Molecular screening of the C^w antigen for typing donors compatible with patients with anti-MAR-like antibodies

Introduction

The prevalence of C^w (Rh8) specificity in the Polish population is relatively high compared to that in other western European countries (2.5%)^1,2. This is probably related to the population’s geographical proximity to the Latvian and Finnish populations in which C^w is relatively frequent (7–9%)^1,3–4. Thus the prevalence of C^w homozygous individuals belonging to the very rare group with a Rh51(MAR)-negative phenotype is slightly higher in our region. These individuals may produce anti-MAR-like allo-antibodies following transfusion or pregnancy^5–6. Recently anti-MAR-like antibody was detected in a Polish patient (TW) following repeated transfusions⁷. This antibody reacts with all the red blood cells of the common Rh phenotype, except D or Rh_null and it was extremely difficult to supply compatible blood components for transfusion because of the limited availability of anti-MAR-like serum for screening. The C^w specificity is caused by the 122A>G in exon 1 of the RHCE gene⁴. To circumvent serological limitations we have designed a simple, standard method of C^w allelic discrimination using real-time polymerase chain reaction (PCR) to type donors suitable for transfusion or antibody screening panels for such patients.

Material and methods

Blood samples were collected from two patients with anti-MAR-like antibodies (TW and KK), 300 consecutive blood donors preselected as C+C^w+c (170 samples) and C+C^w c (130 samples) in the routine typing of 3,500 donors performed in Regional Blood Transfusion Centres and four reference samples (with known C/C^w/c phenotypes and the reference sample of C+c+C^x+ DNA, kindly provided by Joyce Poole and Shane Grimsley, NHSBT Filton Blood Centre, Bristol, UK).

Genomic DNA was isolated manually using a NucleoSpin Blood Kit (Marcheney Nagle GmbH, Duren, Germany) (210 samples) or Genomic Mini AX BLOOD96-well Kit (A&ABiotechnology, Gdynia, Poland) (96 samples).

C^w allelic discrimination reactions were performed in a final volume of μL with 20 ng of DNA and Universal Master Mix (Life Technology) on ABIPrism 7700 (Applied Biosystems, Branchburg, NJ, USA). The primers (forward GCTGCCTGCCCCTCTGC specific for RHCE*02.01, reverse TGCTCCTGTGACCACTGTTCC specific for RHCE*02.01 and Taqman probes (CGCTTCCTTAGAGGATCAAAAGGGGCTCGT-[FAM] specific for RHD or RHCE*02.01; CGCTTCCTTAGAGGATCGAAAGGGGCTCGT-[VIC] specific for RHCE* 02.08) were designed with Primer ExpressTM1.0 (Applied Biosystems). Amplification conditions were: 50 °C for 10 minutes, 95 °C for 2 minutes, then 40 cycles of 60 °C for 1 minute and 95 °C for 15 seconds.

The red blood cells of donors 6 and 7 as well as patient KK were tested with plasma from patient TW to confirm the phenotype. An indirect antiglobulin test was performed on the donors’ red blood cells using DiaMed microcolumns. Unfortunately, the anti-MAR-like antibodies lost their activity during our study and it was impossible to confirm all the homozygous donors.

The DNA of donors with the C^w homozygous genotype and of the reference samples was tested by direct DNA sequencing on a 3130 Genetic Analyzer (Applied Biosystems). We used 3 μL of the amplicons; generated with the same primers and conditions as were used for allelic discrimination, and purified with QIAquick PCR Purification Kit (Qiagen, Hilden, Germany); for sequencing with the ABI Prism Big Dye Terminator v1.1 Cycle Sequencing Kit (Life Technology, Austin, TX, USA), purified with Centri-Sep spin columns (Life Technology).

Results

Table I shows the results for 300 consecutive donors tested with the C^w discrimination assay (C^w genotype calls shown in Figure 1). Of 130 samples typed as C^w-negative by serology, all had a C^w-negative genotype. Of 170 donors phenotyped as C^w-positive, we discriminated 163 C^w heterozygotes and seven C^w homozygotes (including one reference sample). In four samples (donors 2–5) direct sequencing confirmed the C^w homozygous results and two samples (donors 6 and 7) were compatible with serum with anti-MAR-like antibodies (Figure 2 and Online Supplementary Table I).

Table I.

The results of C^w allelic discrimination.

Rh phenotype	N. of donors
	Cw negative/Cw negative	Cw positive/Cw negative	Cw positive/Cw positive
C+Cw−	130	-	-
C+Cw+	-	163	7*

^*Including one reference DNA from donor 1 compatible with the plasma from patient TW with anti-MAR-like antibodies.

Figure 1.

C^w allelic discrimination by real-time polymerase chain reaction.

Figure 2.

Results of DNA sequencing. Positions 122 and 106, encoding C^w and C^x specificity, are marked by a star and triangle, respectively.

The allelic discrimination of DNA isolated from patient KK confirmed her C^w homozygous genotype.

Discussion

We report here the results of our C^w allelic discrimination assay, which we designed in response to Polish transfusion requirements for blood components compatible with patients with anti-MAR-like antibodies. The basic objective of the project was to design a method for C^w genotyping to find homozygotes among consecutive donors pre-typed serologically as C+C^w+ in Regional Blood Transfusion Centres. We managed to discriminate 169 such donors and to confirm their C^w homozygous status in six cases. The high frequency of detected C^w homozygotes agrees with the high prevalence of C^w specificity in the Polish population (about 5%)⁷. Donors potentially compatible with patients with anti-MAR-like antibodies or suitable for antibody screening panels were found in a very short period of time at no additional cost apart from the ordering of new primers, probes or PCR buffers, with no costs related to DNA extraction because DNA samples came from the blood biobank. Furthermore, the real-time PCR method presented here is suitable for large scale typing and requires only a small amount of genomic DNA, but for future screening it would be reasonable to adjust the test to a pipetting workstation for a fully automated protocol.

At the molecular level, the design of an amplification reaction within RHCE or RHD loci is complicated by the high level of similarity of both genes. Moreover, C^w antigen is produced by the RHCE gene encoding both C and c specificities and our project required the differentiation of the C^w position in relation to other characteristics coexisting within the same gene. In order to achieve the correct specificity of the reaction, we therefore, narrowed the tested group down to donors with the C+c C^w+ phenotype. The forward primer was designed to contain cytosine at the 3′ end (in position 48 of RHCE) which is only characteristic for RHCE*C. Mouro et al. suggested that the so-called “cyt48” position is conserved in the C^w-positive haplotype because the C^w peptide is a hybrid composed of the N-terminal fragment deriving from exon 1 of RHCE*C and the rest of the protein, encoded by exons 2–10 of other RHCE allelic forms⁴. The reverse primer was specific for the RHCE gene. Fluorescent probes were designed to amplify position 122 of RHCE. The nucleotide sequence of the C^w-negative probe is only specific for the RHCE gene but the C^w-positive probe has the same sequence as the RHD gene because both genes contain an adenine at position 122. The designed primers were only specific to the RHCE gene to limit the non-specific RHD amplification with the C^w-positive probe. Simultaneously, the presented assay does not type the C^x antigen, so some C^x-related MAR-negative individuals are missed.

In addition, the C^w discrimination assay is a useful instrument for the confirmation of a patient’s C^w phenotype and to confirm the serological result for very rare anti-MAR-like antibodies in their serum. From this point of view, DNA typing can be a valuable addition to serological testing, contributing to improved safety of blood transfusions.

Conclusions

C^w discrimination allows us to test alleles with a high degree of accuracy in a manner that is both simple and fast. Of the 169 donors typed as C_w+ we discriminated six C^w homozygotes. This is the first work on pre-typing donors compatible with patients with anti-MAR-like antibodies by genetic screening prior to serological investigations.