byrd D, Riddell SR, Roche P, Celis E, et al. Adoptive T cell therapy using antigen-specific CD8+ T cell clones for the treatment of patients with metastatic melanoma: In vivo persistence, migration, and antitumor effect of transferred T cells. Proc Natl Acad Sci. 2002;99:16168–73. doi: 10.1073/pnas.242600099. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Chapuis AG, Ragnarsson GB, Nguyen HN, Chaney CN, Pufnock JS, Schmitt TM, et al. Transferred WT1-reactive CD8+ T cells can mediate antileukemic activity and persist in post-transplant patients. Sci Transl Med. 2013;5:174ra27. doi: 10.1126/scitranslmed.3004916. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Pardoll DM. The blockade of immune checkpoints in cancer immunotherapy. Nat Rev Cancer. 2012;12:252–64. doi: 10.1038/nrc3239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Mellman I, Coukos G, Dranoff G. Cancer immunotherapy comes of age. Nature Nature Publishing Group. 2011;480:480–9. doi: 10.1038/nature10673. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Adams JL, Smothers J, Srinivasan R, Hoos A. Big opportunities for small molecules in immuno-oncology. Nat Rev Drug Discov Nature Publishing Group. 2015;14:603–22. doi: 10.1038/nrd4596. [DOI] [PubMed] [Google Scholar]
- 9.Chiappinelli KB, Zahnow CA, Ahuja N, Baylin SB. Combining Epigenetic and Immunotherapy to Combat Cancer. Cancer Res. 2016:1683–90. doi: 10.1158/0008-5472.CAN-15-2125. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Campoli M, Ferrone S. HLA antigen changes in malignant cells: epigenetic mechanisms and biologic significance. Oncogene. 2008;27:5869–85. doi: 10.1038/onc.2008.273. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Leone P, Shin E-C, Perosa F, Vacca A, Dammacco F, Racanelli V. MHC Class I Antigen Processing and Presenting Machinery: Organization, Function, and Defects in Tumor Cells. JNCI J Natl Cancer Inst. 2013;105:1172–87. doi: 10.1093/jnci/djt184. [DOI] [PubMed] [Google Scholar]
- 12.Kageshita T, Hirai S, Ono T, Hicklin DJ, Ferrone S. Down-Regulation of HLA Class I Antigen-Processing Molecules in Malignant Melanoma. Am J Pathol. 1999;154:745–54. doi: 10.1016/S0002-9440(10)65321-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Paul P, Van Den Hoorn T, Jongsma MLM, Bakker MJ, Hengeveld R, Janssen L, et al. A Genome-wide Multidimensional RNAi Screen Reveals Pathways Controlling MHC Class II Antigen Presentation. Cell Elsevier Inc. 2011;145:268–83. doi: 10.1016/j.cell.2011.03.023. [DOI] [PubMed] [Google Scholar]
- 14.Calabrò L, Morra A, Fonsatti E, Cutaia O, Amato G, Giannarelli D, et al. Tremelimumab for patients with chemotherapy-resistant advanced malignant mesothelioma: an open-label, single-arm, phase 2 trial. Lancet Oncol Elsevier. 2013;14:1104–11. doi: 10.1016/S1470-2045(13)70381-4. [DOI] [PubMed] [Google Scholar]
- 15.Veomett N, Dao T, Liu H, Xiang J, Pankov D, Dubrovsky L, et al. Therapeutic Efficacy of an Fc-Enhanced TCR-like Antibody to the Intracellular WT1 Oncoprotein. Clin Cancer Res. 2014;20:4036–46. doi: 10.1158/1078-0432.CCR-13-2756. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Zuber J, McJunkin K, Fellmann C, Dow LE, Taylor MJ, Hannon GJ, et al. Nat Biotechnol. Vol. 29. Nature Publishing Group, a division of Macmillan Publishers Limited. All Rights Reserved; 2011. Toolkit for evaluating genes required for proliferation and survival using tetracycline-regulated RNAi; pp. 79–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Fellmann C, Hoffmann T, Sridhar V, Hopfgartner B, Muhar M, Roth M, et al. An Optimized microRNA Backbone for Effective Single-Copy RNAi. Cell Rep. 2013;5:1704–13. doi: 10.1016/j.celrep.2013.11.020. [DOI] [PubMed] [Google Scholar]
- 18.Politi K, Zakowski MF, Fan P-D, Schonfeld EA, Pao W, Varmus HE. Lung adenocarcinomas induced in mice by mutant EGF receptors found in human lung cancers respond to a tyrosine kinase inhibitor or to down-regulation of the receptors. Genes Dev. 2006;20:1496–510. doi: 10.1101/gad.1417406. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Regales L, Gong Y, Shen R, de Stanchina E, Vivanco I, Goel A, et al. Dual targeting of EGFR can overcome a major drug resistance mutation in mouse models of EGFR mutant lung cancer. J Clin Invest American Society for Clinical Investigation. 2009;119:3000–10. doi: 10.1172/JCI38746. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Akbay EA, Koyama S, Carretero J, Altabef A, Tchaicha JH, Christensen CL, et al. Activation of the PD-1 Pathway Contributes to Immune Escape in EGFR-Driven Lung Tumors. Cancer Discov. 2013;3:1355–63. doi: 10.1158/2159-8290.CD-13-0310. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Rivoltini L, Barracchini KC, Viggiano V, Kawakami Y, Smith A, Mixon A, et al. Quantitative correlation between HLA class I allele expression and recognition of melanoma cells by antigen-specific cytotoxic T lymphocytes. Cancer Res. 1995;55:3149–57. [PMC free article] [PubMed] [Google Scholar]
- 22.Dao T, Yan S, Veomett N, Pankov D, Zhou L, Korontsvit T, et al. Targeting the Intracellular WT1 Oncogene Product with a Therapeutic Human Antibody. Sci Transl Med. 2013;5:176ra33–176ra33. doi: 10.1126/scitranslmed.3005661. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Flaherty KT, Robert C, Hersey P, Nathan P, Garbe C, Milhem M, et al. Improved Survival with MEK Inhibition in BRAF-Mutated Melanoma. N Engl J Med. 2012;367:107–14. doi: 10.1056/NEJMoa1203421. [DOI] [PubMed] [Google Scholar]
- 24.Brevet M, Shimizu S, Bott MJ, Shukla N, Zhou Q, Olshen AB, et al. Coactivation of Receptor Tyrosine Kinases in Malignant Mesothelioma as a Rationale for Combination Targeted Therapy. J Thorac Oncol. 2011;6:864–74. doi: 10.1097/jto.0b013e318215a07d. [DOI] [PubMed] [Google Scholar]
- 25.Chang Aaron, Dao Tao, Scott Andrew, Dubrovsky Leonid, Liu Cheng, Scheinberg D. A Therapeutic TCR Mimic Monoclonal Antibody for Intracellular PRAME Protein in Leukemias. Am Soc Hematol. 2015 [Google Scholar]
- 26.Krug LM, Dao T, Brown AB, Maslak P, Travis W, Bekele S, et al. WT1 peptide vaccinations induce CD4 and CD8 T cell immune responses in patients with mesothelioma and non-small cell lung cancer. Cancer Immunol Immunother. 2010;59:1467–79. doi: 10.1007/s00262-010-0871-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Cross DAE, Ashton SE, Ghiorghiu S, Eberlein C, Nebhan CA, Spitzler PJ, et al. AZD9291, an irreversible EGFR TKI, overcomes T790M-mediated resistance to EGFR inhibitors in lung cancer. Cancer Discov American Association for Cancer Research. 2014;4:1046–61. doi: 10.1158/2159-8290.CD-14-0337. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Girdlestone J, Isamat M, Gewert D, Milstein C. Transcriptional regulation of HLA-A and -B: differential binding of members of the Rel and IRF families of transcription factors. Proc Natl Acad Sci U S A. 1993;90:11568–72. doi: 10.1073/pnas.90.24.11568. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Wolchok JD, Vilček J. Induction of HLA class I mRNA by cytokines in human fibroblasts: comparison of TNF, IL-1 and IFN-β. Cytokine. 1992;4:520–7. doi: 10.1016/1043-4666(92)90014-i. [DOI] [PubMed] [Google Scholar]
- 30.Kochan G, Escors D, Breckpot K, Guerrero-Setas D. Role of non-classical MHC class I molecules in cancer immunosuppression. Oncoimmunology. 2013;2:e26491. doi: 10.4161/onci.26491. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Budhu S, Loike JD, Pandolfi A, Han S, Catalano G, Constantinescu A, et al. CD8+ T cell concentration determines their efficiency in killing cognate antigen-expressing syngeneic mammalian cells in vitro and in mouse tissues. J Exp Med. 2010;207:223–35. doi: 10.1084/jem.20091279. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Solit DB, Garraway LA, Pratilas CA, Sawai A, Getz G, Basso A, et al. BRAF mutation predicts sensitivity to MEK inhibition. Nature. 2006;439:358–62. doi: 10.1038/nature04304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Rizvi NA, Hellmann MD, Snyder A, Kvistborg P, Makarov V, Havel JJ, et al. Mutational landscape determines sensitivity to PD-1 blockade in non-small cell lung cancer. Science (80-) American Association for the Advancement of Science. 2015;348:124–8. doi: 10.1126/science.aaa1348. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Snyder A, Makarov V, Merghoub T, Yuan J, Zaretsky JM, Desrichard A, et al. Genetic Basis for Clinical Response to CTLA-4 Blockade in Melanoma. N Engl J Med. 2014;371:2189–99. doi: 10.1056/NEJMoa1406498. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Van Allen EM, Miao D, Schilling B, Shukla SA, Blank C, Zimmer L, et al. Genomic correlates of response to CTLA4 blockade in metastatic melanoma. Science (80-) American Association for the Advancement of Science. 2015;350:207–11. doi: 10.1126/science.aad0095. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Liu L, Mayes PA, Eastman S, Shi H, Yadavilli S, Zhang T, et al. The BRAF and MEK Inhibitors Dabrafenib and Trametinib: Effects on Immune Function and in Combination with Immunomodulatory Antibodies Targeting PD1, PD-L1 and CTLA-4. Clin Cancer Res. 2015 doi: 10.1158/1078-0432.CCR-14-2339. [DOI] [PubMed] [Google Scholar]
- 37.Hu-Lieskovan S, Mok S, Homet Moreno B, Tsoi J, Robert L, Goedert L, et al. Improved antitumor activity of immunotherapy with BRAF and MEK inhibitors in BRAF(V600E) melanoma. Sci Transl Med. 2015;7:279ra41. doi: 10.1126/scitranslmed.aaa4691. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Kortum RL, Rouquette-Jazdanian AK, Samelson LE. Ras and extracellular signal-regulated kinase signaling in thymocytes and T cells. Trends Immunol. 2013;34:259–68. doi: 10.1016/j.it.2013.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Ebert PJR, Cheung J, Yang Y, Kim JM, Belvin M, Mellman I, et al. Article MAP Kinase Inhibition Promotes T Cell and Anti-tumor Activity in Combination with PD-L1 MAP Kinase Inhibition Promotes T Cell and Anti-tumor Activity in Combination with PD-L1 Checkpoint Blockade. Immunity Elsevier Inc. 2016:1–13. doi: 10.1016/j.immuni.2016.01.024. [DOI] [PubMed] [Google Scholar]
- 40.Vella LJ, Pasam A, Dimopoulos N, Andrews M, Knights A, Puaux A-L, et al. MEK inhibition, alone or in combination with BRAF inhibition, affects multiple functions of isolated normal human lymphocytes and dendritic cells. Cancer Immunol Res. 2014 doi: 10.1158/2326-6066.CIR-13-0181. canimm.0181.2013. [DOI] [PubMed] [Google Scholar]
- 41.Callahan MK, Masters G, Pratilas CA, Ariyan C, Katz J, Kitano S, et al. Paradoxical activation of T cells via augmented ERK signaling mediated by a RAF inhibitor. Cancer Immunol Res. 2014;2:70–9. doi: 10.1158/2326-6066.CIR-13-0160. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Vella LJ, Andrews MC, Pasam A, Woods K, Behren A, Cebon JS. The kinase inhibitors dabrafenib and trametinib affect isolated immune cell populations. Oncoimmunology. 3:e946367. doi: 10.4161/21624011.2014.946367. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Gobin SJP, Biesta P, Van den Elsen PJ. Regulation of human β2-microglobulin transactivation in hematopoietic cells. Blood. 2003;101:3058–64. doi: 10.1182/blood-2002-09-2924. [DOI] [PubMed] [Google Scholar]
- 44.Wolchok D, Goodman A. induction cells of NF-xB may be necessary but is not sufficient for of H-2 antigens by TNF in J558L murine myeloma. Cytokines. 1994;55:7–12. doi: 10.1002/jlb.55.1.7. [DOI] [PubMed] [Google Scholar]
- 45.Gobin SJP, Peijnenburg A, Van Eggermond M, Van Zutphen M, Van Den Berg R, Van Den Elsen PJ. The RFX complex is crucial for the constitutive and CIITA-mediated transactivation of MHC class I and B2-microglobulin genes. Immunity. 1998;9:531–41. doi: 10.1016/s1074-7613(00)80636-6. [DOI] [PubMed] [Google Scholar]
- 46.Zaidi MR, Merlino G. The Two Faces of Interferon-γ in Cancer. Clin Cancer Res. 2011;17:6118–24. doi: 10.1158/1078-0432.CCR-11-0482. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Pollack BP, Sapkota B, Cartee TV. Epidermal Growth Factor Receptor Inhibition Augments the Expression of MHC Class I and II Genes. Clin Cancer Res. 2011;17:4400–13. doi: 10.1158/1078-0432.CCR-10-3283. [DOI] [PubMed] [Google Scholar]
- 48.Mimura K, Shiraishi K, Mueller A, Izawa S, Kua L-F, So J, et al. The MAPK pathway is a predominant regulator of HLA-A expression in esophageal and gastric cancer. J Immunol. 2013;191:6261–72. doi: 10.4049/jimmunol.1301597. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Fogdell-Hahn A, Ligers A, Gronning M, Hillert J, Olerup O. Multiple sclerosis: a modifying influence of HLA class I genes in an HLA class II associated autoimmune disease. Tissue Antigens. 2000;55:140–8. doi: 10.1034/j.1399-0039.2000.550205.x. [DOI] [PubMed] [Google Scholar]
- 50.Brown MA, Kenna T, Wordsworth BP. Genetics of ankylosing spondylitis-insights into pathogenesis. Nat Rev Rheumatol. 2016;12:81–91. doi: 10.1038/nrrheum.2015.133. [DOI] [PubMed] [Google Scholar]
- 51.Caroline Robert MD, Thomas S, Kupper M. Inflammatory Skin Diseases, T Cells, and Immune Surveillance — NEJM. N Engl J Med. 1999;341:1817–28. doi: 10.1056/NEJM199912093412407. [DOI] [PubMed] [Google Scholar]