Skip to main content
Blood Transfusion logoLink to Blood Transfusion
. 2015 Sep 22;14(6):573–576. doi: 10.2450/2015.0044-15

Molecular screening of the Cw antigen for typing donors compatible with patients with anti-MAR-like antibodies

Agnieszka Orzińska 1,, Katarzyna Guz 1, Bogumiła Michalewska 1, Ewa Brojer 1
PMCID: PMC5111387  PMID: 26509828

Introduction

The prevalence of Cw (Rh8) specificity in the Polish population is relatively high compared to that in other western European countries (2.5%)1,2. This is probably related to the population’s geographical proximity to the Latvian and Finnish populations in which Cw is relatively frequent (7–9%)1,34. Thus the prevalence of Cw homozygous individuals belonging to the very rare group with a Rh51(MAR)-negative phenotype is slightly higher in our region. These individuals may produce anti-MAR-like allo-antibodies following transfusion or pregnancy56. Recently anti-MAR-like antibody was detected in a Polish patient (TW) following repeated transfusions7. This antibody reacts with all the red blood cells of the common Rh phenotype, except D or Rhnull and it was extremely difficult to supply compatible blood components for transfusion because of the limited availability of anti-MAR-like serum for screening. The Cw specificity is caused by the 122A>G in exon 1 of the RHCE gene4. To circumvent serological limitations we have designed a simple, standard method of Cw allelic discrimination using real-time polymerase chain reaction (PCR) to type donors suitable for transfusion or antibody screening panels for such patients.

Material and methods

Blood samples were collected from two patients with anti-MAR-like antibodies (TW and KK), 300 consecutive blood donors preselected as C+Cw+c (170 samples) and C+Cw c (130 samples) in the routine typing of 3,500 donors performed in Regional Blood Transfusion Centres and four reference samples (with known C/Cw/c phenotypes and the reference sample of C+c+Cx+ DNA, kindly provided by Joyce Poole and Shane Grimsley, NHSBT Filton Blood Centre, Bristol, UK).

Genomic DNA was isolated manually using a NucleoSpin Blood Kit (Marcheney Nagle GmbH, Duren, Germany) (210 samples) or Genomic Mini AX BLOOD96-well Kit (A&ABiotechnology, Gdynia, Poland) (96 samples).

Cw allelic discrimination reactions were performed in a final volume of μL with 20 ng of DNA and Universal Master Mix (Life Technology) on ABIPrism 7700 (Applied Biosystems, Branchburg, NJ, USA). The primers (forward GCTGCCTGCCCCTCTGC specific for RHCE*02.01, reverse TGCTCCTGTGACCACTGTTCC specific for RHCE*02.01 and Taqman probes (CGCTTCCTTAGAGGATCAAAAGGGGCTCGT-[FAM] specific for RHD or RHCE*02.01; CGCTTCCTTAGAGGATCGAAAGGGGCTCGT-[VIC] specific for RHCE* 02.08) were designed with Primer ExpressTM1.0 (Applied Biosystems). Amplification conditions were: 50 °C for 10 minutes, 95 °C for 2 minutes, then 40 cycles of 60 °C for 1 minute and 95 °C for 15 seconds.

The red blood cells of donors 6 and 7 as well as patient KK were tested with plasma from patient TW to confirm the phenotype. An indirect antiglobulin test was performed on the donors’ red blood cells using DiaMed microcolumns. Unfortunately, the anti-MAR-like antibodies lost their activity during our study and it was impossible to confirm all the homozygous donors.

The DNA of donors with the Cw homozygous genotype and of the reference samples was tested by direct DNA sequencing on a 3130 Genetic Analyzer (Applied Biosystems). We used 3 μL of the amplicons; generated with the same primers and conditions as were used for allelic discrimination, and purified with QIAquick PCR Purification Kit (Qiagen, Hilden, Germany); for sequencing with the ABI Prism Big Dye Terminator v1.1 Cycle Sequencing Kit (Life Technology, Austin, TX, USA), purified with Centri-Sep spin columns (Life Technology).

Results

Table I shows the results for 300 consecutive donors tested with the Cw discrimination assay (Cw genotype calls shown in Figure 1). Of 130 samples typed as Cw-negative by serology, all had a Cw-negative genotype. Of 170 donors phenotyped as Cw-positive, we discriminated 163 Cw heterozygotes and seven Cw homozygotes (including one reference sample). In four samples (donors 2–5) direct sequencing confirmed the Cw homozygous results and two samples (donors 6 and 7) were compatible with serum with anti-MAR-like antibodies (Figure 2 and Online Supplementary Table I).

Table I.

The results of Cw allelic discrimination.

Rh phenotype N. of donors

Cw negative/Cw negative Cw positive/Cw negative Cw positive/Cw positive
C+Cw 130 - -
C+Cw+ - 163 7*
*

Including one reference DNA from donor 1 compatible with the plasma from patient TW with anti-MAR-like antibodies.

Figure 1.

Figure 1

Cw allelic discrimination by real-time polymerase chain reaction.

Figure 2.

Figure 2

Results of DNA sequencing. Positions 122 and 106, encoding Cw and Cx specificity, are marked by a star and triangle, respectively.

The allelic discrimination of DNA isolated from patient KK confirmed her Cw homozygous genotype.

Discussion

We report here the results of our Cw allelic discrimination assay, which we designed in response to Polish transfusion requirements for blood components compatible with patients with anti-MAR-like antibodies. The basic objective of the project was to design a method for Cw genotyping to find homozygotes among consecutive donors pre-typed serologically as C+Cw+ in Regional Blood Transfusion Centres. We managed to discriminate 169 such donors and to confirm their Cw homozygous status in six cases. The high frequency of detected Cw homozygotes agrees with the high prevalence of Cw specificity in the Polish population (about 5%)7. Donors potentially compatible with patients with anti-MAR-like antibodies or suitable for antibody screening panels were found in a very short period of time at no additional cost apart from the ordering of new primers, probes or PCR buffers, with no costs related to DNA extraction because DNA samples came from the blood biobank. Furthermore, the real-time PCR method presented here is suitable for large scale typing and requires only a small amount of genomic DNA, but for future screening it would be reasonable to adjust the test to a pipetting workstation for a fully automated protocol.

At the molecular level, the design of an amplification reaction within RHCE or RHD loci is complicated by the high level of similarity of both genes. Moreover, Cw antigen is produced by the RHCE gene encoding both C and c specificities and our project required the differentiation of the Cw position in relation to other characteristics coexisting within the same gene. In order to achieve the correct specificity of the reaction, we therefore, narrowed the tested group down to donors with the C+c Cw+ phenotype. The forward primer was designed to contain cytosine at the 3′ end (in position 48 of RHCE) which is only characteristic for RHCE*C. Mouro et al. suggested that the so-called “cyt48” position is conserved in the Cw-positive haplotype because the Cw peptide is a hybrid composed of the N-terminal fragment deriving from exon 1 of RHCE*C and the rest of the protein, encoded by exons 2–10 of other RHCE allelic forms4. The reverse primer was specific for the RHCE gene. Fluorescent probes were designed to amplify position 122 of RHCE. The nucleotide sequence of the Cw-negative probe is only specific for the RHCE gene but the Cw-positive probe has the same sequence as the RHD gene because both genes contain an adenine at position 122. The designed primers were only specific to the RHCE gene to limit the non-specific RHD amplification with the Cw-positive probe. Simultaneously, the presented assay does not type the Cx antigen, so some Cx-related MAR-negative individuals are missed.

In addition, the Cw discrimination assay is a useful instrument for the confirmation of a patient’s Cw phenotype and to confirm the serological result for very rare anti-MAR-like antibodies in their serum. From this point of view, DNA typing can be a valuable addition to serological testing, contributing to improved safety of blood transfusions.

Conclusions

Cw discrimination allows us to test alleles with a high degree of accuracy in a manner that is both simple and fast. Of the 169 donors typed as Cw+ we discriminated six Cw homozygotes. This is the first work on pre-typing donors compatible with patients with anti-MAR-like antibodies by genetic screening prior to serological investigations.

Supplementary Content

BLT-14-573_suppl_cont.pdf (632.2KB, pdf)

Acknowledgements

We thank Małgorzata Malaga, Małgorzata Kowalewska, Benona Nowak, Ewa Buś-Poniatowska, Elżbieta Klausa and their staff from the Regional Blood Transfusion Centres in Kielce, Gdańsk, Bydgoszcz, Kalisz, and Wrocław for providing blood samples for Cw molecular screening.

Footnotes

Authorship contributions

AO designed the allelic discrimination, performed the study, analysed the data and wrote the manuscript. KG performed the study and supervised data discussion. BM provided serological data. EB revised the manuscript.

The Authors declare no conflicts of interest.

References

  • 1.Reid ME. Rh blood group system. In: Reid ME, Lomas-Francis C, Olsson M, editors. The Blood Group Antigen. 3rd ed. London: Elsevier Ltd; 2012. [Google Scholar]
  • 2.Lejon Crottet S, Henny C, Tinguely C, et al. Serological screening and molecular characterization of the Cw antigen (Rh8) in Swiss blood donors [abstract] Vox Sang. 2014;107(Suppl 1):172. [Google Scholar]
  • 3.Sistonen P, Sareneva H, Pirkola A, Eklund J. MAR, a novel high-incidence Rh antigen revealing the existence of an allelic sub-system including Cw (Rh8) and Cx (Rh9) with exceptional distribution in the Finnish population. Vox Sang. 1994;66:287–92. doi: 10.1111/j.1423-0410.1994.tb00331.x. [DOI] [PubMed] [Google Scholar]
  • 4.Mouro I, Colin Y, Sistonen P, et al. Molecular basis of the RhCw (Rh8) and RhCx (Rh9) blood group specificities. Blood. 1995;86:1196–201. [PubMed] [Google Scholar]
  • 5.O’Shea K, Oyen R, Sausais L, et al. A MAR-like antibody in a DCwe/DCwe person. Transfusion. 2001;41:53–5. doi: 10.1046/j.1537-2995.2001.41010053.x. [DOI] [PubMed] [Google Scholar]
  • 6.Poole J. Anti-Rh51-like in rare CwDe/CwDe individual [abstract] Transfus Med. 2001;11(Suppl 1):32. [Google Scholar]
  • 7.Michalewska B, Skowrońska J, Poole J, et al. Anti-Rh51(MAR)-like alloantibody and the frequency of DCwCwee phenotype within donors of DCCwee phenotype in Poland [abstract] Vox Sang. 2010;99(Suppl 1):342. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

BLT-14-573_suppl_cont.pdf (632.2KB, pdf)

Articles from Blood Transfusion are provided here courtesy of SIMTI Servizi

RESOURCES