Abstract
The recessive juvenile spermatogonial depletion (jsd) mutation results in a single wave of spermatogenesis, followed by failure of type A spermatogonia to differentiate, resulting in adult male sterility. We have identified a jsd-specific rearrangement in the mouse homologue of the Saccharomyces cerevisiae gene UTP14, termed mUtp14b. Confirmation that mUtp14b underlies the jsd phenotype was obtained by transgenic bacterial artificial chromosome (BAC) rescue. We also identified a homologous gene on the Mus musculus X chromosome (MMUX) (mUtp14a) that is the strict homologue of the yeast gene, from which the intronless mUtp14b has been derived by retrotransposition. Expression analysis showed that mUtp14b is predominantly expressed in the germ line of the testis from zygotene through round spermatids, whereas mUtp14a, although well expressed in all somatic tissues, could be detected only in the germ line in round spermatids. In yeast, depletion of the UTP proteins impedes production of 18S rRNA, leading to cell death. We propose that the retroposed autosomal copy mUtp14b, having acquired a testis-specific expression pattern, could have provided a mechanism for increasing the efficiency and/or numbers of germ cells produced by meeting the need for more 18S rRNA and protein. Such a mechanism would be of obvious reproductive advantage and be strongly selected for in evolution. Consistent with this hypothesis is the finding of a similar X-autosome retroposition of UTP14 in human which seems to have arisen independently of that in rodents. In jsd homozygotes, which lack a functional copy of Utp14b, insufficient production of rRNA quickly leads to a cessation of spermatogenesis.
Spermatogenesis is a complex, highly ordered process of cell division and differentiation by which spermatogonial stem cells give rise to large numbers of mature spermatozoa (1). It is an essential determinant of fertility in all mammals, playing a fundamental role in the perpetuation of the species, maintaining its genetic diversity, and driving evolution. Successful completion depends on a precisely orchestrated cascade of developmentally regulated genes controlling and coordinating stem cell renewal, mitotic spermatogonial cell proliferation, meiotic chromosomal reduction divisions, and, finally, morphological differentiation to produce mature sperm. Disruption of this process at any of these stages can result in reproductive failure, a problem experienced by at least 5% of the human male population (2).
At present, >200 spontaneous or engineered models affecting fertility exist in the mouse (3). The study of such mutants is currently playing a key role in dissecting the genetic basis of germ cell development. One such model is the recessive juvenile spermatogonial depletion (jsd) mutant first described by Beamer et al. (4). The phenotype observed in developing jsd/jsd testes is one of a single postnatal wave of spermatogenesis, followed by a failure of type A spermatogonia to continue differentiating further (5, 6). This mutation results in sterile adults with small testis, good numbers of Sertoli cells, and a few type A spermatogonia. Unlike several other models with a similar phenotype, such as the Steel Sl17H allele (7), jsd does not exhibit any other phenotype except male sterility, homozygous females being normally fertile. Reciprocal stem cell transplantations have shown that the defect is confined to the germ cells themselves (6, 8) rather than the supporting cell lineage, and the genetic mutation has been mapped to a 1.5-Mb interval on MMU1 (9). Thus, jsd represents a nonpleiotropic animal model for analyzing the regulation of early germ cell differentiation and also provides a firm genetic basis for the study of certain types of idiopathic infertility in man.
We report here the identification of a small rearrangement within mUtp14b that underlies the jsd phenotype. mUtp.14b represents a testis-specific retroposed copy of the ubiquitously expressed X-linked gene mUtp14a. This gene is homologous to the yeast UTP14 gene, which is an essential component of a large ribonucleoprotein complex containing the U3 small nucleolar RNA (10). Deletion of UTP proteins in yeast inhibits 18S rRNA production, indicating that they are part of the active pre-rRNA-processing complex termed the small subunit processome. We propose that the autosomal retroposon mUtp14b has been selected for in evolution due to its ability to specifically increase the efficiency of protein production during spermatogenesis.
Materials and Methods
Mouse Husbandry, Transgenic Rescue, and PCR Analysis. Jsd mice (4), originally obtained on the C57BL/6 inbred background, were maintained on a mixed C57BL/6 × C3H/J cross as described (8). Homozygote breeding females were identified by using flanking PCR markers 24/IV/B9 (0.55 Mb proximal to jsd) and D1MIT214 (7.7 Mb distal to jsd). Upon identification of the rearrangement within mUtp14b, we were able to directly identify the lesion by PCR. A 334-bp fragment of mUtp14b was amplified from genomic DNA by using primers Ntest8f/Ntestmsr (tgtgacagaccttctggcttt and tggggtgagcgtctttgact) and then restricted with HphI overnight. Products were then analyzed on a 3% agarose gel. Normal C57BL/6 DNA is cut, giving two fragments of 110 bp and 224 bp. The lesion in jsd/jsd DNA destroys the HphI site, giving a single band of 334 bp (Fig. 1C). A transgenic mouse line expressing an intact copy of mUtp14b was made by injecting bacterial artificial chromosome (BAC) RPCI-22-292L24 (129/sv/tac origin) into the male pronucleus of FVB embryos. Offspring were checked for BAC carrier status by PCR of tail DNA with BAC-specific primers BACscreenNTR and pBace3.6R (tctggttcctgcacagttagg and tcagctactgttccgtcagcga), which identify a specific 940-bp fragment of the BAC vector backbone. A female founder carrying the BAC was then bred to a heterozygous jsd/+ male. Offspring were typed for the mUtp14b lesion (as described above) and the presence of the BAC. Doubly heterozygous males carrying the BAC and jsd mutation were subsequently bred to proven jsd/jsd females to produce jsd/jsd males carrying the BAC. Such males and their nontransgenic littermates were killed at 6–8 weeks, and their testes were weighed and processed for either sperm function analysis, histology, or total RNA extraction.
Fig. 1.
Structure of mUtp14b in normal and jsd DNA. (A) Structure of the region of chromosome 1 around jsd. Pax3 (paired box3); Frsb (phenylalanyl tRNA synthetase β subunit); Dgat2l1 (diacylglycerol O-acyltransferase 2-like); Facl3 (fatty-acid-CoA ligase, long-chain 3); Kcne4 (potassium voltage-gated channel, Isk-related subfamily, gene 4). Flanking markers 24/IV/B9 and D1Mit214 are arrowed. mUtp14b is located within the first intron of Facl3 and consists of 3 exons. The coding region of the gene (shaded box) is contained entirely within exon 3. (B) Mutation within the mUtp.14.1 gene in homozygous jsd/jsd DNA compared with that in +/+ C57BL/6 (B6). The jsd mutation is the result of CC being replaced with GAAAAG, resulting in the substitution of 2 amino acids and a frame shift that places a stop codon immediately behind the substitution, effectively creating a null mutation of mUtp14b. (C) Genotyping the jsd lesion. After restriction of the 334-bp product with HphI, normal +/+ DNA gives a 224-bp and 110-bp band (lanes 1, 2, and 8); homozygous jsd/jsd mice, which have lost the Hph site, give a single 334-bp band (lane 6); and heterozygous jsd/+ mice three bands of 334 bp, 224 bp, and 110 bp (lanes 3, 4, 5, and 7).
Sperm Function Assays. Wild-type, jsd/+, jsd/jsd and jsd/jsd BAC rescued mice were killed at 6–8 weeks. Testes weights, epididymal sperm counts, sonication-resistant sperm heads, and motility were all determined by using established protocols (11, 12). All data represent the average of two mice.
mRNA Analysis. Total RNA was isolated from mouse tissues by homogenization in TRIzol Reagent according to the manufacturer's instructions (GIBCO/BRL). First-strand cDNA was synthesized with the use of a RETROscript Kit (Ambion, Austin, TX). mUtp14b- and mUtp14a-specific transcripts were detected by PCR of the cDNA by using primers Ntestex3F/Ntest8AR (ctccttgaacttgctgtgagg and tgggaaaaatcaactgctctg) and UtpX11F/UtpX7R (acccagaagctgcaagttgtg and tcctctactgttgtcggaagc), respectively.
Histopathology of the Testis. Testes were fixed in either paraformaldehyde or Bouin's solution, embedded in paraffin wax, and sectioned at 5–7 μm, followed by staining with hematoxylin/ eosin. RNA probes for in situ hybridization were generated from testes RNA by RT-PCR by using primers to unique regions of the genes. A 705-bp probe from the 5′ UTR of mUtp14b was generated by using primers NtestLEND and Ntest8R (agagggtccctgaaaactgcg and accatccgactagcctcagat), and a 993-bp probe was generated from the 5′ end of the coding region of mUtp14a by using primers UtpX2F and UtpX11R (caagcactaccccttgagtgcc and tttgcatcacgactgcaactc). Products were cloned into the pCR4-TOPO vector (Invitrogen), and their integrity was checked by sequencing. [35S]UTP-labeled sense and antisense RNA transcripts were produced by using T3 and T7 promoter sites in the vector according to the manufacturer's protocol. Tissue sections were treated, hybridized, coated with Kodak NTB-2 emulsion, exposed, and developed following the protocol of Robinson et al. (13). Developed slides were counterstained with hematoxylin to aid in staging tubules and identifying the cell-specific expression pattern of genes under study. Antibody to germ cell nuclear antigen (GCNA1) (14) was kindly provided by G. Enders (University of Kansas) and antibody to SOX9 by F Poullat (INSERM, Montpellier, France); antibody to P450SCC was purchased from Chemicon. Immunohistochemistry for GCNA1 and P450SCC was performed by using secondary antibodies labeled with green fluorescent AlexaFluor 488 and red fluorescent AlexaFluor 594, respectively (Invitrogen).
Results
Identification of the jsd Mutation. We have identified a 1.5-Mb critical interval on MMU1 that encodes the jsd mutation (9). The testis expression pattern of eight identified candidate genes was then determined by RT-PCR, in situ hybridization, and/or Northern blot analysis, and their coding regions were sequenced. No mutations were found in any of these genes (data not shown). A transcript well expressed in normal, but undetectable in homozygous, jsd/jsd testes RNA extracted from either young (3–4 weeks) or old (8 weeks) males was then identified. As shown in Fig. 1 A, this gene, which maps to 79.4 Mb on MMU1, is completely contained within the first intron of Facl3 (fatty acid CoA ligase long chain 3). The predicted protein sequence, obtained from the full-length cDNA (gi26081612), was clearly homologous to the recently identified yeast small nucleolar ribonucleoprotein (snoRNP) complex nucleolar protein, UTP14 (10), and we have termed the mouse homolog mUtp14b. mUtp14b spans 9,145 bp of genomic DNA and is split into three exons that generate a 3,371-bp transcript encoding a protein of 779 aa. Transcription of mUtp14b starts 336-bp downstream of the 3′ end of exon 1 of Facl3, placing it within the first 23-kb intron. Exons 1 and 2 of Utp14b are noncoding (Fig. 1 A, open boxes), with the entire coding region of the gene contained within the single third exon (shaded box). Sequencing mUtp14b genomic DNA from jsd/jsd mice identified a lesion 304 bp from the initiator ATG, consisting of a 2-bp deletion and an insertion of 6 bp, when compared with the parental C57BL/6 DNA (Fig. 1B). This mutation predicts a shift in the ORF such that, after the first 105 aa, there are two substitutions (GE to LF) followed by a stop codon (Fig. 1B Lower), effectively disrupting the mUTP14B protein. This mutation was not found in the parental C57BL/6 strain or any other laboratory strains tested (C3H, 129/sv, FVB/N, A/J, or Mus castaneous), indicating that it is jsd-specific. This result strongly suggested that mUtp14b underlies the observed jsd phenotype.
BAC Rescue. To formally prove this point, we attempted to rescue the jsd phenotype by introducing a normal copy of mUtp14b into homozygous jsd/jsd males by means of BAC transgenesis. The BAC chosen (RPCI-22-292L24;gi19033590, origin 129/Sv/Tac) contains the complete sequence of mUtp14b in the Facl3 intron 1. One end of the BAC terminates 5.5 kb downstream of Facl3 exon 2 within the second intron of Facl3, allowing for expression of mUtp14b in the absence of a functional copy of Facl3. The other end terminates between exons 1 and 2 of Dgat2l1 (diacylglycerol O-acyltransferase 2-like), truncating the gene and rendering it functionally inactive. No other genes, either known or predicted, are contained within the BAC.
Testes of wild-type, jsd/+, jsd/jsd, and jsd/jsd plus BAC males were examined at 6 weeks of age, and a number of fertility parameters were examined. As shown in Table 1, the testes of BAC-rescued males were within the normal weight range: 105 mg vs. 19 mg for jsd/jsd littermates without the BAC. Sperm motility was normal and epididymal sperm counts slightly reduced, but the number of sonication-resistant sperm heads was normal. This latter assay can be used as a quantitative measure of sperm production that reflects the integrity of the entire spermatogenic process (11, 12). A histological analysis of testes sections indicated that normal spermatogenesis had been restored with all stages of spermatogenesis being present, with good numbers of mature spermatozoa seen in the epididymis (Fig. 2A). We also performed immunohistochemical analysis by using antibodies to GCNA1, SOX9, and P450SCC as markers for spermatogonia, Sertoli cell function, and Leydig cell function, respectively. As shown in Fig. 2 B and C, no differences could be seen between the normal and BAC-rescued jsd/jsd mice. Further, apoptosis assays showed no differences between normal and BAC-rescued mice (not shown). Two BAC-rescued jsd/jsd males were mated to normal FVB/N females. In a 3-month period, they produced six litters of normal size (8–10 pups per litter), indicating that fertility had been fully restored. These data show that mUtp14b is required for normal spermatogenesis in the mouse and that a mutation in the gene is responsible for the jsd phenotype.
Table 1. Sperm function assay of wild-type, jsd/jsd, and BAC-rescued mice.
| Motility, %
|
||||||
|---|---|---|---|---|---|---|
| Genotype | Testis weight, mg | Sperm heads per testis, 106 | Sperm per cauda epididymis, 106 | Forward mobile morphology | Tail wagging | Nonmotile |
| +/+ | 97 | 21.6 | 11.6 | 61 | 9 | 30 |
| jsd/+ | 82 | 14.9 | 9.4 | 56 | 7 | 37 |
| jsd/jsd | 19 | 0.0 | 0.0 | 0 | 0 | 0 |
| jsd/jsd plus BAC | 105 | 21.4 | 5.7 | 61 | 4 | 35 |
Fig. 2.
BAC rescue of jsd/jsd phenotype with mUtp14b. (A) Testes histology (Inset, epididymis) of adult jsd/+ (Left), jsd/jsd (Center), and jsd/jsd plus BAC (Right) littermate males. (B) Detection of spermatogonia and Leydig cells by using antibody to GCNA1 (green) and P450SCC (red). (C) Detection of Sertoli cells by using antibody to SOX9
Origin and Expression Pattern of mUtp Genes. Database searching revealed the presence of a homologous copy of the gene at 34.5 Mb on the mouse X chromosome, which we have termed mUtp14a. Alignment of mUtp14b and mUtp14a revealed that, at the nucleotide level, there is 80% identity in the coding region and, at the protein level, they share 65% identity and 75% similarity. The coding sequence of mUtp14a is spread across 15 exons on the X chromosome, compared with a single coding exon for mUtp14b (Fig. 3A). This finding strongly suggests that the latter represents a retrotransposed copy of the X gene.
Fig. 3.
Structure and expression of mUtp14b and mUtp14a. (A) The coding region of mUtp14a covers 15 exons, whereas mUtp14b is coded for within a single exon (shaded boxes). mUtp14b is preceded by two small exons that form the 5′ UTR, and the end of exon 3 forms the 3′ UTR (open boxes). mUtp14a has short UTRs that are contained within the first and terminal exons. (B) mUtp14b could be detected only in normal testis RNA (T1) and at a lower level in the brain (B Upper). No expression was seen in jsd/jsd or sex-reversed (Ods) testes. In contrast, mUtp14a could be detected in all tissues (Lower). RNA was prepared from liver (L), spleen (S), lung (Lu), heart (H), muscle (M), ovary (O), normal testis (T1), 4-week jsd/jsd testes (T2), and XX Ods/+ germ cell-deficient testes (T3).
The tissue-specific expression pattern of mUtp14b and Utp14a was examined by RT-PCR by using gene-specific primers (Fig. 3B). mUtp14b transcripts (Upper) were detected only in RNA from normal testis (T1) and weakly in the brain. No transcripts were detected in RNA from 3- to 4-week jsd/jsd testes (T2), which still contain many stages of spermatogenesis, or XX Ods/+ testes (T3), which lack germ cells (15). These data indicate that transcription of mUtp14b is absent in jsd/jsd homozygotes and is germ cell-dependent. In contrast, mUtp14a was expressed in all tissues tested, including jsd/jsd and XX Ods/+ testes (Fig. 3B Lower). In situ RNA hybridization analysis (Fig. 4) confirmed that mUtp14b was germ cell-specific, being expressed from late zygotene (stage XII) through round spermatids, with the strongest signal being in the nucleus. However, expression of mUtp14a could be detected only postmeiotically in round spermatids, stages I through VIII (Fig. 4A). The stage and approximate level of expression are shown in Fig. 4A. Red boxes indicate mUtp14b and green mUtp14a. Examples of the actual in situ analysis from which the summary data were generated are shown in Fig. 4B.
Fig. 4.
Expression of mUtp14b and mUtp14a during spermatogenesis. (A) mUtp14b is expressed from late zygotene (stage XII) through round spermatids (stage VI), with the strongest signal being in the nucleus (green). mUtp14a could be detected only in developing round spermatids in stages I through VIII (red). (B) Photomicrographs show the in situ results and staging of mUtp14b and mUtp14a. (Inset) A magnified (×100) view of the selected area to show actual silver grains.
Evolution of UTP Genes. An examination of the genome sequences of man and rat revealed the presence of functional UTP14 genes on human chromosomes X (at 127.7 Mb) and 13 (at 51.5 Mb), and in rat on chromosomes X (at 134.7 Mb) and 9 (at 78.2 Mb). In addition, a highly degraded non-function pseudogene could be identified on human chromosome 2 at 223.9 Mb. As in mouse, the X-linked copies of UTP14 are multiexonic, comprising 14 and 8 coding exons in man and rat, respectively. As shown in Fig. 5A, the autosomal hUTP14b and rUTP14b are encoded within a single large terminal exon that is preceded by several 5′ noncoding exons. This structure suggests that in both species the autosomal genes represent retroposed copies of the X gene. As in mouse, rUTP14b on rat chromosome 9 is within the first intron of Facl3, indicating a shared evolutionary history. In human, the orthologous region on chromosome 2 does not contain a functional gene, merely a degraded pseudogene, the functional copy, hUTP14B, being found on chromosome 13. These data suggest that hUTP14B arose in the primate lineage by a second transposition event from the X after separation from the rodent. The expression pattern of the human hUTP14 genes was examined by RT-PCR analysis by using RNA from human liver, lung, spleen, and testes. As in the mouse, we found that the X-linked hUTP14A was expressed in all tissues, whereas the retroposed autosomal hUTP14B was restricted to the testis (data not shown)
Fig. 5.
Evolutionary relationships between the Utp14 genes. (A) Autosomal mouse and rat Utp14b consist of 3 homologous exons (green boxes) that lie between the first two exons of Fcal3 (blue boxes). In human, a degraded nonfunctional pseudogene, UTP14B(RS), can be found in the orthologous position on human chromosome (Chr.) 2. A functional human copy, UTP14B, is found on chromosome 13, consisting of a homologous coding exon (green box) and 3 nonhomologous noncoding exons (red boxes). Positions of predicted prompters are indicated by yellow circles. (B) Cladogram of yeast and mammalian UTP14 proteins shows that a first retroposition of UTP14 from Chr. X (R1) preceded the divergence of the human and rodent lineages, giving rise to functional autosomal genes in mouse and rat (m/rUtp14b). A second independent retroposition (R2) occurred in the primate lineage after separation from rodent, leading to a functional copy on Chr. 13 (UTP14b) and the degradation of the original more ancient retroposed sequence. A footprint of this original event in the form of a nonfunctional pseudogene can be see in the orthologous region on human Chr. 2 (Fig. 5A).
No obvious homologies could be detected between the sequences directly upstream of the 5′ UTR of the retrogene and the original X-linked copy in either mouse, rat, or human. This finding implies that, in rodent and human, Utp14 did not retropose with its own promoter but inserted 3′ of an existing promoter element. There are two predicted core element prompters, P1 and P2, immediately upstream of the first exon of m/rUtp14b that are identical in mouse and rat. P1 (CGTGGGTGGGT) contains a predicted transcriptional start site indicated in bold type. P2, GCGGCGTCCGTG, is identical to a known promoter associated with rat U1 small nuclear RNA genes (16). The functional human UTP14b found on chromosome 13 consists of 4 exons that are preceded by two predicted promoters. The first, hP1, has the sequence GGCTGTCAATCA; the second, hP2 (GGGCGGGGCGAG) is identical to a known promoter associated with chicken U1 small nuclear RNA genes (17). Confirmation of these promoter predictions and identification of enhancer and/or binding elements that could confer germ cell specificity will help to clarify how retrogenes achieve a testis-specific expression pattern.
To further investigate the evolution of the UTP genes, a cladogram was constructed from the alignment of mammalian and yeast UTP14 proteins by using the clustalw algorithm (Fig. 5B). It can be seen that the mammalian X chromosome-encoded peptides diverged from yeast together. The mouse and rat autosomal copies of UTP14 diverged independently of the X copies, suggesting that the retrotransposition of UTP in mouse and rat preceded divergence of the rodent lineage. The human autosomal hUTP14b seems to have diverged from the X copy since separation of man and rodent, indicating that an independent, relatively recent retrotransposition from the X has given rise to a functional hUTP14b at the expense of the original chromosome 2 copy that has now degenerated. Table 2 shows the amino acid similarities of the UTP14 peptides. The high level of similarity between the human X and autosomal proteins (94%) also supports the hypothesis of a recent transposition event. Levels of divergence between the various forms of mammalian UTP14 suggest that these peptides are evolving relatively rapidly. However, conservation of function between mammalian and yeast UTP14 is indicated by the almost perfect alignment of the mammalian peptides with yeast (97.9–99.9% aligned) by blast conserved domain search.
Table 2. Percentage of amino acid similarity (identity) between human, mouse, and rat UTP14 proteins.
| mUTP14a | rUTP14a | HUTP14a | mUTP14b | rUTP14b | HUTP14b | |
|---|---|---|---|---|---|---|
| mUTP14a | 77 (72) | 85 (77) | 75 (65) | 68 (61) | 85 (76) | |
| rUTP14a | 73 (66) | 68 (58) | 65 (58) | 72 (64) | ||
| HUTP14a | 79 (68) | 72 (64) | 94 (90) | |||
| mUTP14b | 81 (77) | 77 (65) | ||||
| rUTP14b | 71 (61) | |||||
| HUTP14b |
Discussion
We have identified a mutation in mUtp14b that causes infertility in jsd mutant mice and have shown that the phenotype can be fully rescued by the introduction of a normal copy of this gene. UTP proteins, which are well conserved in evolution and ubiquitously expressed, were first identified in Saccharomyces cerevisiae (10, 18). They show a nucleolar localization and are specifically associated with the large ribonucleoprotein (RNP) complex containing the U3 small nucleolar RNA (snoRNA). In yeast, depletion of the UTP proteins impedes production of the 18S rRNA and is lethal, indicating that they are part of the active pre-rRNA processing complex. This large RNP complex has been termed the small subunit processome. By extrapolation, it seems apparent that compromised 18S rRNA and subsequent protein production in jsd/jsd germ cells is the underlying biological defect that leads to the arrest of spermatogenesis and sterility.
A search of the mouse genome sequence revealed a functional X-linked copy termed mUtp14a. This gene consists of 15 coding exons and represents the cognate UTP14 protein in the mouse. The intronless coding structure of mUtp14b suggests that it was derived from the X-linked gene by retroposition. Unlike mUtp14a, which is transcribed in all tissues tested, the autosomal copy has acquired a testis and germ cell specific expression pattern. The presence of a ubiquitously expressed X-linked gene and the restriction of mUtp14b expression to the germ line, provide an explanation as to why the jsd mutation in mUtp14b is not lethal as it is in yeast and why the phenotype is restricted to spermatogenesis. The germ cell expression of mUtp14b is consistent with our previous findings that the jsd defect is intrinsic to the mutant germ cells rather than a failure of the somatic component to support spermatogenesis (6, 8).
Three widely expressed conserved genes, (Pgk2, Pdha2, and hnRNP) that have retroposed from the X and acquired a male germ-line function have been reported (19–21); to date, 14 such genes have been clearly identified in man and mouse (22). A recent systematic analysis of retrogene evolution in mouse and human has shown that the X chromosome generates an ≈300% excess of retrogenes compared with autosomes (23). In addition, ≈77% of the retrogenes originating from the X show testes expression, compared with only 44% of retrogenes originating from autosomes. These authors (23) concluded that retroposition from the X seems to be driven by natural selection to attain male germ-line function. One such driving force relates to the localization of genes on the sex chromosomes. During meiosis, such genes are inactivated for transcription by sequestration in a heterochromatic XY body during the meiotic pachytene period (24, 25). Thus, any X-linked genes essential for cell function during this period will need to be replaced, providing a strong selection pressure on retrogenes originating from the X. This explanation is consistent with the expression pattern of Pgk2, Pdha2, and hnRNP where the X-linked gene is expressed in premeiotic germ cells and the autosomal retrogene is expressed after the X chromosome has been inactivated during male meiosis. This does not seem to be the case, however, with the mouse Utp14 genes. In situ hybridization to normal testis sections (Fig. 4A) revealed that the X-linked mUtp14a is not expressed premeiotically and then inactivated at meiosis. Rather, it is one of the very few X-linked genes that is expressed postmeiotically (23) in round spermatid stages I through VIII. The autosomal mUtp14b is continuously expressed from late zygotene through the round spermatid stage. The simplest explanation for the mode of action of mUtp14b is that, having retroposed and acquired a germ cell-specific expression pattern, it may have provided a mechanism for increasing the efficiency and/or numbers of germ cells produced, by meeting the need for more 18s rRNA and protein during the early stages of spermatogenesis. Such a mechanism would be of obvious reproductive advantage and would be strongly selected for in evolution. Consistent with this hypothesis is the finding of a second X-autosome (chromosome 13) retroposition of UTP14 in human, which also seems to have acquired a testis-specific expression pattern, but to have arisen later in the primate lineage after the separation from rodents.
A similar gene dosage mechanism has been proposed for the Y chromosome-linked translation initiation factor Eif2s3y. The presence of this protein is essential for spermatogonial proliferation despite the presence of a virtually identical germ cell-transcribed, X-linked copy, Eif3s2x. In man, there seems to be no Y-gene copy encoding EIF2S3; however, there is a retroposed X copy on chromosome 12 that is transcribed in the testis, which may have allowed the loss of a functional Y copy. Similarly, mouse has a retroposed copy of Ddx3 (the X-linked homolog of Dby) on chromosome 1, which is also transcribed in testis. These data may explain how spermatogenesis in the mouse can complete meiotic prophase in the absence of Dby, whereas, in man, DBY seems to be essential for spermatogonial proliferation and survival.
A detailed analysis of the jsd phenotype by several groups has shown that spermatogenesis starts normally during development but, after a single wave, declines ultimately to the point at which only proliferating, undifferentiated, and possibly differentiating type A spermatogonia and Sertoli cells remain in the seminiferous tubules (4, 5). Although type A spermatogonia proliferate, no accumulation of spermatogonia occurs because spermatogonial apoptosis also takes place (6). Expression of Utp14b was first detected at late zygotene (stage XII), somewhat later than the observed spermatogenic block might have predicted. It is possible that a low level of Utp14b expression is present in spermatogonia but is below the detection level of our in situ analysis. Alternatively, it is possible that germ cell death begins during the late zygotene stages and that the final observed jsd phenotype may be a consequence of secondary damage to the developing spermatogonia (26).
The fact that a primary wave of spermatogenesis in jsd/jsd mice is possible in the absence of any Utp14b gene product needs to be considered. The simplest hypothesis is that, for the initial wave of spermatogenesis, there is sufficient stored 18s rRNA to allow limited cell division, helped possibly by a low level of the X-linked UTP14a protein, which may be below our level of detection. Once continuous spermatogenesis becomes established, the demands for protein synthesis, in the absence of UTP14b, deplete any remaining 18s RNA, and germ cell division stops.
It has been shown that spermatogenesis in jsd/jsd homozygotes can be restimulated by reducing the high intratesticular testosterone (ITT) levels with a GnRH antagonist (27, 28). It has also been reported that cryptorchidism can rescue spermatogonial differentiation in jsd mice, although late stage spermatogenesis is lost (29). One mechanism by which this release could occur is the up-regulation of Utp14a gene in the early stages of spermatogenesis to compensate for the loss of Utp14b. In the first case, this reinitiation could occur as a consequence of ITT testosterone reduction. In the second case, it is possible that Utp14a has a lower activity at the normal testicular temperature of 34°C. Shifting to a higher intraabdominal temperature may increase the efficiency of the small subunit processome.
In summary, our data show that the gene mutation that gives rise to the jsd phenotype is located within the coding region of mUtp14b, itself mapping within the first intron of Facl3, at 79.4 Mb on MMU1. This gene, which by analogy to yeast is part of the small subunit processome essential for 18S ribosomal biosynthesis, represents a retroposed copy of the X-located mUtp14a gene. Although Utp14a is widely expressed in somatic cells, Utp14b has acquired a germ cell-specific expression pattern. We propose that it has been selected for during evolution to increase the efficiency or numbers of sperm produced. In jsd homozygotes, which lack a functional copy of Utp14b, insufficient production of rRNA and thus protein quickly leads to a block in spermatogenesis.
Acknowledgments
We thank Theresa Ty and Cavatina Truong for excellent technical assistance and Drs. H. Boettger-Tong, N. Levy, A. Agoulnik, D. Lamb, and Y. Nishimune for help throughout this project. Special thanks go to Drs. M. Meistrich and M. Zhao for assistance with testis staging, sperm assays, and photography, and for commenting on this manuscript. This work was supported by National Institutes of Health grants (to C.E.B.).
This paper was submitted directly (Track II) to the PNAS office.
Abbreviations: BAC, bacterial artificial chromosome; jsd, juvenile spermatogonial depletion.
References
- 1.McCarrey, J. I. (1993) in Cellular and Molecular Biology of the Testis, eds. Desjardins, C. & Ewing, L. L. (Oxford Univ. Press, New York), pp. 58–89.
- 2.Aitken, R. J. & Sawyer, D. (2003) Adv. Exp. Med. Biol. 518, 85–98. [DOI] [PubMed] [Google Scholar]
- 3.Matzuk, M. M. & Lamb, D. J. (2002) Nat. Cell Biol. 4, Suppl., S41–S49. [DOI] [PubMed] [Google Scholar]
- 4.Beamer, W. G., Cunliffe-Beamer, T. L., Shultz, K. L., Langley, S. H. & Roderick, T. H. (1988) Biol. Reprod. 38, 899–908. [DOI] [PubMed] [Google Scholar]
- 5.de Rooij, D. G., Okabe, M. & Nishimune, Y. (1999) Biol. Reprod. 61, 842–847. [DOI] [PubMed] [Google Scholar]
- 6.Ohta, H., Yomogida, K., Tadokoro, Y., Tohda, A., Dohmae, K. & Nishimune, Y. (2001) Int. J. Androl. 24, 15–23. [DOI] [PubMed] [Google Scholar]
- 7.Brannan, C. I., Bedell, M. A., Resnick, J. L., Eppig, J. J., Handel, M. A., Williams, D. E., Lyman, S. D., Donovan, P. J., Jenkins, N. A. & Copeland, N. G. (1992) Genes Dev. 6, 1832–1842. [DOI] [PubMed] [Google Scholar]
- 8.Boettger-Tong, H. L., Johnston, D. S., Russell, L. D., Griswold, M. D. & Bishop, C. E. (2000) Biol. Reprod. 63, 1185–1191. [DOI] [PubMed] [Google Scholar]
- 9.Boettger-Tong, H. L., Rohozinski, J., Agoulnik, A. I., Dohmae, K., Nishimune, Y., Levy, N. & Bishop, C. E. (2001) Biochem. Biophys. Res. Commun. 288, 1129–1135. [DOI] [PubMed] [Google Scholar]
- 10.Dragon, F., Gallagher, J. E., Compagnone-Post, P. A., Mitchell, B. M., Porwancher, K. A., Wehner, K. A., Wormsley, S., Settlage, R. E., Shabanowitz, J., Osheim, Y., et al. (2002) Nature 417, 967–970. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Meistrich, M. L. & van Beek, M. (1993) in Methods in Reproductive Toxicology, eds. Chapin, R. E. & Heindel, J. (Academic, New York), Vol. 3A, pp. 106–123. [Google Scholar]
- 12.Zhao, M., Shirley, C. R., Yu, Y. E., Mohapatra, B., Zhang, Y., Unni, E., Deng, J. M., Arango, N. A., Terry, N. H., Weil, M. M., et al. (2001) Mol. Cell. Biol. 21, 7243–7255. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Robinson, M. L., Overbeek, P. A., Verran, D. J., Grizzle, W. E., Stockard, C. R., Friesel, R., Maciag, T. & Thompson, J. A. (1995) Development (Cambridge, U.K.) 121, 505–514. [DOI] [PubMed] [Google Scholar]
- 14.Enders, G. C. & May, J. J., 2nd (1994) Dev. Biol. 163, 331–340. [DOI] [PubMed] [Google Scholar]
- 15.Bishop, C. E., Whitworth, D. J., Qin, Y., Agoulnik, A. I., Agoulnik, I. U., Harrison, W. R., Behringer, R. R. & Overbeek, P. A. (2000) Nat. Genet. 26, 490–494. [DOI] [PubMed] [Google Scholar]
- 16.Watanabe-Nagasu, N., Itoh, Y., Tani, T., Okano, K., Koga, N., Okada, N. & Ohshima, Y. (1983) Nucleic Acids Res. 11, 1791–1801. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Earley, J. M., 3rd, Roebuck, K. A. & Stumph, W. E. (1984) Nucleic Acids Res. 12, 7411–7421. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Wehner, K. A., Gallagher, J. E. & Baserga, S. J. (2002) Mol. Cell. Biol. 22, 7258–7267. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.McCarrey, J. R., Berg, W. M., Paragioudakis, S. J., Zhang, P. L., Dilworth, D. D., Arnold, B. L. & Rossi, J. J. (1992) Dev. Biol. 154, 160–168. [DOI] [PubMed] [Google Scholar]
- 20.Dahl, H. H., Brown, R. M., Hutchison, W. M., Maragos, C. & Brown, G. K. (1990) Genomics 8, 225–232. [DOI] [PubMed] [Google Scholar]
- 21.Elliott, D. J., Venables, J. P., Newton, C. S., Lawson, D., Boyle, S., Eperon, I. C. & Cooke, H. J. (2000) Hum. Mol. Genet. 9, 2117–2124. [DOI] [PubMed] [Google Scholar]
- 22.Wang, P. J. (2004) Trends Endocrinol. Metab. 15, 79–83. [DOI] [PubMed] [Google Scholar]
- 23.Emerson, J. J., Kaessmann, H., Betran, E. & Long, M. (2004) Science 303, 537–540. [DOI] [PubMed] [Google Scholar]
- 24.Turner, J. M., Mahadevaiah, S. K., Elliott, D. J., Garchon, H. J., Pehrson, J. R., Jaenisch, R. & Burgoyne, P. S. (2002) J. Cell Sci. 115, 4097–4105. [DOI] [PubMed] [Google Scholar]
- 25.Richler, C., Ast, G., Goitein, R., Wahrman, J., Sperling, R. & Sperling, J. (1994) Mol. Biol. Cell 5, 1341–1352. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Meistrich, M. L. & Shetty, G. (2003) J. Androl. 24, 135–148. [DOI] [PubMed] [Google Scholar]
- 27.Tohda, A., Okuno, T., Matsumiya, K., Okabe, M., Kishikawa, H., Dohmae, K., Okuyama, A. & Nishimune, Y. (2002) Biol. Reprod. 66, 85–90. [DOI] [PubMed] [Google Scholar]
- 28.Shetty, G., Wilson, G., Huhtaniemi, I., Boettger-Tong, H. & Meistrich, M. L. (2001) Endocrinology 142, 2789–2795. [DOI] [PubMed] [Google Scholar]
- 29.Shetty, G. & Weng, C. C. (2004) Endocrinology 145, 126–133. [DOI] [PubMed] [Google Scholar]





