Abstract
Background
Red yeast species in the Rhodotorula/Rhodosporidium genus are outstanding producers of triacylglyceride and cell biomass. Metabolic engineering is expected to further enhance the productivity and versatility of these hosts for the production of biobased chemicals and fuels. Promoters with strong activity during oil-accumulation stage are critical tools for metabolic engineering of these oleaginous yeasts.
Results
The upstream DNA sequences of 6 genes involved in lipid biosynthesis or accumulation in Rhodotorula toruloides were studied by luciferase reporter assay. The promoter of perilipin/lipid droplet protein 1 gene (LDP1) displayed much stronger activity (4–11 folds) than that of glyceraldehyde-3-phosphate dehydrogenase gene (GPD1), one of the strongest promoters known in yeasts. Depending on the stage of cultivation, promoter of acetyl-CoA carboxylase gene (ACC1) and fatty acid synthase β subunit gene (FAS1) exhibited intermediate strength, displaying 50–160 and 20–90% levels of GPD1 promoter, respectively. Interestingly, introns significantly modulated promoter strength at high frequency. The incorporation of intron 1 and 2 of LDP1 (LDP1in promoter) enhanced its promoter activity by 1.6–3.0 folds. Similarly, the strength of ACC1 promoter was enhanced by 1.5–3.2 folds if containing intron 1. The intron 1 sequences of ACL1 and FAS1 also played significant regulatory roles. When driven by the intronic promoters of ACC1 and LDP1 (ACC1in and LDP1in promoter, respectively), the reporter gene expression were up-regulated by nitrogen starvation, independent of de novo oil biosynthesis and accumulation. As a proof of principle, overexpression of the endogenous acyl-CoA-dependent diacylglycerol acyltransferase 1 gene (DGA1) by LDP1in promoter was significantly more efficient than GPD1 promoter in enhancing lipid accumulation.
Conclusion
Intronic sequences play an important role in regulating gene expression in R. toruloides. Three intronic promoters, LDP1in, ACC1in and FAS1in, are excellent promoters for metabolic engineering in the oleaginous and carotenogenic yeast, R. toruloides.
Electronic supplementary material
The online version of this article (doi:10.1186/s12934-016-0600-x) contains supplementary material, which is available to authorized users.
Keywords: Rhodosporidium/Rhodotorula, Metabolic engineering, Oleaginous yeast, Promoter, Lipid
Background
Red yeast species in the Rhodosporidium (teleomorph) genus, which was recently revised as genus Rhodotorula (anamorphic) regarding to the implementation of “One Fungus = One Name” nomenclatural principle [1], are outstanding producers of lipids and carotenoids [2, 3]. More than 100 g/L of dry biomass with over 60% neutral lipids (triacylglycerol, TAG) content can be produced within a week when glucose was used as the carbon source [4–6]. To take advantage of their high metabolic flux and cell mass productivity, a number of laboratories have been engaged in establishing them as new platforms for synthetic biology and metabolic engineering. To date, several genetic manipulation tools have been reported, such as high efficiency transformation via Agrobacterium tumefaceins-mediated transformation (ATMT), high efficiency gene deletion, and constitutive and inducible promoter toolbox [7–12]. As oil producers, strong and robust promoters that function during lipid accumulation stage will be particularly useful.
The production of long chain acyl-CoA, triacylglycerol (TAG) and lipid bodies are the 3 major lipogenesis steps, and genes involved in these processes are the likely source of strong promoters in oleaginous yeasts. Acetyl-CoA carboxylase (Acc1) catalyzes the biotin-dependent carboxylation of acetyl-CoA to form malony-CoA, the first committed and rate-limiting step in fatty acid biosynthesis [13]. Proteomic studies showed that it is a highly abundant protein during lipid accumulation phase [5]. Likewise, the α and β subunits of fatty acid synthase (Fas2 and Fas1, respectively), fatty acid transporter (Fat1), ATP:citrate lyase (Acl1) and urea carboxylase/allophanate hydrolase (Dur1/2) were also found in high abundance during lipid accumulation phase [14, 15]. Other known abundant targets are the perilipin, adipophilin and tail-interacting (PAT) family proteins, which serve as dynamic scaffolds regulating the formation, growth and degradation of lipid bodies [15–19].
Eukaryotic genes are often interrupted by spliceosomal introns, which vary greatly among different species in either density (number of introns per gene) or length [20]. Although introns are often perceived as junk DNA gained during genome evolution [21], some introns are known to regulate gene transcription and this effect is known as intron-mediated enhancement (IME) [22]. The concept of IME was initially reported in plant [22] and subsequently observed in other organisms such as flies [23] and fungi [24, 25]. To our knowledge, two cases of IME have been reported in oleaginous yeasts where the 5′ introns significantly enhanced gene expression: one in fructose 1,6-bisphosphate aldolase gene (FBA1) of Yarrowia lipolytica and the other in d-amino acid oxidase gene (DAO1) of R. toruloides [12, 26]. Despite Acc1 being the most abundant protein in R. toruloides [5], the 1.5-kb upstream DNA sequence of ACC1 (−1501 to −1 from the translational start site) showed little promoter activity (our unpublished data). In addition, the high intron density (an average of 6 introns per gene) [14] and strong enhancing effect of the DAO1 introns [12] suggested the global regulatory roles of introns in R. toruloides.
Here, we report the cloning and molecular characterization of 6 promoters from R. toruloides and demonstrate their applications in metabolic engineering.
Results
Characterization of genes involved in lipid accumulation
Genomic sequences for acetyl-CoA carboxylase gene (ACC1), ATP:citrate lyase gene (ACL1), β subunit of fatty acid synthetase gene (FAS1), fatty acid transporter gene (FAT1) and urea amidolyase gene (DUR1) were identified by BLAST search against the public database as well as in-house EST and genome database of R. toruloides strains [27, 28]. The amino acid sequences of known orthologous enzymes from Saccharomyces cerevisiae or Y. lipolytica were used as queries (Table 1). The perilipin encoding gene of R. toruloides NP11 strain (lipid droplet protein 1 gene, LDP1) [15] was used to search for its counterpart in R. toruloides ATCC 10657. The putative homolog of ACC1, ACL1, FAS1, FAT1, DUR1 and LDP1 was found located in the genome sequencing scaffold No.18, 9, 18, 9, 25 and 10 of R. glutinis ATCC 204091, respectively (Table 1). Analysis by 5′ RACE and transcriptomics showed that the cDNA of ACC1, ACL1, FAS1, FAT1, DUR1 and LDP1 contains a 5′ untranslated region (5′UTR) of 150, 179, 142, 61, 303 and 194 nt in length, respectively (Table 1). Notably, the first intron was found to be located within the 5′UTR of both FAS1 and LDP1 (Fig. 1). The detailed structures and sequences of these genes are summarized in Table 1 and Additional file 1, respectively.
Table 1.
Gene annotations
| Gene | CDS length (nt) |
Scaffold No. |
5′UTR (nt) |
3′UTR (nt) |
Exon | Protein (aa) |
Querya |
|---|---|---|---|---|---|---|---|
| ACC1 | 7347 | 18 | 150 | 187b | 11 | 2232 | YNR016C |
| ACL1 | 4417 | 9 | 178b | 216 | 10 | 1157 | YALI0E34793g |
| FAS1 | 9628 | 18 | 142bc | 101b | 16 | 2928 | YKL182W |
| FAT1 | 2860 | 9 | 61b | 105b | 14 | 639 | YBR041W |
| DUR1 | 4446 | 25 | 303b | 109b | 12 | 1239 | YBR208C |
| LDP1 | 1256 | 10 | 115bc | 230b | 7 | 261 | RHTO-05627 |
a Genbank numbers used for BLAST search and gene annotation
b Predicted by transcriptomic results
c Containing the first intron within 5′UTR
Fig. 1.

Schematic diagrams of promoters. a DUR1 and DUR1in promoters. b FAT1 and FAT1in promoter. c FAS1 and FAS1in promoters. d ACL1 and ACL1in promoters. e ACC1 and ACC1in promoters. f LDP1 and LDP1in promoters. tss represents the transcription start site, blue bars represent exons. Translational starts (ATG) in intronic promoters are indicated. Nucleotides in red letters indicate modifications from the genome sequences. The scaffold number is based on the genome sequence of R. glutinis ATCC 204091 [28]
Analysis of promoter activity by luciferase reporter assay
Upstream DNA sequences of the above mentioned genes were amplified by PCR in two versions, with or without intronic sequence (Fig. 1), and fused to the codon-optimized luciferase reporter gene RtLUC2 (GenBank accession number KR258785) [12] in the binary vector pKCL2. pKCL2 allows site-specific integration of reporter cassettes at the CAR2 locus (phytoene synthase/carotene cyclase gene), which eliminates position effects caused by ectopic insertion of T-DNA into the chromosomes [8, 12]. The names of intronic promoters were affixed with “in” to differentiate the promoters analyzed.
As reported, DUR1 and FAT1 were highly transcribed during lipogenic phase [14]. However, luciferase reporter assay revealed that none of DUR1, DUR1in, FAT1 and FAT1in promoters (Fig. 1a, b) displayed detectable activity throughout the cell culture (Fig. 2a, b). The presence of introns in FAS1 and ACL1 promoters weakened promoter activities at the initial stages of cell culture (day 1 and 2) (Fig. 2c, d). However, these repressive effects disappeared after day 3 when nitrogen levels became limited and lipid accumulation began to accelerate (Fig. 2c, d). Thus, the FAS1in and ACL1in promoters (Fig. 1c, d) should be useful under circumstances where strong expression have undesirable effects at the early stages of cell culture. Otherwise, the intronless FAS1 and ACL1 promoters would be preferred for gene expression. Unlike the intronless ACC1 promoter (−1501 to −1, Fig. 1e), the ACC1in promoter (−1501 to +93) yielded significantly higher luciferase activity throughout the time course (Fig. 2e).
Fig. 2.

Time-course studies of promoter strength by luciferase gene reporter assay. a DUR1 and DUR1in promoter. b FAT1 and FAT1in promoter. c FAS1 and FAS1in promoter. d ACL1 and ACL1in promoter. e ACC1 and ACC1in promoter. f LDP1 and LDP1in promoter. Cells were cultured in MinRL3 medium at 30 °C. Results were derived from three biological replicates and error bars indicate standard deviation. RPA relative promoter activity normalized against that of GPD1 promoter
Suprisingly, LDP1 promoter (−362 to −1, Fig. 1f) exhibited two- to fourfold higher activity than the GPD1 promoter, one of the strongest promoters known in fungi (Fig. 2f). Moreover, the intronic LDP1in promoter (−362 to +155, Fig. 1f) further enhanced the promoter activity, reaching up to 11 times that of GPD1 promoter (Fig. 2f). Taken together, promoters of FAS1, ACC1 and LDP1 are strong candidates for metabolic engineering in R. toruloides and related fungal species.
Transcription of ACC1, FAS1 and LDP1 mRNAs during lipid production
Gene expression of ACC1, FAS1 and LDP1 were investigated by qRT-PCR analysis, which was done by normalizing against the transcripts of actin gene (ACT1) using cycle threshold (Ct) method (2−ΔCt calculation method). In good agreement with the luciferase reporter assays, mRNA levels of LDP1 were much higher than those of ACC1 and FAS1 throughout the 6-day culture period (Fig. 3a). To show the dynamic changes in gene expression, the relative mRNA levels of ACC1, FAS1 and LDP1 at different time points were compared using 2−ΔΔCt calculation method, where each mRNA level at day 0 was set as 1. Overall, all 3 genes showed upward trends in transcription over the 6-day culture period, although the mRNA levels of ACC1 and LDP1 peaked earlier at day 2 and 4, respectively (Fig. 3b).
Fig. 3.

qRT-PCR analysis of mRNA levels. a Relative mRNA levels of ACC1, FAS1 and LDP1. Calculation of mRNA levels were done using 2−ΔCt method by normalizing against actin gene ACT1 (reference). b Dynamic changes of mRNA levels of ACC1, FAS1 and LDP1. Fold change of mRNA level was normalized against its own mRNA level at day 0. WT strain was cultured in MinRL3 medium for 6 days at 30 °C. Results were derived from three biological replicates and error bars indicate standard deviation
Performance of promoters in a lipid-less genetic background
To evaluate the performance of the above promoters in a non-oil accumulating genetic background, reporter constructs for LDP1 and LDP1in were transformed into a R. toruloides mutant named dlad, in which genes encoding 4 essential acyltransferase in lipid biosynthesis, acyl-CoA-dependent diacylglycerol acyltransferase (DGA1), phospholipid:diacylglycerol acyltransferase (LRO1), acyl-CoA:sterol acyltransferase (ARE1) and soluble diacylglycerol acyltransferase (DGA3), were sequentially disrupted (our unpublished data). This quadruple disruption mutant contains only 8.5% lipids of wild-type strain (WT) (our unpublished data). Similar to the situation in WT, both LDP1 and LDP1in promoters displayed significantly higher activity than the GPD1 promoter in dlad mutant. Moreover, the LDP1in promoter was more active than the LDP1 promoter (Fig. 4) although the magnitude of enhancement appeared to be reduced (compare Figs. 2f, 4). These suggest that the lipogenic promoters such as LDP1 and LDP1in are largely regulated by nutrient levels independent of de novo TAG biosynthesis.
Fig. 4.

Promoter strength in lipid production-deficient mutant dlad. The dlad strain is mutant with targeted deletion of four diacylglycerol acyltransferase genes (our unpublished data). All reporter mutants were cultured in MinRL3 for 5 days and luciferase reporter assays were performed daily. Results were derived from three biological replicates and error bars indicate standard deviation
Metabolic engineering of lipid production using different promoters
Overexpression of Dga1, the key enzyme of TAG biosynthesis, has been demonstrated to significantly improve lipid yields in other oleaginous yeast like Y. lipolytica [13]. As a principle of concept, to demonstrate the application of the strong promoters characterized in this study, we compared the lipid production levels by overexpressing DGA1 using either GPD1 or LDP1in promoter (strain PGPD1::DGA1 and PLDP1in::DGA1, respectively). Results showed that overexpression of DGA1 with either promoters significantly improved lipid content (Fig. 5a). More importantly, lipid content accumulated in the strain PLDP1in::DGA1 was on average 21% higher than that in the strain PGPD1::DGA1 and 55% higher than that of WT strain (Fig. 5a). qRT-PCR analysis was used to identify the gene expression of DGA1 in the above three strains. When compared to WT strain on day 2, the use of GPD1 and LDP1in promoter resulted in 26- and 66-fold increase in the mRNA levels of DGA1, respectively (Fig. 5b). These data suggest that the promoters developed in this study, particularly the LDP1in promoter, are superior tools for metabolic engineering in oleaginous yeasts.
Fig. 5.

Enhancement of lipid content by DGA1 overexpression. a Quantification of lipid content as gram lipids per gram dry cell weight (%). b qRT-PCR analysis of DGA1 expression. WT, PGPD1 ::DGA1 and PLDP1in ::DGA1 strains were cultured in GJ2013 medium for 3 days at 30 °C. Results were derived from three biological replicates and error bars indicate standard deviation
Discussion
Lipid biosynthesis is the dominant bioactivity in oleaginous yeasts. Therefore, promoters of genes involved in various steps of the pathway are particularly useful. Such examples include GPD1, PGK1 and PGI1 promoters as reported previously [7, 11]. Here, we analyzed the promoters of 6 genes involved in either fatty acid biosynthesis, TAG biosynthesis or lipid body formation. Through luciferase reporter assay, the application of intronic promoters derived from ACC1, FAS1 and LDP1 genes were firmly established.
Promoters are generally known to be located upstream of the transcriptional start site (TSS) and composed of a core promoter domain and several regulatory domains [29]. Although cis-acting elements may be located 50 or more kilobases proximal to the TSS, most eukaryotic promoters used to date are within 1 kb upstream from the TSS, including those reported promoters from R. toruloides [7, 12]. However, increasing evidences have demonstrated that cis-acting elements may be located downstream of the TSS, in the 5′UTR, within an intron, or even downstream from the last exon of a gene [30]. The inclusiveness of introns in certain genes may improve their transcriptional and translational outputs [31]. Regulatory elements in the first intron within the 5′UTR and coding region have been found in higher eukaryotes elsewhere [32–36]. Although IME has been known for a long time, mechanistic studies are still lagging. It was recently proposed that introns may create a region of localized accessible chromatin to increase transcriptional initiation [37]. The introns characterized in this report with diverse roles in regulating gene expression should serve as good samples for the mechanistic studies of IME.
In this study, we found that the expression of 5 out of 6 genes were significantly regulated by introns: with strong enhancing effect on ACC1 and LDP1 genes and repressing effect on ACL1, FAS1 and DUR1 genes (Fig. 2). In fact, intron 1 of GPD1 gene (+3 to +131) also contains a repressing element (Additional file 2). These results, together with the previous report of DAO1 gene [12], showed that the involvement of introns in transcriptional control is a universal phenomenon in R. toruloides. Further studies in this area may facilitate the development of a more robust and efficient synthetic platform based on oleaginous red yeasts.
Conclusions
Intronic promoters of ACC1, FAS1 and LDP1 are superior tools for gene expression, metabolic engineering and synthetic biology in R. toruloides. Similar promoters may also be functional in other Pucciniomycotina species.
Methods
Strains, media and culture conditions
Rhodotorula toruloides strain ATCC 10657 was purchased from ATCC (Manassas, VA, USA). R. toruloides nonhomologous end joining-deficient mutant strain Δku70e [8] was considered as the wild-type strain. R. toruloides quadruple disruption mutant dlad (Δdga1Δlro1Δare1Δdga3) was generated by serial deletion of the four diacylglycerol acyltransferase genes, DGA1, LRO1, ARE1 and DGA3, in the host Δku70e through homologous recombination, in which the selectable marker cassette was recycled by activating Cre/loxP system [8]. A. tumefaciens strain AGL1 [38] and Escherichia coli XL1-BLUE were used for routine molecular cloning procedures.
Rhodotorula toruloides was cultured at 28 °C in YPD broth (1% yeast extract, 2% peptone, 2% glucose) or on solid potato-dextrose agar (PDA). A. tumefaciens was grown at 28 °C in either liquid or solid 2YT medium (1.6% tryptone, 1% yeast extract, 0.5% NaCl). E. coli XL1-Blue was cultured in Luria–Bertani (LB) broth or on LB agar and used for routine DNA manipulation.
Rhodotorula toruloides was cultured in lipid production medium MinRL3 unless indicated otherwise. Medium MinRL3 contains (per l) 70 g glucose, 1.5 g yeast extract, 0.5 g (NH4)2SO4, 2.05 g K2HPO4, 1.45 g KH2PO4, 0.6 g MgSO4, 0.3 g NaCl, 10 mg CaCl2, 1 mg FeSO4, 0.5 mg ZnSO4, 0.5 mg CuSO4, 0.5 mg H3BO4, 0.5 mg MnSO4, 0.5 mg NaMoO4, with pH adjusted to 6.1.
In some experiments, GJ2013 medium [39] was used as another lipid production medium. Medium GJ2013 (per l) contains 40 g glucose, 0.4 g KH2PO4, 1.5 g MgSO4·7H2O, 10 mL TE solution, pH6.0. TE solution (per litre) contains 4.0 g CaCl2·2H2O, 0.55 g FeSO4·7H2O, 0.52 g citric acid·H2O, 0.1 g ZnSO4·7H2O, 0.076 g MnSO4·H2O, 0.1 mL smoked H2SO4 [40].
Plasmid construction
Oligonucleotides used are listed in Table 2. All DNA restriction and modification enzymes were sourced from New England Biolabs (NEB, MA, USA). Plasmid pKCL2 (Fig. 5a) is similar to pKC2 except that the RtGFP fragment was replaced with RtLUC2 gene [12]. This allowed efficient intergation of reporter gene cassette at the CAR2 locus, consisting of a hygromycin resistant cassette (PGPD1–3::HPT-3::TSV40) and a luciferase reporter cassette (PGPD1::RtLUC2::T35S) flanked by CAR2 sequence [8]. PGPD1–3 and PGPD1 are the glyceraldehyde 3-phosphate dehydrogenase promoter of R. graminis WP1 and R. toruloides ATCC 10657, with GenBank accession number of JQ806386 and JN208861, respectively [7]. HPT-3 (JQ806387) and RtLUC2 (KR258785) are codon-optimized synthetic genes encoding E. coli hygromycin phosphotransferase and firefly luciferase (Luc2, ACH53166), respectively [7].
Table 2.
Sequences of oligonucleotides
| Name | Sequence (5′-3′) | Information |
|---|---|---|
| SV40R | TTTccgcggTCGAATTTCCCCGATCGTTCA | T SV40 |
| LUC2U | GAGTCGCTCACCTACTGCATC | RtLUC2 |
| ACC1U1 | GAAGGCGGGGGTTCTCGGAAG | ACC1 |
| LDP1U1 | GACGAGGTCATCCGCGAG | LDP1 5′UTR |
| LDP1L1 | GACCAGCTCTACCAGCGCATCAC | LDP1 3′UTR |
| CRP79L1 | TCGCCCTCCTCCCCTGCTCGCAAAT | CRP79 |
| Rt232Sf | TTTactagtGGTCGCTTCTTTCCTCGCAG | ACC1/ACC1in |
| Rt233Nr | TTTccatggGAAGTGAAGTTGGGGAACG | ACC1 |
| Rt310Nr | TTTccatggAGAACCTGTCGTCGCATGA | ACC1in |
| Rt359Sf | TTTactagtTCGACTTGTCTTCCTCCGCGA | DUR1/DRU1in |
| Rt360Nr | TTTccatggCGAAAGAGGGATGTGAG | DUR1 |
| Rt424Nr | TTTccatggAGAAGAGGTTCTGCGCGGA | DUR1in |
| Rt363Sf | TTTactagtCTGTGATGCTAGGTGTCGATC | ACL1/ACL1in |
| Rt364Nr | TTTccatggCTGCTGCGTTTCCTGGTAC | ACL1 |
| Rt365Nr | TTTccatggCGTCGTACTCGCGGATG | ACL1in |
| Rt369Sf | TTTactagtGAACTCGACTCATTACGGGAG | FAS1/FAS1in |
| Rt370Nr | TTTccatggTGTGCGGTATTCGACGAGTTTG | FAS1 |
| Rt371Nr -1 | TTTccatggAGTAGTGCTGTCCGCGCAGA | FAS1in |
| Rt361Sf | TTTactagtCTCTAGCCTACGACCGCCTC | FAT1/FAT1in |
| Rt362Nr | TTTccatggTAGCGAGTCGTTCTCTGCAG | FAT1 |
| Rt516Nr | TTTccatggGCGAGGCGGTTGACCTCTGC | FAT1in |
| Rt359Sf | TTTactagtTCGACTTGTCTTCCTCCGCGA | DUR1/DUR1in |
| Rt360Nr | TTTccatggCGAAAGAGGGATGTGAG | DUR1 |
| Rt424Nr | TTTccatggAGAAGAGGTTCTGCGCGGA | DUR1in |
| Rt366Sf | TTTactagtCACGCCTCTGTGACTCGGTAC | LDP1/LDP1in |
| Rt367Nr | TTTccatggCGTGCGAGTGTGCGTGCGA | LDP1 |
| Rt368Nr | TTTccatggGGTAGTCCGACACCTGCG | LDP1in |
All promoter sequences were amplified using R. toruloides genomic DNA as the template unless indicated otherwise. Upstream sequence of ACL1 (−1000 to −1) and ACL1in (−1000 to +167) was amplified using oligo pair Rt363Sf/Rt364Nr and Rt363Sf/Rt365Nr, respectively. The resulting PCR products of ACL1 and ACL1in promoter were double digested with SpeI and NcoI and inserted to the same sites of vector pKCL2 to create plasmid pKCLAL1 and pKCLAL2, respectively. Similarly, upstream sequence of FAS1 (−1001 to −1), FAS1in (−1001 to +271), FAT1 (−1003 to −1), FAT1in (−1003 to +417), DUR1 (−493 to −1), DUR1in (−493 to +627), ACC1 (−1501 to −1), ACC1in (−1501 to +91), LDP1 (−362 to −1) and LDP1in (−362 to +152) was amplified using oligo pair Rt369Sf/Rt370Nr, Rt369Sf/Rt371Nr, Rt361Sf/Rt362Nr, Rt361Sf/Rt516Nr, Rt359Sf/Rt360Nr, Rt359Sf/Rt424Nr, Rt232Sf/Rt233Nr, Rt232Sf/Rt310Nr, Rt366Sf/Rt367Nr and Rt366Sf/Rt368Nr (Table 2) to create pKCLF3, pKCLF4, pKCLF5, pKCLF6, pKCLDU1, pKCLDU2, pKCLA1, pKCLA2, pKCLP3 and pKCLP4, respectively.
Agrobacterium tumefaciens-mediated transformation
The binary vectors were electroporated into A. tumefaciens AGL1 (2.5 kV, 25 μF, 400 Ω) and subsequently selected with 2YT agar medium supplemented with streptomycin (100 µg/ml). Fungi transformation via ATMT was performed as described previously [7].
Isolation of genomic DNA and total RNA
Genomic DNA and RNA of R. toruloides were extracted as described previously [7]. The concentration and purity of the extracted DNA and RNA were analyzed using NanoDrop® ND-1000 Spectrophotometer (Nanodrop Technologies, USA) and agarose gel electrophoresis.
Gene annotation in R. toruloides
Due to the very high sequence homology between R. toruloides ATCC 10657 and R. glutinis ATCC 204091, genome database of R. glutinis ATCC 204091 was used as the reference unless indicated otherwise. The putative encoding gene of acetyl-CoA carboxylase (ACC1), ATP:citrate lyase (ACL1), β subunit of fatty acid synthetase (FAS1), fatty acid transporter (FAT1), urea amidolyase (DUR1) and perilipin (LDP1) were annotated using orthologous sequences from S. cerevisiae, Y. lipolytica or R. toruloides NP11 (Table 1).
Rapid amplification of cDNA ends (RACE)
The 5′ and 3′ end of cDNA sequences were determined by 5′ RACE and 3′ RACE using BD SMARTer™ RACE cDNA Amplification Kit (Clontech, CA, USA) according to the manufacturer’s instruction. Oligos ACC1U1 (Table 2) was used as the specific primer for 5′ RACE of ACC1, LDP1U1 and LDP1L1 (Table 2) was used for 5′ RACE and 3′ RACE of LDP1, respectively.
Quantitative reverse transcription PCR (qRT-PCR)
Total RNA was treated with DNase I (Roche Diagnostics, Mannheim, Germany) followed by precipitation with ethanol to remove trace amount of DNA. cDNA was synthesized by reverse transcription using iScript™ Reverse Transcription Supermix (Bio-Rad Laboratories, CA, USA). Real-time PCR was conducted in ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, CA, USA) using the ABI SYBR® Select Master Mix (Applied Biosystems). PCR conditions were as follows: an initial 50 °C for 2 min and 95 °C denaturation step for 10 min followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 1 min. Triplicates were used for all analysis. The data was acquired using the software SDS 2.4 (Applied Biosystems) and relative gene expression levels were calculated against the reference encoding gene of actin (ACT1, GenBank acc. no. KR138696) [12] using the 2−ΔΔCt method through the RQ Manager software v1.2.1 (Applied Biosystems).
Reporter assay
Strains bearing the integrated T-DNA at the CAR2 locus were identified by the albino phenotype followed by Southern blot verification. The strains were then cultured in YPD broth to mid-exponential phase and used for luciferase assay. Cells were washed twice with water and inoculated to the indicated medium at an optical density (OD600) of 0.5 and cultured at 30 °C with agitation (250 rpm). Luciferase activity was determined by one-step measurement method as described previously [7] with some modifications. Briefly, cell culture (10 µl) was mixed with 85 µl of PBS buffer (pH7.4) and 5 µl of 10 mM D-luciferin (DMSO solution, catalogue No. L9504, Sigma-Aldrich), loaded in a well of FluoroNunc 96-well plate (Thermo Fisher Scientific, Langenselbold, Germany) for measurement of bioluminescence. Cell density was measured at OD of 600 nm with 10-20 fold dilution of cell culture in PBS buffer to a final volume of 100 μl, and loaded to a well of 96-well flat-bottom transparent plate (Nunc, Roskilde, Denmark). All data was measured and acquired with the Tecan Infinite M200 plate reader coupled with the iCycler version 3.0 software (Tecan, Salzburg, Austria). The relative promoter activity (RPA) was calculated by normalization against that of GPD1 promoter.
Authors’ contributions
YL, SAY and CMJK carried out the experiments, contributed the regents, materials and analysis tools. YL analyzed the data. YL and LJ conceived and designed the experiments, drafted and revised the manuscript. All authors read and approved the final manuscript.
Acknowledgements
Not applicable.
Competing interests
The authors declare that they have no competing interests. Temasek Life Sciences Laboratory has an interest in developing Rhodosporidium toruloides as an industrial biotechnology platform.
Availability of data and materials
The datasets supporting the conclusions of this article are included within the article and its additional files.
Funding
This work was financially supported by Singapore National Research Fundation CRP-8-2011-02, Singapore Economic Development Board and Temasek Trust.
Abbreviations
- UTR
untranslated region
- Are1
acyl-CoA:sterol acyltransferase
- ATCC
American type culture collection, USA
- BLAST
basic local alignment search tool (National Library of Medicine, National Institutes of Health, USA)
- CAR2
bifunctional enzyme phytoene synthase and lycopene cyclase encoding gene
- Dga1
acyl-CoA:diacylglycerol acyltransferase
- Dga3
soluble diacylglycerol acyltransferase
- GPD1
glyceraldehyde 3-phosphate dehydrogenase gene
- IME
intron-mediated enhancement
- Lro1
phospholipid:diacylglycerol acyltransferase
- qPCR
quantitative reverse transcription polymerase chain reaction
- RACE
rapid amplification of cDNA ends
- RtLUC2
a commercially synthesized firefly luciferase protein (Luc2) gene according to the codon bias of R. toruloides
- TAG
triacylglycerol
- TSS
transcriptional start site
Additional files
Additional file 1. Promoter sequences. Promoter range in the gene was shown in the parenthesis and substituted sequences are in red font. Translational starts (ATG) are underlined.
Additional file 2. Comparison of intronic and intronless GPD1 promoter strength. Luciferase gene assay was performed using the reporter strain with 795 and 932 bp promoter of GPD1 (−795 to +1) and GPD1in (−795 to +137), respectively. Cells were cultured in MinRL3 medium for 4 days and luciferase reporter assay was performed daily.
Contributor Information
Yanbin Liu, Phone: +65-68727484, Email: yanbin@tll.org.sg.
Sihui Amy Yap, Email: amyyap@tll.org.sg.
Chong Mei John Koh, Email: johnkoh@tll.org.sg.
Lianghui Ji, Phone: +65-68727483, Email: jilh@tll.org.sg.
References
- 1.Wang QM, Yurkov AM, Goker M, Lumbsch HT, Leavitt SD, Groenewald M, Theelen B, Liu XZ, Boekhout T, Bai FY. Phylogenetic classification of yeasts and related taxa within Pucciniomycotina. Stud Mycol. 2015;81:149–189. doi: 10.1016/j.simyco.2015.12.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Sampaio JP, Gadanho M, Bauer R, Weiß M. Taxonomic studies in the Microbotryomycetidae: Leucosporidium golubevii sp. nov., Leucosporidiella gen. nov. and the new orders Leucosporidiales and Sporidiobolales. Mycol Prog. 2003;2:53–68. doi: 10.1007/s11557-006-0044-5. [DOI] [Google Scholar]
- 3.Yamazaki M, Komagata K. Taxonomic significance of electrophoretic comparison of enzymes in the genera Rhodotorula and Rhodosporidium. Int J Syst Bacteriol. 1981;31:361–381. doi: 10.1099/00207713-31-3-361. [DOI] [Google Scholar]
- 4.Zhao X, Wu S, Hu C, Wang Q, Hua Y, Zhao ZK. Lipid production from Jerusalem artichoke by Rhodosporidium toruloides Y4. J Ind Microbiol Biotechnol. 2010;37:581–585. doi: 10.1007/s10295-010-0704-y. [DOI] [PubMed] [Google Scholar]
- 5.Liu H, Zhao X, Wang F, Li Y, Jiang X, Ye M, Zhao ZK, Zou H. Comparative proteomic analysis of Rhodosporidium toruloides during lipid accumulation. Yeast. 2009;26:553–566. doi: 10.1002/yea.1706. [DOI] [PubMed] [Google Scholar]
- 6.Turcotte G, Kosaric N. Biosynthesis of lipids by Rhodosporidium toruloides ATCC 10788. J Biotechnol. 1988;8:221–237. doi: 10.1016/0168-1656(88)90004-1. [DOI] [Google Scholar]
- 7.Liu Y, Koh CM, Sun L, Hlaing MM, Du M, Peng N, Ji L. Characterization of glyceraldehyde-3-phosphate dehydrogenase gene RtGPD1 and development of genetic transformation method by dominant selection in oleaginous yeast Rhodosporidium toruloides. Appl Microbiol Biotechnol. 2013;97:719–729. doi: 10.1007/s00253-012-4223-9. [DOI] [PubMed] [Google Scholar]
- 8.Koh CM, Liu Y, Du Moehninsi M, Ji L. Molecular characterization of KU70 and KU80 homologues and exploitation of a KU70-deficient mutant for improving gene deletion frequency in Rhodosporidium toruloides. BMC Microbiol. 2014;14:50–59. doi: 10.1186/1471-2180-14-50. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Lin X, Wang Y, Zhang S, Zhu Z, Zhou YJ, Yang F, Sun W, Wang X, Zhao ZK. Functional integration of multiple genes into the genome of the oleaginous yeast Rhodosporidium toruloides. FEMS Yeast Res. 2014;14:547–555. doi: 10.1111/1567-1364.12140. [DOI] [PubMed] [Google Scholar]
- 10.Abbott EP, Ianiri G, Castoria R, Idnurm A. Overcoming recalcitrant transformation and gene manipulation in Pucciniomycotina yeasts. Appl Microbiol Biotechnol. 2013;97:283–295. doi: 10.1007/s00253-012-4561-7. [DOI] [PubMed] [Google Scholar]
- 11.Wang Y, Lin X, Zhang S, Sun W, Ma S, Zhao ZK. Cloning and evaluation of different constitutive promoters in the oleaginous yeast Rhodosporidium toruloides. Yeast. 2016;33:99–106. doi: 10.1002/yea.3145. [DOI] [PubMed] [Google Scholar]
- 12.Liu Y, Koh CMJ, Ngoh ST, Ji L. Engineering an efficient and tight D-amino acid-inducible gene expression system in Rhodosporidium/Rhodotorula species. Microb Cell Fact. 2015;14:170–185. doi: 10.1186/s12934-015-0357-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Tai M, Stephanopoulos G. Engineering the push and pull of lipid biosynthesis in oleaginous yeast Yarrowia lipolytica for biofuel production. Metab Eng. 2013;15:1–9. doi: 10.1016/j.ymben.2012.08.007. [DOI] [PubMed] [Google Scholar]
- 14.Zhu Z, Zhang S, Liu H, Shen H, Lin X, Yang F, Zhou YJ, Jin G, Ye M, Zou H, Zhao ZK. A multi-omic map of the lipid-producing yeast Rhodosporidium toruloides. Nat Commun. 2012;3:1112. doi: 10.1038/ncomms2112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Zhu Z, Ding Y, Gong Z, Yang L, Zhang S, Zhang C, Lin X, Shen H, Zou H, Xie Z, et al. Dynamics of the Lipid Droplet Proteome of the Oleaginous Yeast Rhodosporidium toruloides. Eukaryot Cell. 2015;14(3):252–264. doi: 10.1128/EC.00141-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Digel M, Ehehalt R, Fullekrug J. Lipid droplets lighting up: insights from live microscopy. FEBS Lett. 2010;584:2168–2175. doi: 10.1016/j.febslet.2010.03.035. [DOI] [PubMed] [Google Scholar]
- 17.Kimmel AR, Brasaemle DL, McAndrews-Hill M, Sztalryd C, Londos C. Adoption of PERILIPIN as a unifying nomenclature for the mammalian PAT-family of intracellular lipid storage droplet proteins. J Lipid Res. 2010;51:468–471. doi: 10.1194/jlr.R000034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Athenstaedt K, Jolivet P, Boulard C, Zivy M, Negroni L, Nicaud JM, Chardot T. Lipid particle composition of the yeast Yarrowia lipolytica depends on the carbon source. Proteomics. 2006;6:1450–1459. doi: 10.1002/pmic.200500339. [DOI] [PubMed] [Google Scholar]
- 19.Wang C, St Leger RJ. The Metarhizium anisopliae Perilipin Homolog MPL1 Regulates Lipid Metabolism, Appressorial Turgor Pressure, and Virulence. J Biol Chem. 2007;282:21110–21115. doi: 10.1074/jbc.M609592200. [DOI] [PubMed] [Google Scholar]
- 20.Roy SW. Intron-rich ancestors. Trends Genet. 2006;22:468–471. doi: 10.1016/j.tig.2006.07.002. [DOI] [PubMed] [Google Scholar]
- 21.Rose AB. Intron-mediated regulation of gene expression. Curr Top Microbiol Immunol. 2008;326:277–290. doi: 10.1007/978-3-540-76776-3_15. [DOI] [PubMed] [Google Scholar]
- 22.Mascarenhas D, Mettler IJ, Pierce DA, Lowe HW. Intron-mediated enhancement of heterologous gene expression in maize. Plant Mol Biol. 1990;15:913–920. doi: 10.1007/BF00039430. [DOI] [PubMed] [Google Scholar]
- 23.Duncker BP, Davies PL, Walker VK. Introns boost transgene expression in Drosophila melanogaster. Mol Gen Genet. 1997;254:291–296. doi: 10.1007/s004380050418. [DOI] [PubMed] [Google Scholar]
- 24.Lugones LG, Scholtmeijer K, Klootwijk R, Wessels JG. Introns are necessary for mRNA accumulation in Schizophyllum commune. Mol Microbiol. 1999;32:681–689. doi: 10.1046/j.1365-2958.1999.01373.x. [DOI] [PubMed] [Google Scholar]
- 25.Xu J, Gong ZZ. Intron requirement for AFP gene expression in Trichoderma viride. Microbiology. 2003;149:3093–3097. doi: 10.1099/mic.0.26514-0. [DOI] [PubMed] [Google Scholar]
- 26.Hong SP, Seip J, Walters-Pollak D, Rupert R, Jackson R, Xue Z, Zhu Q. Engineering Yarrowia lipolytica to express secretory invertase with strong FBA1IN promoter. Yeast. 2012;29:59–72. doi: 10.1002/yea.1917. [DOI] [PubMed] [Google Scholar]
- 27.Hu J, Ji L. Draft genome sequences of Rhodosporidium toruloides strains ATCC 10788 and ATCC 10657 with compatible mating types. Genome Announc. 2016;4:e00098–00116. doi: 10.1128/genomeA.00098-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Paul D, Magbanua Z, Arick M, 2nd, French T, Bridges SM, Burgess SC, Lawrence ML. Genome Sequence of the Oleaginous Yeast Rhodotorula glutinis ATCC 204091. Genome Announc. 2014;2:1–2. doi: 10.1128/genomeA.00046-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Gagniuc P, Ionescu-Tirgoviste C. Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters. BMC Genom. 2012;13:512. doi: 10.1186/1471-2164-13-512. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Leavitt JM, Alper HS. Advances and current limitations in transcript-level control of gene expression. Curr Opin Biotechnol. 2015;34C:98–104. doi: 10.1016/j.copbio.2014.12.015. [DOI] [PubMed] [Google Scholar]
- 31.Juneau K, Miranda M, Hillenmeyer ME, Nislow C, Davis RW. Introns regulate RNA and protein abundance in yeast. Genetics. 2006;174:511–518. doi: 10.1534/genetics.106.058560. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Bornstein P, McKay J. The first intron of the α1 (I) collagen gene contains several transcriptional regulatory elements. J Biol Chem. 1988;263:1603–1606. [PubMed] [Google Scholar]
- 33.Aronow B, Lattier D, Silbiger R, Dusing M, Hutton J, Jones G, Stock J, McNeish J, Potter S, Witte D, Wiginton D. Evidence for a complex regulatory array in the first intron of the human adenosine deaminase gene. Genes Dev. 1989;3:1384–1400. doi: 10.1101/gad.3.9.1384. [DOI] [PubMed] [Google Scholar]
- 34.Rippe RA, Lorenzen SI, Brenner DA, Breindl M. Regulatory elements in the 5′-flanking region and the first intron contribute to transcriptional control of the mouse alpha 1 type I collagen gene. Mol Cell Biol. 1989;9:2224–2227. doi: 10.1128/MCB.9.5.2224. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Son GH, Jung H, Seong JY, Choe Y, Geum D, Kim K. Excision of the first intron from the gonadotropin-releasing hormone (GnRH) transcript serves as a key regulatory step for GnRH biosynthesis. J Biol Chem. 2003;278:18037–18044. doi: 10.1074/jbc.M209850200. [DOI] [PubMed] [Google Scholar]
- 36.Bossu JP, Chartier FL, Fruchart JC, Auwerx J, Staels B, Laine B. Two regulatory elements of similar structure and placed in tandem account for the repressive activity of the first intron of the human apolipoprotein A-II gene. Biochem J. 1996;318(Pt 2):547–553. doi: 10.1042/bj3180547. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Gallegos JE, Rose AB. The enduring mystery of intron-mediated enhancement. Plant Sci. 2015;237:8–15. doi: 10.1016/j.plantsci.2015.04.017. [DOI] [PubMed] [Google Scholar]
- 38.Lazo GR, Stein PA, Ludwig RA. A DNA transformation-competent Arabidopsis genomic library in Agrobacterium. Biotechnology (N Y) 1991;9:963–967. doi: 10.1038/nbt1091-963. [DOI] [PubMed] [Google Scholar]
- 39.Jin G, Zhang Y, Shen H, Yang X, Xie H, Zhao ZK. Fatty acid ethyl esters production in aqueous phase by the oleaginous yeast Rhodosporidium toruloides. Bioresour Technol. 2013;150:266–270. doi: 10.1016/j.biortech.2013.10.023. [DOI] [PubMed] [Google Scholar]
- 40.Meesters PA, Eggink G. Isolation and characterization of a delta-9 fatty acid desaturase gene from the oleaginous yeast Cryptococcus curvatus CBS 570. Yeast. 1996;12:723–730. doi: 10.1002/(SICI)1097-0061(19960630)12:8<723::AID-YEA963>3.0.CO;2-O. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The datasets supporting the conclusions of this article are included within the article and its additional files.
