Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 Jan 1.
Published in final edited form as: J Cell Biochem. 2016 Jun 21;118(1):172–181. doi: 10.1002/jcb.25623

Chondrogenesis of Embryonic Stem Cell-derived Mesenchymal Stem Cells Induced by TGFβ1 and BMP7 Through Increased TGFβ Receptor Expression and Endogenous TGFβ1 Production

Patrick T Lee 1,2, Wan-Ju Li 1,3,*
PMCID: PMC5118051  NIHMSID: NIHMS795640  PMID: 27292615

Abstract

For decades stem cells have proven to be invaluable to the study of tissue development. More recently, mesenchymal stem cells (MSCs) derived from embryonic stem cells (ESCs) (ESC-MSCs) have emerged as a cell source with great potential for the future of biomedical research due to their enhanced proliferative capability compared to adult tissue-derived MSCs and effectiveness of musculoskeletal lineage-specific cell differentiation compared to ESCs. We have previously compared the properties and differentiation potential of ESC-MSCs to bone marrow-derived MSCs. In this study, we evaluated the potential of TGFβ1 and BMP7 to induce chondrogenic differentiation of ESC-MSCs compared to that of TGFβ1 alone and further investigated the cellular phenotype and intracellular signaling in response to these induction conditions. Our results showed that the expression of cartilage-associated markers in ESC-MSCs induced by the TGFβ1 and BMP7 combination was increased compared to induction with TGFβ1 alone. The TGFβ1 and BMP7 combination upregulated the expression of TGFβ receptor and the production of endogenous TGFβs compared to TGFβ1 induction. The growth factor combination also increasingly activated both of the TGF and BMP signaling pathways, and inhibition of the signaling pathways led to reduced chondrogenesis of ESC-MSCs. Our findings suggest that by adding BMP7 to TGFβ1-supplemented induction medium, ESC-MSC chondrogenesis is upregulated through increased production of endogenous TGFβ and activities of TGFβ and BMP signaling.

Keywords: embryonic stem cell, mesenchymal stem cell, chondrogenesis, transforming growth factor-beta, bone morphogenetic protein

Introduction

Mesenchymal stem cells (MSCs) derived from embryonic stem cells (ESCs) represent an emerging cell source for tissue engineering and regenerative medicine and possess great potential toward understanding tissue development and cellular differentiation. MSCs derived from ESCs (ESC-MSCs) have essentially provided researchers with a tool needed to study the process of tissue development from pluripotent stem cells to MSC intermediates to terminally differentiated cells [Boyd et al., 2009; Oldershaw et al., 2010]. Multiple ESC-MSC lines have been established using different derivative methods and in general, ESC-MSCs have been shown to portray the characteristic phenotype of MSCs while maintaining the ability to differentiate into multiple cell lineages. Enhanced proliferative and immunosuppressive capabilities have also been demonstrated within ESC-MSCs compared to bone marrow MSCs (BM-MSCs) and other adult tissue-derived MSCs [Brown et al., 2009; de Peppo et al., 2010; Trivedi and Hematti, 2008; Vodyanik et al., 2010]. However, previous studies have shown that variation in the ability to differentiate into chondrocytes, osteoblasts, and adipocytes exists between different ESC-MSCs lines and also between ESC-MSCs and BM-MSCs [Karlsson and al, 2009; Marolt et al., 2012; Varga et al., 2011]. Chondrogenic induction of ESC-MSCs, for example, appears to be challenging as the cells produce less cartilage-associated extracellular matrix (ECM) in culture compared to BM-MSCs in response to transforming growth factor-beta (TGFβ) induction [Karlsson and al, 2009; Marolt et al., 2012; Varga et al., 2011]. This presents a need to develop approaches capable of effectively inducing ESC-MSC chondrogenesis.

TGFβ is a potent induction factor for chondrogenic differentiation of BM-MSCs and other adult tissue-derived MSCs [Johnstone et al., 1998]. Treatment with TGFβ1 or TGFβ3 induces the expression of SOX9 and other cartilage-associated ECM markers in high-density cell pellets. In fact, few growth factors other than TGFβ have been demonstrated to be capable of effectively inducing chondrogenesis in human BM-MSC or other adult tissue-derived MSC [Longobardi et al., 2006; Neumann et al., 2007; Shintani and Hunziker, 2011]. We have previously shown that when induced with TGFβ1 alone for chondrogenesis, ESC-MSCs produces less cartilage-associated ECM markers than BM-MSCs, however, by adding BMP7 to TGFβ1-supplemented chondrogenic medium, ESC-MSCs produce significantly increased amounts of ECM markers [Brown et al., 2014].

Similarly, other studies have shown that adipose-derived MSCs require additional BMP stimulation for chondrogenic differentiation [Afizah et al., 2007; Kim and Im, 2009]. In adult tissue-derived MSCs or other progenitor cells, combinations of TGFβ1 or TGFβ3 and various bone morphogenetic proteins (BMPs), including BMP2, 4, 6, and 7, have been shown to increase the production of collagen type 2 and other cartilage ECM proteins compared to TGFβ alone [Brady et al., 2014; Hennig et al., 2007; Hildner et al., 2010; Kim and Im, 2009; Koay et al., 2007; Xu et al., 2006]. The upregulation of cartilage-associated marker expression by these growth factor combinations is in part through increased activation of intracellular signaling pathways and downstream SOX9 [Montero et al., 2008]. While TGFβs and BMPs can act synergistically to upregulate chondrogenic induction of ESC-MSCs, the underlying regulatory mechanism is yet identified.

During cartilage development, multiple growth factors regulate the expression and endogenous production of TGFs and BMPs to drive differentiation of mesenchymal cells into chondrocytes. Similarly, exogenous administration of growth factors can induce MSCs and other cells to produce growth factors through autocrine regulation to modulate cellular behavior [Li et al., 2014; Li et al., 2013; Li et al., 2011]. Additionally, growth factors induce changes in expression of growth factor receptors, thus altering the cell phenotype as differentiation progresses. Activation of TGFβ and BMP signaling through specific Type 1 and Type 2 serine/threonine kinase receptor complexes to regulate downstream molecules such as SOX9 [Raftery and Sutherland, 1999; Wrana and Attisano, 2000]. It is likely that increased production of endogenous growth factors and upregulation of specific growth factor receptors may synergistically increase chondrogenesis of MSCs. Specifically, the combination of TGFβ1 and BMP7 may regulate ESC-MSCs to increase production of TGFβ and TGFβ receptor to enhance chondrogenic differentiation compared to TGFβ1 alone.

The objective of this study was to investigate the effects of TGFβ1 and BMP7 combination on ESC-MSC chondrogenesis and further investigate the underlying regulatory mechanism. We hypothesized that TGFβ1 and BMP7 in combination upregulates the expression of TGFβ receptor and the production of endogenous TGF to increase the activation of TGFβ signaling, which collectively results in enhancement of ESC-MSC chondrogenesis.

Materials and Methods

Stem cell culture

Ethical approval of using human embryonic stem cells for this study was granted by the Institutional Biosafety Committee at the University of Wisconsin-Madison. Two ESC-MSC lines, H1-MSC and WA1-MSC, derived from H1-ESCs (WiCell, Madison, WI) as described previously were provided by Drs. Slukvin and Hematti and cultured following recommended protocols [Trivedi and Hematti, 2008; Vodyanik et al., 2010]. Briefly, one ESC-MSC line was derived by culturing H1-ESCs on OP9 feeder layer and then in semisolid medium supplemented with fibroblast growth factor-2 (FGF2) and platelet-derived growth factor BB for two weeks. Selected mesodermal colonies were further cultured in serum-free medium with FGF2 to expand ESC-MSCs. These cells are henceforth referred to as H1-MSCs. The other ESC-MSC line was derived from H1-ESCs by maintaining the cells on mouse embryonic fibroblast (MEF) cells and passaging them weekly on Matrigel-coated plates with MEF conditioned medium and FGF2. The culture was continually passaged to generate MSCs with fibroblast-like morphology that are henceforth referred to as WA1-MSCs. H1-MSCs were maintained in serum free, chemically defined medium (SFM) composed of 50% Stemline II Hematopoietic Stem Cell Expansion Medium (Sigma-Aldrich, St. Louis, MO) and 50% Endothelial Serum Free Medium (Life Technologies), supplemented with 10 ng/ml FGF2 (Peprotech, Rocky Hill, NJ), 100 μM monothioglutamate (Sigma-Aldrich), 0.05% Excyte (StemCell Technologies, Vancouver, BC), and 2 mM Glutamax (Life Technologies). WA1-MSCs were maintained in α-MEM (Life Technologies) supplemented with 5% FBS (Atlanta Biologicals), 2 mM Glutamax (Life Technologies), and 10 ng/ml FGF2 (Peprotech). The two culture media were previously optimized for achieving the best result of growth of each ESC-MSC line. Culture medium was changed every three days. Cells were maintained at 37°C in a 5% CO2 and 95% humidified incubator and passaged using StemPro Accutase (Life Technologies) when reaching 70–80% confluence.

Chondrogenic differentiation

ESC-MSCs were collected upon reaching 80% confluence and centrifuged in 96-well round bottom plates at 600 × g for 5 minutes to create high-density cell pellets with 2.5 ×105 cells per pellet. Cell pellets were then induced in serum-free chondrogenic medium composed of high-glucose DMEM (Life Technologies), 1% ITS+ Premix (6.25 μg/ml insulin, 6.25 μg/ml transferrin, 6.25 μg/ml selenious acid, 1.25 mg/ml bovine serum albumin, and 5.35 μg/ml linoleic acid) (BD Biosciences), 1% penicillin/streptomycin antibiotics, 1 mM sodium pyruvate, 50 μg/ml ascorbic acid, 40 μg/ml L-proline, and 0.1 μM dexamethasone. Depending on the study, chondrogenic differentiation was induced with 10 ng/ml TGFβ1 (Peprotech) and with or without 100 ng/ml BMP7 (Peprotech) or BMP7 alone. Cell pellets were maintained at 37°C in a 5% CO2 and 95% humidified incubator and the medium was replaced every 3 days during the culture period.

Inhibition of TGFβ and BMP signaling

Inhibition of TGFβ and/or BMP signaling was performed using the small molecule inhibitors, SB431542 (Torcris Biosciences, Bristol, United Kingdom) and Dorsomorphin (Abcam, Cambridge, United Kingdom), respectively. Inhibitors were added in culture with a final concentration of 5 μM during medium change.

RNA isolation and quantitative PCR

Total RNA was isolated as previously described using the NucleoSpin RNA II kit (Macherey-Nagel). Synthesis of cDNA was carried out using the High Capacity cDNA Reverse Transcriptase kit (Life Technologies) and real-time PCR analysis was performed to determine the expression level of collagen type 2, aggrecan, SOX9, TGFβ1, and TGFβ3 using iQ SYBR Green Supermix (BioRad). The sequences of the primers for these genes are listed in Table 1. The relative expression level of each target mRNA transcript was determined in reference to the expression level of the internal control UBC using the 2−ΔCT formula.

Table 1.

List of primer sequences for quantitative PCR

Gene Accession number Sequences (5′ to 3′)
Aggrecan NM_013227.2 (F) CACGATGCCTTTCACCACGAC
(R) CTATCCGTGACAACTGGGCGT
BMP2 NM_00478.3 (F) CGTCAAGCCAAACACAAACAG
(R) GAAGTCCACGTACAAAGGGTG
BMP4 NM_004348.3 (F) TAGGAGCCATTCCGTAGTGCC
(R) ACAGTCCATGATTCTTGACAGC
BMP6 NM_000088.3 (F) GTCTTACAGGAGCATCAGCAC
(R) GGAGTCACAACCCACAGATTG
BMP7 NM_001844.4 (F) TCCTGATGCGTAAACAGAAGC
(R) TCTTGGATTTGGGCAAACCTC
Collagen Type 2 NM_001844.4 (F) GGAAACTTTGCTGCCCAGATG
(R) CGTTAGGACCACTTGGACCACT
SOX9 NM_000346.3 (F) TAAAGGCAACTCGTACCCAA
(R) GCACCTCCTACTACCTCTTA
TGFβ1 NM_013227.2 (F) CTATTGCTTCAGCTCCACGG
(R) TCCAGGCTCCAAATGTAGGG
TGFβ3 NM_000346.3 (F) TGACTTCCGACAGGATCTGG
(R) AGCCCTTAGGTTCATGGACC
UBC NM_021009.4 (F) TGAAGACACTCACTGGCAAGACCA
(R) AACTAGAAACGGCCTTTCGTCGAC
Open in a new tab

Forward and reverse primers are indicated as “F” and “R”, respectively.

Flow cytometry analysis

After 1, 3, or 7 days of chondrogenic induction with TGFβ1 or the combination of TGFβ1 and BMP7, pellets were collected and washed with ice-cold PBS and fixed with 2% formaldehyde (Polysciences, Warrington, PA). Pellets were then dissociated using collagenase A and mechanical disruption (Roche Mannheim, Germany). Cells were passed through a 40-μm nylon strainer (BD Biosciences), washed with a buffer solution, and incubated with antibodies detecting TGFβR2, BMPR1B and BMPR2. The data is presented graphically as the fluorescence signal to noise ratio against the geometric mean of the isotype control.

Protein isolation and western blot analysis

Protein was isolated from chondrogenic pellets using radioimmunoprecipitation (RIPA) solubilization buffer (50 mM Tris-HCl, pH 7.5, 1% NP-40, 0.25% sodium-deoxycholate, 150 mM NaCl, 1 mM EDTA) and complete protease inhibitor cocktail (Roche, Madison, WI). Pellets were physically dissociated with a pestle, vortexed for 1 minute, and sonicated for 5 minutes using a water bath sonicator. After centrifugation at 14,000 rpm for 10 minutes at 4°C, supernatant was collected and protein concentrations were determined using the BCA Protein Assay kit (Pierce, Rockford, IL). Protein samples were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to polyvinylidene difluoride (PVDF) members for blotting. Membranes were incubated overnight at 4°C with primary antibodies in 5% BSA solution. The primary antibodies were used to detect pSMAD3 (Ser423/425), SMAD3, pSMAD1/5, SMAD1, and TGFβ. GAPDH was used as a loading control. All antibodies were purchased from Cell Signaling (Danvers, MA). A goat-anti-rabbit HRP-conjugated antibody was used as the secondary antibody. Signals were developed using Clarity™ Western ECL Substrate (BioRad) and imaged using Kodak Image Station 4000R Pro.

Histology and immunofluorescence analysis

Chondrogenic cell pellets were collected at day 21, fixed with 10% formalin, embedded in paraffin, and sectioned into 7 μm-thick slices. Slides were prepared following our laboratory standard protocol prior to staining with Gill’s Hematoxylin #3 and 0.5% Eosin Y or Alcian blue 8GX (Polysciences). Immunohistochemical analysis was performed by blocking rehydrated samples with 1% BSA in PBS and then incubating the samples with mouse anti-human collagen type 2 primary antibody (Millipore) diluted in PBS at 1:200 for 1 hour. Samples were then washed with PBS and incubated with FITC-conjugated secondary antibody (eBioscience) diluted 1:100 in PBS for 1 hour. Coverslips were affixed to slides using Prolong Antifade Reagent with DAPI (Life Technologies) prior to imaging.

Enzyme-linked immunosorbent assay (ELISA) for TGFβ1

H1-MSC pellets were induced for chondrogenic differentiation with TGFβ1 alone or the combination of TGFβ1 and BMP7. At each medium change, 200 μl of culture medium was collected and immediately frozen at 20°C for analysis at a later time. TGFβ1 concentrations in the collected culture medium were measured using ELISA (R&D Systems) following the manufacturer’s protocol.

Statistical analysis

All values of quantitative results are expressed as mean ± standard deviations. Statistical significance was determined by performing Two-factor ANOVA to test for significant differences between means of the experimental groups, followed by pairwise t-test as prescribed by the Fisher’s Least Significant Difference (LSD) test to determine statistical significance between any paired groups. A P-value < 0.05 was considered significant.

Results

TGFβ1 and BMP7 combination enhances H1-MSC and WA1-MSC chondrogenesis

To demonstrate the effect of the TGFβ1 and BMP7 combination on chondrogenic differentiation of ESC-MSCs, we induced chondrogenesis in H1-MSCs and WA1-MSCs using TGFβ1 with or without BMP7 and analyzed the mRNA expression of cartilage-related markers. H1-MSCs or WA1-MSCs induced with the TGFβ1 and BMP7 combination expressed significantly higher levels of collagen type 2, aggrecan, and SOX9 than those induced with TGFβ1 alone; H1-MSCs expressed greater levels of these mRNA transcripts than WA1-MSCs (Fig. 1A). Histological analysis showed that cell pellets induced with the TGFβ1 and BMP7 combination produced greater amounts of ECM compared to pellets induced with TGFβ1 alone (Fig. 1B). H&E and Alcian blue staining showed denser collections of ECM within the pellets induced by the TGFβ1 and BMP7 combination. Similarly, compared to TGFβ1 induction, the TGFβ1 and BMP7 combination resulted in increased collagen type 2 production throughout both H1-MSC and WA1-MSC pellets as shown by immunofluorescence staining (Fig. 1B).

Figure 1.

Figure 1

Open in a new tab

Analysis of cartilage-related markers during chondrogenic differentiation of ESC-MSCs. (A) The mRNA expression of cartilage-related markers in two ESC-MSC lines induced by TGFβ1 (T) with or without BMP7 (B) was analyzed by quantitative PCR. *p < 0.05; n = 3. (B) Histological sections of ESC-MSC pellets induced with T or TB for chondrogenesis were analyzed by Alcian blue (top row), H&E staining (middle row), and immunofluorescence staining of collagen type 2 (bottom row). Scale bar = 200 μm.

BMP7 induces much less expression of cartilage-associated ECM markers than TGFβ1

After demonstrating that the addition of BMP7 to standard TGFβ1-supplemneted chondrogenic medium enhanced chondrogenesis of ESC-MSCs, we sought to determine if BMP7 alone was able to induce chondrogenesis of the cell by analyzing the mRNA expression of cartilage-associated ECM markers, collagen type 2 and aggrecan (Fig. 2). While comparable mRNA levels of collagen type 2 were found between TGFβ1- and BMP7-induced chondrogenesis, BMP7 induced significantly lower mRNA levels of aggrecan than TGFβ1, suggesting that compared to TGFβ1, BMP7 is an ineffective inducer for chondrogenesis.

Figure 2.

Figure 2

Open in a new tab

Chondrogenic induction of H1-MSCs with BMP7 or TGFβ1. H1-MSCs induced by either BMP7 or TGFβ1 for 21 days were analyzed for the mRNA expression of cartilage-associated ECM markers. *p < 0.05; n = 3

TGFβ1 and BMP7 in combination upregulates expression of TGFβR2 and production of endogenous TGFβ

We analyzed the expression of TGFβR2, BMPR1B, and BMPR2 during chondrogenesis induced by TGFβ1 with or without BMP7 using flow cytometry (Fig. 3A). During the 7-day induction, the fluorescence intensity of TGFβR2 on H1-MSCs treated with TGFβ1 and BMP7 was greater than that on the cell treated with only TGFβ1. While the expression of BMPR1B induced by either treatment showed a dramatic decrease from day 1 to day 3 before increased again at day 7, the fluorescence intensity was greater in TGFβ1-treaetd cells than that in TGFβ1 and BMP7-treated cells. On the other hand, the expression of BMPR2 was decreased with culture time and showed no difference between TGFβ1- and TGFβ1 and BMP7-treated cells.

Figure 3.

Figure 3

Open in a new tab

Expression of growth factor receptors and production of endogenous growth factors. (A) Chondrogenic pellets of H1-MSCs induced with T or TB for a week were analyzed by flow cytometry to detect the expression of TGFβR2, BMPR1B, and BMPR2. Values are represented as the fluorescence signal to noise ratio against the geometric mean of the isotype control. (B) The mRNA transcripts of BMPs 2,4,6 and 7, and TGFβ1 and β3 in H1-MSC pellets induced with T or TB for chondrogenesis were analyzed by quantitative PCR. (C) Protein extracts from H1-MSC pellets induced with T or TB for chondrogenesis were analyzed by Western blotting to detect the expression of TGFβ. (D) Soluble TGFβ1 released into culture medium during ESC-MSC chondrogenesis was determined by ELISA.

After determining that TGFβ1 and BMP7 upregulated chondrogenic differentiation of ESC-MSCs and increased the expression of TGFβR2, we next investigated the mRNA expression of TGFβs and BMPs that might be produced endogenously in cells during chondrogenic induction (Fig. 3B). Quantitative PCR analysis revealed no significant difference in the expression of BMP2, BMP4, BMP6 or BMP7 between H1-MSCs induced with TGFβ1 and the TGFβ1 and BMP7 combination. However, the cells induced by the combination of growth factors upregulated expression of TGFβ1 and TGFβ3 with a significant increase in their expression levels at hour 48 compared to those induced by TGFβ1 alone. Specifically, in the TGFβ1-induced cells, the expression of TGFβ1 began to decrease between hours 24 and 48 while TGFβ1 and BMP7 induction resulted in a consistent increase in the expression of TGFβ1 from hour 6 to hour 48 with significant expression differences between the TGFβ1 alone and the TGFβ1 and BMP7 combination groups at hours 12 and 48. The expression of TGFβ3 increased steadily between hours 6 and 48 in cells induced by both conditions, but induction with the TGFβ1 and BMP7 combination resulted in significantly greater expression of TGFβ3 than that with TGFβ1 alone at hour 48.

Similarly, the expression of endogenous TGFβ in both cultures analyzed by western blotting was increased with induction time, and the addition of BMP7 to TGFβ1-supplemented chondrogenic medium induced more endogenous TGFβ production than TGFβ alone (Fig. 3C). Western blots detected by a pan-specific antibody showed two bands of TGFβ isoforms with the molecular weight around 60 kDa. The production of endogenous TGFβ by ESC-MSCs induced with TGFβ alone or with the TGFβ1 and BMP7 combination increased with time during the 48 hours and similar to the results of mRNA expression, induction with the TGFβ1 and BMP7 combination resulted in the upregulated production of endogenous TGFβ compared to induction by TGFβ1.

We further used ELISA to determine the concentration of soluble TGFβ1 and TGFβ3 released into the media after growth factor induction. Culture medium was collected before each cell feeding for 9 days, and again at the end of the culture period (Fig. 3D). The results showed that the TGFβ1 content in medium was increased with induction time in response to both treatments while more TGFβ1 was detected in the culture induced with TGFβ1 and BMP7 than that in the culture with TGFβ1 alone. Interestingly, the concentration of TGFβ3 in medium was undetectable in either of the cultures (data not shown).

TGFβ1 and BMP7 combination increases activation of SMADs during H1-MSC chondrogenesis

We analyzed SMAD signaling activated by TGFβ1 or the TGFβ1 and BMP7 combination to determine whether the growth factor treatments induce differential activation of the intracellular signaling in an ESC-MSC line. After growth factor induction, the TGFβ1 and BMP7 combination increased phosphorylation of SMAD3 at both hours 2 and 6 compared to TGFβ1 alone (Fig. 4A). Similarly, TGFβ1 alone was able to induce activation of SMAD1/5 but the level of phosphorylation was less than that in hMSCs induced by the TGFβ1 and BMP7 combination.

Figure 4.

Figure 4

Open in a new tab

Activation of SMADs during chondrogenesis of H1-MSC pellets. (A) H1-MSC pellets induced with T or TB for chondrogenesis were analyzed by western blotting to detect the expression of pSMAD3 and pSMAD1/5. GAPDH was used as a loading control. (B) H1-MSC pellets were treated with conditioned medium collected from separate 3-day chondrogenic culture of H1-MSCs for 6 hours prior to protein isolation and analysis of pSMAD3 and pSMAD1/5.

As our results showed that TGFβ1 and BMP7 in combination induced the production of endogenous TGFβ1 in culture medium, we were then interested in determining if SMAD signaling could be activated using the conditioned chondrogenic medium. The conditioned medium was collected from chondrogenic culture of H1-MSCs induced with TGFβ1 or the TGFβ1 and BMP7 combination for 3 days. H1-MSC pellets were then treated with the conditioned medium for 6 hours and analyzed for SMAD signaling molecules. While the conditioned medium of TGFβ1-induced culture weakly activated SMAD3 and SMAD1/5, the medium from the TGFβ1 and BMP7-induced culture more robustly activated both of the SMAD signaling molecules (Fig. 4B).

Attenuating TGFβ or BMP signaling inhibits H1-MSC chondrogenesis

With our earlier results showing that the TGFβ1 and BMP7 combination enhanced chondrogenesis of ESC-MSCs compared to TGFβ1 alone, we then sought to determine the effect of blocking TGFβ and/or BMP receptors on chondrogenic differentiation of H1-MSCs. We used small molecule inhibitors SB431542 (SB) to block ALK4 (Activin receptor 1B), ALK5 (TGFβ receptor 1) and ALK7 (Activin receptor 1C) to attenuate TGFβ1-induced signaling and dorsomorphin (DM) to block ALK2 (Activin receptor 1), ALK3 (BMP receptor 1A) and ALK6 (BMP receptor 1B) to attenuate BMP7-induced signaling during chondrogenic induction. Quantitative PCR analysis showed that at both days 10 and 20 the TGFβ1 and BMP7 combination induced the expression of collagen type 2, aggrecan, and SOX9, as expected (Fig. 5A). With the addition of SB, DM or both, the induced expression of mRNA transcripts of these markers was significantly reduced. Particularly, the expression of collagen type 2 and aggrecan was reduced to near undetectable levels.

Figure 5.

Figure 5

Open in a new tab

Analysis of cartilage-related markers during chondrogenic differentiation of ESC-MSCs attenuated by TGFβ and BMP signaling inhibitors. (A) H1-MSC pellets induced with TB are treated with dorsomorphin (DM), SB431542 (SB) or both before the analysis of expression of the cartilage-related markers. *p < 0.05; n = 3 (B) Histological sections of H1-MSC pellets induced with TB and treated with DM and/or SB were analyzed by Alcian blue (top row), H&E staining (middle row), and immunofluorescence staining of collagen type 2 (bottom row). Scale bar = 200 μm.

Furthermore, the histological results of H1-MSC pellets corroborated the quantitative PCR results. In the TGFβ1 and BMP7-treated pellets, Alcian blue and H&E staining showed a dense cellular structure rich in glycosaminoglycan and immunofluorescent staining revealed a large deposition of collagen type 2 (Fig. 5B). When treated with the inhibitors DM and/or SB, chondrogenic cell pellets showed a less dense cellular structure with a decrease in the glycosaminoglycan content compared to the control pellets without inhibitor treatment. Additionally, in terms of the evaluation of pellet size, DM-treated pellets were similar in size to TGFβ1 and BMP7-treated pellets while SB-treated pellets were clearly the smallest among all pellets cultured in different conditions. The production of collagen type 2 was also reduced in inhibitor-treated pellets compared to that in the pellets induced by the TGFβ1 and BMP7 combination.

Discussion

Although the roles of TGFβs and BMPs in regulation of chondrogenesis of MSCs derived from adult tissues have been studied for years, the mechanism of how these growth factors induce chondrogenesis of ESC-MSCs still remains elusive. In this study we demonstrate that adding BMP7 to the gold standard TGFβ1-supplemented chondrogenic medium can greatly upregulate chondrogenic induction of ESC-MSCs compared to TGFβ1 alone, which is considered a gold-standard induction molecule for chondrogenesis. In addition, we further show that the upregulation of chondrogenesis by TGFβ1 and BMP7 is correlated to increased TGFβR2 expression and the production of endogenous TGFβ. Concomitantly, TGFβ1 and BMP7 in combination induce greater activation of both TGFβ- and BMP-related SMAD signaling compared to TGFβ1. Inhibition of the signaling pathways using small molecule inhibitors reduces the ability of the TGFβ1 and BMP7 combination to induce ESC-MSC chondrogenesis. Together, our data provide insight into how the TGFβ1 and BMP7 combination upregulates chondrogenesis of ESC-MSCs.

We investigate the effect of BMP7 in TGFβ1-supplemented culture on chondrogenesis because BMP7 has been shown to promote adipogenesis, osteogenesis, and chondrogenesis in several previous studies including ours [Brown et al., 2014; Knippenberg et al., 2006; Neumann et al., 2007; Shen et al., 2010]. In chondrocytes of developing cartilage, BMP7 along with BMP2, 3, 4, and 5 are expressed in the perichondrium but only BMP7 is expressed in proliferating chondrocytes and mature cartilage [Hidaka and Goldring, 2008]. This may suggest that BMP7 may be a potent growth factor capable of inducing chondrogenesis compared to other BMPs that are found mostly in hypertrophic chondrocytes. BMP7 can additionally function as a potent anabolic stimulus for adult chondrocytes in vivo and exert an anti-apoptotic effect to promote cell survival [Gokce et al., 2012; Hidaka and Goldring, 2008; Wei et al., 2008]. Our results show that TGFβ1 and BMP7 in combination increasingly induce ESC-MSC chondrogenesis.

Our results show that BMP7 generates synergistic effects in TGFβ1-supplemneted culture on the upregulation of ESC-MSC chondrogenesis but BMP7 alone in culture is limited in driving ESC-MSCs to differentiate into chondrocytes. Shen et al. have demonstrated a similar finding in their study in which BMP7 is unable to effectively induce chondrogenesis of BM-MSCs with reduced mRNA expression of collagen type 2 comparable to TGFβ3 [Shen et al., 2010]. Together, the results of both studies suggest that it is not preferable to use BMP7 alone in culture to induce chondrogenesis of MSCs and BMP7 should be used along with TGFβs to upregulate chondrogenic differentiation of the cell.

Previous studies using ESCs, MSCs, tissue-specific stem cells, and chondro-progenitor cells have demonstrated the synergistic effects of TGFβs and BMPs on chondrogenesis [Gong et al., 2010; Hildner et al., 2010; Nakagawa et al., 2009; Rui et al., 2010; Xu et al., 2006]. However, the chondrogenic effects of different TGFβ and BMP combinations in these studies are dependent on the growth factor isoform and concentration [Mehlhorn et al., 2007; Shintani and Hunziker, 2011]. For example, Shen et al. have demonstrated that compared to TGFβ3 alone, chondrogenic induction by BMP7 and TGFβ3 upregulates the expression of collagen types 2 and 9 and aggrecan but downregulate the expression of collagen type 1 and biglycan suggesting a critical role of BMP7 in regulating hyaline- and fibro-chondrogenesis [Shen et al., 2010]. On the other hand, it has also been shown that TGFβs and BMPs can exert opposing effects on each other depending on cell type. For example, induction by both TGFβ and BMP does not yield a synergetic effect on chondrogenesis of ESCs in embryoid bodies [Toh et al., 2009]. Furthermore, Keller et al. have demonstrated that when TGFβ1 and BMP2 in combination are used to induce chondrogenesis in the rat ATCD5 cell line, TGFβ1 was able to enhance BMP signaling while BMP2 significantly reduced levels of TGFβ signaling [Keller et al., 2011]. These examples demonstrate that the effect of TGFβs and BMPs on chondrogenesis may also depend on target cell types.

Induction by TGFβ1 and BMP7 increases the expression of TGFβR2 in H1-MSCs during early chondrogenesis. TGFβR2 recruits and phosphorylates TGFβR1 after binding TGFβ1 to initiate its downstream signaling pathway [Ehrlich et al., 2012]. Studies have shown that depletion of TGFβR2 or abolishing its function interferes with TGFβ-induced chondrogenesis and the development of cartilage, demonstrating the importance of this receptor [Hiramatsu et al., 2011; Li et al., 2014]. Similar findings reported by Hennig et al. have shown that alteration of the expression of TGFβR1 in adipose-derived MSCs results in reduced chondrogenesis [Hennig et al., 2007]. When the cells are induced with BMP6 and TGFβ3, the expression of TGFβR1 is increased. On the other hand, studies have also reported that TGFβ can upregulate BMP receptors further suggesting additional layers of regulation [Montero et al., 2008; Xu et al., 2006].

In addition to upregulated expression of the TGFβ receptor, we demonstrated that the induction by TGFβ1 and BMP7 increased the production of endogenous TGFβ compared to induction by TGFβ1 alone during chondrogenesis. Interestingly, the level of soluble TGFβ1 or TGFβ3 in culture measured by ELISA was either comparable between experimental groups or undetectable. Considering that our results did show a noticeable increase in the expression of both TGFβ1 transcript and protein in H1-MSCs induced by the TGFβ1 and BMP7 combination, it is possible that ELISA is limited to detecting a fraction of total TGFβs released from cells since some of the released TGFβs may have already bound to cells and some of them may have been sequestered by the ECM. In any way, our results suggest that the TGFβ1 and BMP7 combination upregulates production of endogenous TGFβ in H1-MSCs. The production of endogenous TGFβs or BMPs during cartilage development in vitro in response to growth factors has been investigated by several groups and is suggested to improve differentiation into mesenchymal lineages [Choi et al., 2012; Leonard et al., 1991; Mizuta et al., 2002; Seib et al., 2009]. For example, TGFβs are known to regulate the production of endogenous TGFβs [Mizuta et al., 2002] and transient administration of TGFβ can induce the production of endogenous TGFβs during the differentiation process [Kulyk et al., 1989]. Likewise, transient induction of TGFβ3 between 30 minutes and 6 hours is also sufficient to continuously induce cellular condensation and matrix production in chick limb mesenchymal cells for a few days following induction through the activity of endogenous TGFβ [Leonard et al., 1991]. Taken together these studies demonstrate the importance of endogenous growth factors to the differentiation process as seen in this study.

In addition to differences in the expression of growth factor receptors, we also observe differential activation of downstream SMAD signaling after growth factor stimulation. TGFβ1 and BMP7 in combination induce greater activation of both SMAD3 and SMAD1/5 compared to TGFβ1 alone. Additionally, we also demonstrate that H1-MSC pellets treated with the TGFβ1 and BMP7-conditioned medium resulted in increased activation of SMAD signaling compared to those treated with the TGFβ1-conditioned medium. Together, these results suggest that the TGFβ1 and BMP7 combination may induce ESC-MSCs to release endogenously produced growth factors into the medium that continuously activate SMAD signaling during chondrogenesis. Notably, our results show that when TGFβ1 and BMP7 are administered together, both the SMAD3-mediated and SMAD1/5-mediciated signaling pathways are activated whereas TGFβ1 alone only activated SMAD3. It has been reported that SMAD activation by TGFβ leads to an increased SOX9 level which in turn upregulates the production of collagen type 2 and cartilage extracellular matrix proteins in MSCs or in the limb during chondrogenesis [Song et al., 2009; Zehentner et al., 1999]. We have confirmed that in this study the TGFβ1 and BMP7 combination increases activation of SMAD signaling and expression of SOX9 to upregulate production of collagen type 2 and aggrecan as enhanced chondrogenesis in ESC-MSCs.

We also show that inhibition of TGFβ and BMP signaling reduces the effect of the TGFβ1 and BMP7 combination on chondrogenesis, suggesting that activation of both of the signaling pathways is critical for ESC-MSC chondrogenesis. Interestingly, the addition of both small molecule inhibitors results in cell pellets with a less dense structure than those treated with or without one of the inhibitors. Our results suggest that TGFβ1 and/or BMP7 may be involved in mediating cell-cell interaction or cell condensation in a pellet for chondrogenesis. The effect of TGFβs and BMPs on cell-cell interaction has been demonstrated in previous studies, in which BMPs and TGFβs increase cellular adhesion through regulation of N-cadherin to enhance chondrogenic differentiation [Haas and Tuan, 1999; Tuli et al., 2003]. In addition, it seems to be more detrimental to the formation of chondrogenic pellets to block TGFβ signaling with SB than to block BMP signaling with DM. Pellets treated with DM retained a structure much similar to those with TGFβ1 and BMP7 than pellets treated with SB. This suggests that TGFβ1 may be a predominant growth factor that induces chondrogenesis of H1-MSCs while BMP7 may act synergistically with TGFβ1 to increase production of cartilaginous matrix proteins.

In conclusion, our results show that BMP7, when combined with TGFβ1, exerts a synergistic effect on the induction of ESC-MSC chondrogenesis through the upregulation of TGFβR2 expression and an increase in the production of endogenous TGFβs. Inhibition of TGFβ1 and/or BMP7 signaling with receptor inhibitors attenuates the synergistic effect of TGFβ1 and BMP7 on promoting ESC-MSC chondrogenesis. Our findings provide further insight into the mechanism of how the combination of TGFβ1 and BMP7 synergistically induces ESC-MSC chondrogenesis.

Acknowledgments

We would like to thank Drs. Igor Slukvin, Xin Zhang, Kran Suknuntha, and Peiman Hematti for providing ESC-MSCs for this study. We would like to thank the National Institute of Arthritis and Musculoskeletal and Skin Diseases for the funding support R01 AR064803.

Footnotes

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record.

References

  1. Afizah H, Yang Z, Hui JH, Ouyang HW, Lee EH. A comparison between the chondrogenic potential of human bone marrow stem cells (BMSCs) and adipose-derived stem cells (ADSCs) taken from the same donors. Tissue Eng. 2007;13:659–66. doi: 10.1089/ten.2006.0118. [DOI] [PubMed] [Google Scholar]
  2. Boyd NL, Robbins KR, Dhara SK, West FD, Stice SL. Human embryonic stem cell-derived mesoderm-like epithelium transitions to mesenchymal progenitor cells. Tissue Eng Part A. 2009;15:1897–907. doi: 10.1089/ten.tea.2008.0351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Brady K, Dickinson SC, Guillot PV, Polak J, Blom AW, Kafienah W, Hollander AP. Human fetal and adult bone marrow-derived mesenchymal stem cells use different signaling pathways for the initiation of chondrogenesis. Stem Cells Dev. 2014;23:541–54. doi: 10.1089/scd.2013.0301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Brown PT, Squire MW, Li WJ. Characterization and evaluation of mesenchymal stem cells derived from human embryonic stem cells and bone marrow. Cell Tissue Res. 2014;358:149–64. doi: 10.1007/s00441-014-1926-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Brown SE, Tong W, Krebsbach PH. The derivation of mesenchymal stem cells from human embryonic stem cells. Cells Tissues Organs. 2009;189:256–60. doi: 10.1159/000151746. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Choi JS, Kim BS, Kim JD, Choi YC, Lee HY, Cho YW. In vitro cartilage tissue engineering using adipose-derived extracellular matrix scaffolds seeded with adipose-derived stem cells. Tissue Eng Part A. 2012;18:80–92. doi: 10.1089/ten.tea.2011.0103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. de Peppo GM, Svensson S, Lenneras M, Synnergren J, Stenberg J, Strehl R, Hyllner J, Thomsen P, Karlsson C. Human embryonic mesodermal progenitors highly resemble human mesenchymal stem cells and display high potential for tissue engineering applications. Tissue Eng Part A. 2010;16:2161–82. doi: 10.1089/ten.TEA.2009.0629. [DOI] [PubMed] [Google Scholar]
  8. Ehrlich M, Gutman O, Knaus P, Henis YI. Oligomeric interactions of TGF-beta and BMP receptors. FEBS Lett. 2012;586:1885–96. doi: 10.1016/j.febslet.2012.01.040. [DOI] [PubMed] [Google Scholar]
  9. Gokce A, Yilmaz I, Bircan R, Tonbul M, Gokay NS, Gokce C. Synergistic Effect of TGF-beta1 And BMP-7 on Chondrogenesis and Extracellular Matrix Synthesis: An In Vitro Study. Open Orthop J. 2012;6:406–13. doi: 10.2174/1874325001206010406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Gong G, Ferrari D, Dealy CN, Kosher RA. Direct and progressive differentiation of human embryonic stem cells into the chondrogenic lineage. J Cell Physiol. 2010;224:664–71. doi: 10.1002/jcp.22166. [DOI] [PubMed] [Google Scholar]
  11. Haas AR, Tuan RS. Chondrogenic differentiation of murine C3H10T1/2 multipotential mesenchymal cells: II. Stimulation by bone morphogenetic protein-2 requires modulation of N-cadherin expression and function. Differentiation. 1999;64:77–89. doi: 10.1046/j.1432-0436.1999.6420077.x. [DOI] [PubMed] [Google Scholar]
  12. Hennig T, Lorenz H, Thiel A, Goetzke K, Dickhut A, Geiger F, Richter W. Reduced chondrogenic potential of adipose tissue derived stromal cells correlates with an altered TGFbeta receptor and BMP profile and is overcome by BMP-6. J Cell Physiol. 2007;211:682–91. doi: 10.1002/jcp.20977. [DOI] [PubMed] [Google Scholar]
  13. Hidaka C, Goldring MB. Regulatory Mechanisms of Chondrogenesis and Implications for Understanding Articular Cartilage Homeostasis. Current Rheumatology Reviews. 2008;5:12. [Google Scholar]
  14. Hildner F, Peterbauer A, Wolbank S, Nurnberger S, Marlovits S, Redl H, van Griensven M, Gabriel C. FGF-2 abolishes the chondrogenic effect of combined BMP-6 and TGF-beta in human adipose derived stem cells. J Biomed Mater Res A. 2010;94:978–87. doi: 10.1002/jbm.a.32761. [DOI] [PubMed] [Google Scholar]
  15. Hiramatsu K, Iwai T, Yoshikawa H, Tsumaki N. Expression of dominant negative TGF-beta receptors inhibits cartilage formation in conditional transgenic mice. J Bone Miner Metab. 2011;29:493–500. doi: 10.1007/s00774-010-0248-2. [DOI] [PubMed] [Google Scholar]
  16. Johnstone B, Hering TM, Caplan AI, Goldberg VM, Yoo JU. In vitro chondrogenesis of bone marrow-derived mesenchymal progenitor cells. Exp Cell Res. 1998;238:265–72. doi: 10.1006/excr.1997.3858. [DOI] [PubMed] [Google Scholar]
  17. Karlsson C, et al. Human embryonic stem cell-derived mesenchymal progenitors-Potential in regenerative medicine. Stem Cell Res. 2009;3:39–50. doi: 10.1016/j.scr.2009.05.002. [DOI] [PubMed] [Google Scholar]
  18. Keller B, Yang T, Chen Y, Munivez E, Bertin T, Zabel B, Lee B. Interaction of TGFbeta and BMP signaling pathways during chondrogenesis. PLoS One. 2011;6:e16421. doi: 10.1371/journal.pone.0016421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kim HJ, Im GI. Combination of transforming growth factor-beta2 and bone morphogenetic protein 7 enhances chondrogenesis from adipose tissue-derived mesenchymal stem cells. Tissue Eng Part A. 2009;15:1543–51. doi: 10.1089/ten.tea.2008.0368. [DOI] [PubMed] [Google Scholar]
  20. Knippenberg M, Helder MN, Zandieh Doulabi B, Wuisman PI, Klein-Nulend J. Osteogenesis versus chondrogenesis by BMP-2 and BMP-7 in adipose stem cells. Biochem Biophys Res Commun. 2006;342:902–8. doi: 10.1016/j.bbrc.2006.02.052. [DOI] [PubMed] [Google Scholar]
  21. Koay EJ, Hoben GM, Athanasiou KA. Tissue engineering with chondrogenically differentiated human embryonic stem cells. Stem Cells. 2007;25:2183–90. doi: 10.1634/stemcells.2007-0105. [DOI] [PubMed] [Google Scholar]
  22. Kulyk WM, Rodgers BJ, Greer K, Kosher RA. Promotion of embryonic chick limb cartilage differentiation by transforming growth factor-beta. Dev Biol. 1989;135:424–30. doi: 10.1016/0012-1606(89)90191-7. [DOI] [PubMed] [Google Scholar]
  23. Leonard CM, Fuld HM, Frenz DA, Downie SA, Massague J, Newman SA. Role of transforming growth factor-beta in chondrogenic pattern formation in the embryonic limb: stimulation of mesenchymal condensation and fibronectin gene expression by exogenenous TGF-beta and evidence for endogenous TGF-beta-like activity. Dev Biol. 1991;145:99–109. doi: 10.1016/0012-1606(91)90216-p. [DOI] [PubMed] [Google Scholar]
  24. Li C, Wang Q, Wang JF. Transforming growth factor-beta (TGF-beta) induces the expression of chondrogenesis-related genes through TGF-beta receptor II (TGFRII)-AKT-mTOR signaling in primary cultured mouse precartilaginous stem cells. Biochem Biophys Res Commun. 2014 doi: 10.1016/j.bbrc.2014.06.030. [DOI] [PubMed] [Google Scholar]
  25. Li X, Su G, Wang J, Zhou Z, Li L, Liu L, Guan M, Zhang Q, Wang H. Exogenous bFGF promotes articular cartilage repair via up-regulation of multiple growth factors. Osteoarthritis Cartilage. 2013;21:1567–75. doi: 10.1016/j.joca.2013.06.006. [DOI] [PubMed] [Google Scholar]
  26. Li Y, Deng L, Qian W, Zhou JN, Xu KS. Effects of exogenous TGF-beta3 on the expression of endogenous TGF-beta3 in hepatic stellate cell-T6 (HSC-T6) Zhonghua Gan Zang Bing Za Zhi. 2011;19:843–7. doi: 10.3760/cma.j.issn.1007-3418.2011.11.012. [DOI] [PubMed] [Google Scholar]
  27. Longobardi L, O’Rear L, Aakula S, Johnstone B, Shimer K, Chytil A, Horton WA, Moses HL, Spagnoli A. Effect of IGF-I in the chondrogenesis of bone marrow mesenchymal stem cells in the presence or absence of TGF-beta signaling. J Bone Miner Res. 2006;21:626–36. doi: 10.1359/jbmr.051213. [DOI] [PubMed] [Google Scholar]
  28. Marolt D, Campos IM, Bhumiratana S, Koren A, Petridis P, Zhang G, Spitalnik PF, Grayson WL, Vunjak-Novakovic G. Engineering bone tissue from human embryonic stem cells. Proc Natl Acad Sci U S A. 2012;109:8705–9. doi: 10.1073/pnas.1201830109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Mehlhorn AT, Niemeyer P, Kaschte K, Muller L, Finkenzeller G, Hartl D, Sudkamp NP, Schmal H. Differential effects of BMP-2 and TGF-beta1 on chondrogenic differentiation of adipose derived stem cells. Cell Prolif. 2007;40:809–23. doi: 10.1111/j.1365-2184.2007.00473.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Mizuta H, Sanyal A, Fukumoto T, Fitzsimmons JS, Matsui N, Bolander ME, Oursler MJ, O’Driscoll SW. The spatiotemporal expression of TGF-beta1 and its receptors during periosteal chondrogenesis in vitro. J Orthop Res. 2002;20:562–74. doi: 10.1016/S0736-0266(01)00130-9. [DOI] [PubMed] [Google Scholar]
  31. Montero JA, Lorda-Diez CI, Ganan Y, Macias D, Hurle JM. Activin/TGFbeta and BMP crosstalk determines digit chondrogenesis. Dev Biol. 2008;321:343–56. doi: 10.1016/j.ydbio.2008.06.022. [DOI] [PubMed] [Google Scholar]
  32. Nakagawa T, Lee SY, Reddi AH. Induction of chondrogenesis from human embryonic stem cells without embryoid body formation by bone morphogenetic protein 7 and transforming growth factor beta1. Arthritis Rheum. 2009;60:3686–92. doi: 10.1002/art.27229. [DOI] [PubMed] [Google Scholar]
  33. Neumann K, Endres M, Ringe J, Flath B, Manz R, Haupl T, Sittinger M, Kaps C. BMP7 promotes adipogenic but not osteo-/chondrogenic differentiation of adult human bone marrow-derived stem cells in high-density micro-mass culture. J Cell Biochem. 2007;102:626–37. doi: 10.1002/jcb.21319. [DOI] [PubMed] [Google Scholar]
  34. Oldershaw RA, Baxter MA, Lowe ET, Bates N, Grady LM, Soncin F, Brison DR, Hardingham TE, Kimber SJ. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat Biotechnol. 2010;28:1187–94. doi: 10.1038/nbt.1683. [DOI] [PubMed] [Google Scholar]
  35. Raftery LA, Sutherland DJ. TGF-beta family signal transduction in Drosophila development: from Mad to Smads. Dev Biol. 1999;210:251–68. doi: 10.1006/dbio.1999.9282. [DOI] [PubMed] [Google Scholar]
  36. Rui YF, Du L, Wang Y, Lui PP, Tang TT, Chan KM, Dai KR. Bone morphogenetic protein 2 promotes transforming growth factor beta3-induced chondrogenesis of human osteoarthritic synovium-derived stem cells. Chin Med J (Engl) 2010;123:3040–8. [PubMed] [Google Scholar]
  37. Seib FP, Franke M, Jing D, Werner C, Bornhauser M. Endogenous bone morphogenetic proteins in human bone marrow-derived multipotent mesenchymal stromal cells. Eur J Cell Biol. 2009;88:257–71. doi: 10.1016/j.ejcb.2009.01.003. [DOI] [PubMed] [Google Scholar]
  38. Shen B, Wei A, Whittaker S, Williams LA, Tao H, Ma DD, Diwan AD. The role of BMP-7 in chondrogenic and osteogenic differentiation of human bone marrow multipotent mesenchymal stromal cells in vitro. J Cell Biochem. 2010;109:406–16. doi: 10.1002/jcb.22412. [DOI] [PubMed] [Google Scholar]
  39. Shintani N, Hunziker EB. Differential effects of dexamethasone on the chondrogenesis of mesenchymal stromal cells: influence of microenvironment, tissue origin and growth factor. Eur Cell Mater. 2011;22:302–19. doi: 10.22203/ecm.v022a23. discussion 319–20. [DOI] [PubMed] [Google Scholar]
  40. Song B, Estrada KD, Lyons KM. Smad signaling in skeletal development and regeneration. Cytokine Growth Factor Rev. 2009;20:379–88. doi: 10.1016/j.cytogfr.2009.10.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Toh WS, Guo XM, Choo AB, Lu K, Lee EH, Cao T. Differentiation and enrichment of expandable chondrogenic cells from human embryonic stem cells in vitro. J Cell Mol Med. 2009;13:3570–90. doi: 10.1111/j.1582-4934.2009.00762.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Trivedi P, Hematti P. Derivation and immunological characterization of mesenchymal stromal cells from human embryonic stem cells. Exp Hematol. 2008;36:350–9. doi: 10.1016/j.exphem.2007.10.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Tuli R, Tuli S, Nandi S, Huang X, Manner PA, Hozack WJ, Danielson KG, Hall DJ, Tuan RS. Transforming growth factor-beta-mediated chondrogenesis of human mesenchymal progenitor cells involves N-cadherin and mitogen-activated protein kinase and Wnt signaling cross-talk. J Biol Chem. 2003;278:41227–36. doi: 10.1074/jbc.M305312200. [DOI] [PubMed] [Google Scholar]
  44. Varga N, Vereb Z, Rajnavolgyi E, Nemet K, Uher F, Sarkadi B, Apati A. Mesenchymal stem cell like (MSCl) cells generated from human embryonic stem cells support pluripotent cell growth. Biochem Biophys Res Commun. 2011;414:474–80. doi: 10.1016/j.bbrc.2011.09.089. [DOI] [PubMed] [Google Scholar]
  45. Vodyanik MA, Yu J, Zhang X, Tian S, Stewart R, Thomson JA, Slukvin II. A mesoderm-derived precursor for mesenchymal stem and endothelial cells. Cell Stem Cell. 2010;7:718–29. doi: 10.1016/j.stem.2010.11.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Wei A, Brisby H, Chung SA, Diwan AD. Bone morphogenetic protein-7 protects human intervertebral disc cells in vitro from apoptosis. Spine J. 2008;8:466–74. doi: 10.1016/j.spinee.2007.04.021. [DOI] [PubMed] [Google Scholar]
  47. Wrana JL, Attisano L. The Smad pathway. Cytokine Growth Factor Rev. 2000;11:5–13. doi: 10.1016/s1359-6101(99)00024-6. [DOI] [PubMed] [Google Scholar]
  48. Xu D, Gechtman Z, Hughes A, Collins A, Dodds R, Cui X, Jolliffe L, Higgins L, Murphy A, Farrell F. Potential involvement of BMP receptor type IB activation in a synergistic effect of chondrogenic promotion between rhTGFbeta3 and rhGDF5 or rhBMP7 in human mesenchymal stem cells. Growth Factors. 2006;24:268–78. doi: 10.1080/08977190601075865. [DOI] [PubMed] [Google Scholar]
  49. Zehentner BK, Dony C, Burtscher H. The transcription factor Sox9 is involved in BMP-2 signaling. J Bone Miner Res. 1999;14:1734–41. doi: 10.1359/jbmr.1999.14.10.1734. [DOI] [PubMed] [Google Scholar]

RESOURCES