Abstract
A total of 2,201 nonduplicate enterococcal isolates collected from 29 hospitals in 23 cities in China between 2004 and 2014 were screened for the oxazolidinone resistance gene optrA; 45 isolates (2.0%) were optrA positive with 11 OptrA variants identified. The positive rate of optrA increased from 0.4% to 3.9% during the 10-year surveillance period. Pulsed-field gel electrophoresis (PFGE) and multilocus sequence type (MLST) analysis revealed that 37 optrA-positive Enterococcus faecalis isolates clustered into 25 PFGE patterns and 21 sequence types, while 6 Enterococcus faecium isolates represented 6 PFGE patterns and 6 sequence types. The present study underscores the importance of routine and persistent monitoring of oxazolidinone resistance and optrA gene.
TEXT
Linezolid is an important oxazolidinone antibiotic, approved for clinical use since 2000, that has shown great potency against most Gram-positive organisms, especially vancomycin-resistant enterococci (VRE) and methicillin-resistant Staphylococcus aureus (MRSA) (1). According to the Zyvox Annual Appraisal of Potency and Spectrum (ZAAPS) and Linezolid Experience and Accurate Determination of Resistance (LEADER) program for 2014, linezolid demonstrated excellent activity against Gram-positive pathogens in vitro with overall susceptibility rates of 99.88% and 99.78%, respectively (2, 3). However, increasing numbers of linezolid-resistant isolates have been detected worldwide. Mutations in domain V of the 23S rRNA are the main resistance mechanisms, and G2576T is the most frequently seen alteration (4). Furthermore, linezolid resistance has also been associated with mutations in ribosomal proteins L3 and L4 (4). Besides these mutations, the cfr gene, the first reported transferable oxazolidinone resistance gene, encodes a methyltransferase that modifies the 23S rRNA at position A2503 that mediates the resistance not only to linezolid but also to phenicols, lincosamides, pleuromutilins, and streptogramin A. Moreover, a cfr variant gene, designated cfr(B) (5, 6), and the second transferable oxazolidinone resistance gene optrA have been identified (7).
The optrA gene (oxazolidinone phenicol transferable resistance) encodes an ATP-binding cassette transporter, resulting in resistance or elevated MICs for oxazolidinones (linezolid and tedizolid) and phenicols (chloramphenicol and florfenicol), and the plasmid-borne optrA can be transferred among Enterococcus spp. (7). optrA was initially identified in Enterococcus faecalis isolate E349 recovered from a Chinese patient and to date has been mainly detected in Enterococcus spp. and very recently in one cfr-positive Staphylococcus sciuri isolate from a pig in China (8, 9). Although the optrA gene was originally detected in human isolates, it was also identified in food-producing animals and is more frequently seen in Enterococcus spp. from food-producing animals than from humans (15.9% and 2% to 2.9%, respectively) and in E. faecalis than in Enterococcus faecium (7, 9). However, the previous surveillance data on optrA from hospitals of China were territorial; thus, to understand the comprehensive epidemiology of optrA, we screened enterococci isolated from hospitalized patients across China during 10 years.
In total, 2,201 enterococcal isolates, including 987 E. faecalis isolates, 1,115 E. faecium isolates, and 99 other Enterococcus species isolates, were collected from 29 hospitals in 23 different cities from 21 provinces and municipalities between 2004 and 2014 through the Center Net of Mohnarin program (Ministry of Health National Antimicrobial Resistance Investigation Net, established by the China Ministry of Health in 2004) and the CARST program (the China Antimicrobial Resistance Surveillance Trial; the Center Net of Mohnarin was renamed CARST in 2013). Species were initially identified by the participating hospital using Vitek and API systems, and identifications of optrA-positive isolates were confirmed through 16S rRNA sequence and Enterococcus genus-specific primers (10, 11). Screened isolates were collected from urine (37.2%), drainage (23.3%), blood (17.3%), body secretions (9.8%), sputum (6.5%), and other specimens (3%, including cerebrospinal fluid, feces, etc.); 18.6% of strains were collected from intensive care units (ICU), and 78.6% of strains were not from ICUs. In addition, there were 2.9% and 2.8% of the isolates with unknown specimen origin and ward information (ICU or not ICU), respectively.
The optrA gene was also detected in linezolid-susceptible Enterococcus spp. in a previous study (9); therefore, all 2,201 isolates were investigated for the optrA gene using an internal primer pair (optrAinternal F, CAGGTGGTCAGCGAACTAAG; optrAinternal R, GCCACACCACCCATAAGTGTT). For optrA-positive isolates, the complete optrA gene was amplified by another primer pair (optrAcomplete F, TAGGAGGTAGAAGCAAATGA; optrAcomplete R, CGGCAAACTCAAAAGGTC) and sequenced. Pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) were performed to analyze the genotypes of the optrA-positive strains. MICs were determined by the 2-fold agar dilution method according to the recommendations of the CLSI, and the reference strain E. faecalis ATCC 29212 served as a quality control (12). Moreover, all of the optrA-positive isolates were screened for cfr and cfr(B), and isolates with linezolid resistance (MIC of ≥8 mg/liter) were also screened for the presence of the 23S rRNA mutation and ribosomal protein (L3/L4) mutation as previously described (5, 7, 13).
A total of 45 isolates (2.0%, 45/2201), including 37 E. faecalis isolates, 6 E. faecium isolates, and 1 isolate each of Enterococcus thailandicus and Enterococcus gallinarum, were positive for the optrA gene. The optrA-positive incidence increased over time from 0.4% (1/262) in 2004 to 2005 to 3.9% (26/668) in 2013 to 2014 (Table 1). Interestingly, the optrA gene was initially detected in an E. faecium isolate, 05K173, collected in the year 2005, 2 years before linezolid was approved for clinical use in China (2007). Similar to the results of the aforementioned study, the optrA gene was more frequently seen in E. faecalis (3.7%, 37/987) than in E. faecium (0.5%, 6/1115). The 37 optrA-positive E. faecalis isolates clustered into 25 PFGE patterns using the criteria of Tenover et al. (14). Further, MLST analysis revealed that 37 E. faecalis isolates belonged to 21 sequence types (ST), and ST476 was the most common type (6/37), followed by ST116 (5/37). Overall, the clones of 37 E. faecalis isolated in different hospitals and different time periods were diverse. However, occasional clonal dissemination was observed in the same hospital; for example, three isolates (09E349, 09E363, and 09E399) from one hospital were clustered into one clone and one sequence type (ST116), and isolates 13F074 and 13F075 with identical PFGE and ST grouping (ST714) were observed from another hospital. Moreover, 6 optrA-positive E. faecium isolates represented 6 PFGE patterns and 6 different sequence types.
TABLE 1.
Numbers of Enterococcus species isolates screened for the optrA gene and the positive rate from 2004 to 2014 in Chinaa
| Yr and species | No. of isolates | LZDb MIC50 (mg/liter) | LZD MIC90 (mg/liter) | No. optrA positive | Percentage (%) |
|---|---|---|---|---|---|
| 2004-2005 | |||||
| E. faecalis | 125 | NDc | ND | 0 | 0 |
| E. faecium | 115 | ND | ND | 1 | 0.9 |
| Other Enterococcus spp. | 22 | ND | ND | 0 | 0 |
| Overall | 262 | 1 | 0.4 | ||
| 2007-2008 | |||||
| E. faecalis | 158 | ND | ND | 1 | 0.6 |
| E. faecium | 149 | ND | ND | 0 | 0 |
| Other Enterococcus spp. | 39 | ND | ND | 0 | 0 |
| Overall | 346 | 1 | 0.3 | ||
| 2009-2010 | |||||
| E. faecalis | 113 | 2 | 2 | 6 | 5.3 |
| E. faecium | 195 | 1 | 2 | 1 | 0.5 |
| Other Enterococcus spp. | 36 | 1 | 2 | 0 | 0 |
| Overall | 344 | 7 | 2.0 | ||
| 2011-2012 | |||||
| E. faecalis | 276 | 1 | 2 | 8 | 2.9 |
| E. faecium | 304 | 1 | 2 | 1 | 0.3 |
| Other Enterococcus spp. | 1 | —d | — | 1 | 100 |
| Overall | 581 | 10 | 1.7 | ||
| 2013-2014 | |||||
| E. faecalis | 315 | 2 | 2 | 22 | 7.0 |
| E. faecium | 352 | 2 | 2 | 3 | 0.9 |
| Other Enterococcus spp. | 1 | — | — | 1 | 100 |
| Overall | 668 | 26 | 3.9 | ||
| 2004-2014 | |||||
| E. faecalis | 987 | 2e | 2e | 37 | 3.7 |
| E. faecium | 1,115 | 1e | 2e | 6 | 0.5 |
| Other Enterococcus spp. | 99 | 1e | 2e | 2 | 2.0 |
| Overall | 2,201 | 45 | 2.0 |
The Center Net of Mohnarin program and CARST program collected the isolates from the middle of one year to the middle of the following year.
LZD, linezolid.
ND, not detected.
—, linezolid MIC50 and MIC90 were not calculated.
MIC50 and MIC90 were calculated according to the MICs of isolates screened from 2009 to 2014.
Antimicrobial susceptibility testing of 45 optrA-positive isolates revealed that 34 E. faecalis isolates were not susceptible to linezolid (MIC of ≥4 mg/liter), and the remaining 11 isolates were susceptible to linezolid (MIC of ≤2 mg/liter). With the exception of one vancomycin-intermediate Enterococcus gallinarum isolate, 44 isolates were susceptible to vancomycin, teicoplanin, and tigecycline but resistant to erythromycin. Among 37 optrA-positive E. faecalis isolates, 2 isolates (5.4%) were resistant to ampicillin, while 30 (81.1%), 34 (91.9%), and 35 (94.6%) isolates were resistant to levofloxacin, minocycline, and chloramphenicol, respectively. Furthermore, the analysis of mutations in 23S rRNA and L3/L4 protein in 13 linezolid-resistant strains (MIC of 8 mg/liter) revealed that only the mutation F101L in L4 protein was detected; this mutation has been considered to be associated with linezolid resistance (15). However, this mutation has also been observed in two linezolid-susceptible isolates, 09E317 (MIC of 0.5 mg/liter) and 09K619 (MIC of 1 mg/liter), which were randomly selected in isolates our laboratory preserved, implying that this mutation may be not strongly associated with linezolid resistance. Moreover, 45 optrA-positive isolates were all negative for the cfr or cfr(B) gene.
It was previously reported that 655 amino acid sequences of OptrA protein varied in the optrA-positive isolates, and, to date, 10 variants have been identified compared with those for the original OptrA from E. faecalis E349 (designated OptrAE349) (9). In this study, 11 OptrA variants were observed, and 3 novel variants, the DK variant, ED variant, and KDP variant, were identified (Table 2). Among 11 OptrA variants, OptrAE349was the most observed (8/45), followed by the DP variant (7/45), EDD variant (6/45), and EDM variant (6/45). Five OptrA variants, including the EDD variant (4/11), EDM variant (3/11), DP variant (2/11), ED variant (1/11), and EYDNDM variant (1/11), were identified in 11 linezolid-susceptible isolates, which included 9 E. faecalis isolates, 1 E. gallinarum isolate, and 1 E. faecium isolate. The amino acid alterations of the 5 OptrA variants occurred at positions 3 (Lys→Glu), 12 (Asn→Tyr), 176 (Tyr→Asp), 247 (Asp→Asn), 393 (Gly→Asp), 481 (Thr→Pro), and 622 (Ile→Met). However, the EYDD variant with positions at 3 (Lys→Glu), 12 (Asn→Tyr), 176 (Tyr→Asp), and 393 (Gly→Asp) from S. sciuri has been shown to cause 2- to 8-fold increased MICs for oxazolidinones in S. aureus and E. faecalis (8). It remains unclear whether any of these amino acid substitutions or the low expression of the optrA gene or some other mechanisms resulted in the lower linezolid MICs.
TABLE 2.
Polymorphisms of the OptrA protein detected in 45 optrA-positive Enterococcus species isolates
| OptrA variant | Mutations compared with first-reported OptrAE349 from E. faecalis E349a | No. of isolates |
|---|---|---|
| OptrAE349 | No mutations | 8 |
| DD | Tyr176Asp, Gly393Asp | 2 |
| DK | Tyr176Asp, Glu256Lys | 1 |
| DP | Tyr176Asp, Thr481Pro | 7 |
| ED | Lys3Glu, Tyr176Asp | 3 |
| EDD | Lys3Glu, Tyr176Asp, Gly393Asp | 6 |
| EDM | Lys3Glu, Tyr176Asp, Ile622Met | 6 |
| EYDNDM | Lys3Glu, Asn12Tyr, Tyr176Asp, Asp247Asn, Gly393Asp, Ile622Met | 1 |
| KD | Thr112Lys, Tyr176Asp | 3 |
| KDP | Thr112Lys, Tyr176Asp, Thr481Pro | 4 |
| RDK | Ile104Arg, Tyr176Asp, Glu256Lys | 4 |
D, Asp; E, Glu; K, Lys; M, Met; N, Asn; P, Pro; R, Arg; Y, Tyr.
To the best of our knowledge, this is the first study of optrA nationwide surveillance on a large scale that involved isolates collected from 29 hospitals in 23 cities in China from 2004 to 2014. This study revealed that the presence of the oxazolidinone resistance gene optrA increased slightly in China and occurred prior to the approval of linezolid in the Chinese market. Owing to the important role of linezolid against Gram-positive pathogens in clinical practice and the potential risks of the transfer of plasmid-borne optrA between Enterococcus spp., it is necessary to routinely and persistently screen for oxazolidinone resistance and optrA gene.
Accession number(s).
The sequences of the optrA gene encoding different OptrA variants have been deposited in GenBank under the following accession numbers: KX620932 (OptrAE349), KX620933 (DD), KX620934 (DK), KX620935 (DP), KX620936 (ED), KX620937 (EDD), KX620938 (EDM), KX620939 (EYDNDM), KX620940 (KD), KX620941 (KDP), and KX620942 (RDK).
ACKNOWLEDGMENTS
This work was funded by grants from the National Natural Science Foundation of China (grants 81572033 and 31422055).
We are truly grateful to all of the hospitals participating in the Center Net of Mohnarin program and CARST program.
Funding Statement
The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
REFERENCES
- 1.Leach KL, Brickner SJ, Noe MC, Miller PF. 2011. Linezolid, the first oxazolidinone antibacterial agent. Ann N Y Acad Sci 1222:49–54. doi: 10.1111/j.1749-6632.2011.05962.x. [DOI] [PubMed] [Google Scholar]
- 2.Flamm RK, Mendes RE, Hogan PA, Streit JM, Ross JE, Jones RN. 2016. Linezolid surveillance results for the United States (LEADER Surveillance Program 2014). Antimicrob Agents Chemother 60:2273–2280. doi: 10.1128/AAC.02803-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Mendes RE, Hogan PA, Jones RN, Sader HS, Flamm RK. 2016. Surveillance for linezolid resistance via the Zyvox Annual Appraisal of Potency and Spectrum (ZAAPS) programme (2014): evolving resistance mechanisms with stable susceptibility rates. J Antimicrob Chemother 71:1860–1865. doi: 10.1093/jac/dkw052. [DOI] [PubMed] [Google Scholar]
- 4.Mendes RE, Deshpande LM, Jones RN. 2014. Linezolid update: stable in vitro activity following more than a decade of clinical use and summary of associated resistance mechanisms. Drug Resist Updat 17:1–12. doi: 10.1016/j.drup.2014.04.002. [DOI] [PubMed] [Google Scholar]
- 5.Deshpande LM, Ashcraft DS, Kahn HP, Pankey G, Jones RN, Farrell DJ, Mendes RE. 2015. Detection of a new cfr-like gene, cfr(B), in Enterococcus faecium isolates recovered from human specimens in the United States as part of the SENTRY Antimicrobial Surveillance Program. Antimicrob Agents Chemother 59:6256–6261. doi: 10.1128/AAC.01473-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Long KS, Poehlsgaard J, Kehrenberg C, Schwarz S, Vester B. 2006. The Cfr rRNA methyltransferase confers resistance to phenicols, lincosamides, oxazolidinones, pleuromutilins, and streptogramin A antibiotics. Antimicrob Agents Chemother 50:2500–2505. doi: 10.1128/AAC.00131-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Wang Y, Lv Y, Cai J, Schwarz S, Cui L, Hu Z, Zhang R, Li J, Zhao Q, He T, Wang D, Wang Z, Shen Y, Li Y, Fessler AT, Wu C, Yu H, Deng X, Xia X, Shen J. 2015. A novel gene, optrA, that confers transferable resistance to oxazolidinones and phenicols and its presence in Enterococcus faecalis and Enterococcus faecium of human and animal origin. J Antimicrob Chemother 70:2182–2190. doi: 10.1093/jac/dkv116. [DOI] [PubMed] [Google Scholar]
- 8.Li D, Wang Y, Schwarz S, Cai J, Fan R, Li J, Fessler AT, Zhang R, Wu C, Shen J. 2016. Co-location of the oxazolidinone resistance genes optrA and cfr on a multiresistance plasmid from Staphylococcus sciuri. J Antimicrob Chemother 71:1474–1478. doi: 10.1093/jac/dkw040. [DOI] [PubMed] [Google Scholar]
- 9.Cai J, Wang Y, Schwarz S, Lv H, Li Y, Liao K, Yu S, Zhao K, Gu D, Wang X, Zhang R, Shen J. 2015. Enterococcal isolates carrying the novel oxazolidinone resistance gene optrA from hospitals in Zhejiang, Guangdong, and Henan, China, 2010−2014. Clin Microbiol Infect 21:1095.e1–1095.e4. doi: 10.1016/j.cmi.2015.08.007. [DOI] [PubMed] [Google Scholar]
- 10.Depardieu F, Perichon B, Courvalin P. 2004. Detection of the van alphabet and identification of enterococci and staphylococci at the species level by multiplex PCR. J Clin Microbiol 42:5857–5860. doi: 10.1128/JCM.42.12.5857-5860.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Jackson CR, Fedorka-Cray PJ, Barrett JB. 2004. Use of a genus- and species-specific multiplex PCR for identification of enterococci. J Clin Microbiol 42:3558–3565. doi: 10.1128/JCM.42.8.3558-3565.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Clinical and Laboratory Standards Institute. 2016. Performance standards for antimicrobial susceptibility testing; 26th ed CLSI supplement M100S. Clinical and Laboratory Standards Institute, Wayne, PA. [Google Scholar]
- 13.Ntokou E, Stathopoulos C, Kristo I, Dimitroulia E, Labrou M, Vasdeki A, Makris D, Zakynthinos E, Tsakris A, Pournaras S. 2012. Intensive care unit dissemination of multiple clones of linezolid-resistant Enterococcus faecalis and Enterococcus faecium. J Antimicrob Chemother 67:1819–1823. doi: 10.1093/jac/dks146. [DOI] [PubMed] [Google Scholar]
- 14.Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, Swaminathan B. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 33:2233–2239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Biedenbach DJ, Farrell DJ, Mendes RE, Ross JE, Jones RN. 2010. Stability of linezolid activity in an era of mobile oxazolidinone resistance determinants: results from the 2009 Zyvox Annual Appraisal of Potency and Spectrum program. Diagn Microbiol Infect Dis 68:459–467. doi: 10.1016/j.diagmicrobio.2010.09.018. [DOI] [PubMed] [Google Scholar]