Skip to main content
PLOS Pathogens logoLink to PLOS Pathogens
. 2016 Nov 30;12(11):e1006040. doi: 10.1371/journal.ppat.1006040

The Two-Component System ArlRS and Alterations in Metabolism Enable Staphylococcus aureus to Resist Calprotectin-Induced Manganese Starvation

Jana N Radin 1, Jessica L Kelliher 1, Paola K Párraga Solórzano 1,2, Thomas E Kehl-Fie 1,*
Editor: Michael Otto3
PMCID: PMC5130280  PMID: 27902777

Abstract

During infection the host imposes manganese and zinc starvation on invading pathogens. Despite this, Staphylococcus aureus and other successful pathogens remain capable of causing devastating disease. However, how these invaders adapt to host-imposed metal starvation and overcome nutritional immunity remains unknown. We report that ArlRS, a global staphylococcal virulence regulator, enhances the ability of S. aureus to grow in the presence of the manganese-and zinc-binding innate immune effector calprotectin. Utilization of calprotectin variants with altered metal binding properties revealed that strains lacking ArlRS are specifically more sensitive to manganese starvation. Loss of ArlRS did not alter the expression of manganese importers or prevent S. aureus from acquiring metals. It did, however, alter staphylococcal metabolism and impair the ability of S. aureus to grow on amino acids. Further studies suggested that relative to consuming glucose, the preferred carbon source of S. aureus, utilizing amino acids reduced the cellular demand for manganese. When forced to use glucose as the sole carbon source S. aureus became more sensitive to calprotectin compared to when amino acids are provided. Infection experiments utilizing wild type and calprotectin-deficient mice, which have defects in manganese sequestration, revealed that ArlRS is important for disease when manganese availability is restricted but not when this essential nutrient is freely available. In total, these results indicate that altering cellular metabolism contributes to the ability of pathogens to resist manganese starvation and that ArlRS enables S. aureus to overcome nutritional immunity by facilitating this adaptation.

Author Summary

The ubiquitous pathogen Staphylococcus aureus is a serious threat to human health due to the continued spread of antibiotic resistance. This spread has made it challenging to treat staphylococcal infections and led to the call for new approaches to treat this devastating pathogen. One approach is to disrupt the ability of S. aureus to adapt to nutrient availability during infection. During infection, the host imposes manganese and zinc starvation on invading pathogens. However, the mechanisms utilized by Staphylococcus aureus to overcome this host defense are unknown. We report that ArlRS, a global staphylococcal virulence regulator, is important for resisting manganese starvation during infection. Loss of ArlRS does not prevent S. aureus from acquiring metals but instead renders the bacterium incapable of adapting to limited manganese availability. ArlRS mutants also have metabolic defects and a reduced ability to grow on amino acids. When using glucose as a carbon source S. aureus is more sensitive to manganese starvation and increases the expression of manganese transporters relative to when amino acids are provided suggesting a higher demand for manganese. These observations indicate that ArlRS contributes to resisting nutritional immunity by altering metabolism to reduce the staphylococcal demand for manganese.

Introduction

Staphylococcus aureus is a ubiquitous pathogen that colonizes 30% of the population at any given time and can infect virtually every human tissue [1]. These facts and the continued spread of antibiotic resistance have led both the Centers for Disease Control and the World Health Organization to state that S. aureus poses a serious threat to human health [2, 3]. Both organizations have highlighted the need to identify new strategies for treating S. aureus and bacterial infections in general. Elucidating how pathogens overcome nutritional immunity, a critical component of the immune response in which the host restricts essential nutrients from the invading pathogen, has the potential to address this need.

Transition metals such as iron (Fe), manganese (Mn) and zinc (Zn) are essential for virtually all forms of life. Their importance is emphasized by the prediction that 30% of all enzymes interact with a metal cofactor [4, 5]. During infection, invading microorganisms must acquire all of their nutrients from the host. Vertebrates take advantage of this fact and combat invading pathogens by restricting the availability of essential metals [6, 7]. While the most well characterized aspect of nutritional immunity is the Fe-withholding response, it has recently become apparent that the host also restricts access to Mn and Zn during infection [712]. The prototypic example of Mn and Zn restriction is the staphylococcal abscess, which is rendered devoid of these two essential metals [8, 13]. This depletion starves S. aureus for these metals resulting in the inactivation of metal-dependent enzymes, such as the staphylococcal superoxide dismutases [8, 9]. A critical component of this withholding response is the Mn- and Zn-binding protein calprotectin (CP). CP comprises ~50% of the cytosolic protein in neutrophils and at sites of infection it can reach concentrations in excess of 1 mg/ml [14, 15]. Mice lacking CP have defects in metal sequestration and are more susceptible to a range of bacterial and fungal pathogens, including S. aureus, Acinetobacter baumannii, Klebsiella pneumoniae, and Candida albicans [8, 9, 1619].

CP, a member of the S100 family of proteins, is a heterodimer comprised of S100A8 and S100A9 (also known as calgranulin A/calgranulin B and MRP8/MRP14), and has two transition metal-binding sites [9, 20]. The first site, known as the Mn/Zn site, is capable of binding either Mn or Zn with nanomolar and picomolar affinities (Kd), respectively [9, 2022]. The second site, known as the Zn site, binds Zn with picomolar affinity [9, 2123]. CP exerts antimicrobial activity against a variety of bacterial and fungal pathogens in vitro, including S. aureus, by starving them for metals [8, 9, 1619]. While the sequestration of both Mn and Zn contributes to the antimicrobial activity of CP, the Mn/Zn site is necessary for maximal antimicrobial activity by CP against a wide range of Gram-positive and Gram-negative pathogens including S. aureus [21].

The ability of S. aureus and other successful pathogens to cause disease indicates that they possess adaptations that allow them to minimize and overcome host-imposed Mn and Zn starvation. One mechanism employed by pathogens to cope with nutrient limitation is the expression of dedicated high-affinity acquisition systems. Mn and Zn import systems that contribute to pathogenesis are found in numerous pathogens including: S. aureus, Brucella abortus, Campylobacter jejuni, Salmonella enterica, Yersinia pestis, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus suis and A. baumannii [6, 2434]. S. aureus expresses two dedicated Mn import systems: MntH, an NRAMP family member, and MntABC, an ABC-type transporter [13, 31, 35]. In S. aureus, MntH is constitutively expressed, while MntABC is induced by Mn limitation [13, 31]. High-affinity Mn acquisition systems play a critical role in resisting Mn starvation during infection, and staphylococcal mutants lacking these systems are attenuated in several models of infection [13, 31, 36]. The virulence defect of a staphylococcal mutant lacking both Mn importers is reversed in CP-deficient mice, indicating that these systems specifically contribute to resisting host-imposed Mn starvation [13]. The ability of a mutant lacking dedicated Mn importers to cause comparable disease to wild type bacteria when Mn is not limited also highlights the critical importance of Mn sequestration to host defense.

While high-affinity metal acquisition systems contribute to infection, they do not prevent the host from imposing Mn starvation. This is evident by the increased bacterial burdens observed in CP-deficient mice and by inhibition of staphylococcal SOD activity during infection [8, 9]. S. aureus and other pathogens are able to successfully cause infection despite experiencing Mn and Zn starvation, thus they must possess additional adaptations that allow them to resist nutritional immunity. In this study, we identified the S. aureus two-component signal transduction system ArlRS as an important factor in resisting CP-imposed Mn starvation. Infection studies using wild type and CP-deficient mice revealed that ArlRS is necessary for establishing invasive S. aureus infection and resisting Mn starvation in vivo. Additionally, we discovered that S. aureus is more sensitive to Mn starvation when using glucose as a carbon source as compared to when amino acids are provided. Furthermore, ArlRS appears to play a critical role in facilitating the use of amino acids as a carbon source. These results indicate that altering core metabolic pathways is critical to overcoming host-imposed metal starvation.

Results

The S. aureus two-component system ArlRS promotes resistance to host-imposed manganese starvation

S. aureus experiences Mn and Zn starvation during infection, yet it is still able to successfully cause infection. This fact indicates that S. aureus possesses adaptations that allow it to overcome this host defense. To identify the factors that allow S. aureus to resist Mn and Zn starvation during infection, a transposon library was screened for mutants with enhanced sensitivity to CP. This screen identified a mutant that has an insertion in arlRS (arlRS:erm), which is more sensitive to CP than wild type S. aureus (Fig 1A). ArlRS is a two-component system and global virulence regulator that influences many staphylococcal processes, including autolysis, toxin expression, surface protein expression and biofilm formation [3740]. As with most two-component systems, the signal sensed by ArlS is currently unknown. Subsequent assays using an ArlRS deletion mutant (ΔarlRS) and an arlR insertion mutant (arlR:erm) created in S. aureus Newman produced similar results to those obtained with the transposon mutant (Figs 1B and S1A). Similar to what was observed by Walker and colleagues, loss of ArlRS did not impact hla expression or hemolysis on blood agar plates [40] (S1B Fig). Expressing ArlRS from a plasmid reversed the increased sensitivity of ΔarlRS to CP (Fig 1C). Increased sensitivity to CP was also observed in arlR:erm derivatives of the community-acquired MRSA strain USA300 (JE2) as well as the methicillin-sensitive strain SH1000 (Fig 1D and 1E). In total, these results indicate that ArlRS promotes resistance to host-imposed metal starvation in both methicillin-sensitive and methicillin-resistant strains of S. aureus.

Fig 1. The S. aureus two-component system ArlRS plays a role in resisting calprotectin-imposed Mn starvation.

Fig 1

Growth assays were performed in rich medium in the presence of increasing concentrations of CP for (A) WT (Newman) and the arlRS:erm derivative (Tn 917 transposon mutant), (B) WT (Newman), ΔarlRS and arlR:erm derivatives, (C) WT (Newman) and ΔarlRS containing either pOS1 plgt or pOS1 plgt:arlRS, (D) WT (USA300) and the arlR:erm derivative and (E) WT (SH1000) and the arlR:erm derivative. (F) Growth of WT S. aureus (Newman) and ΔarlRS, pre-cultured in NRPMI, in the presence of 480 μg/ml of WT CP, as well as the ΔMn/Zn, ΔZn and ΔMn/ZnΔZn site mutants. * = p≤0.05 by two-way ANOVA with Tukey’s posttests of selected means. n≥3. Error bars indicate SD. See also S1 Fig.

CP sequesters both Mn and Zn preventing the individual impact of withholding either metal from being evaluated with wild type protein. To circumvent this issue, the sensitivity of ΔarlRS to a series of engineered CP variants with altered metal-binding properties was assessed [9, 21]. Specifically, CP variants lacking the Mn/Zn site (ΔMn/Zn), the Zn site (ΔZn), or both sites (ΔMn/ZnΔZn) were utilized. When incubated with the ΔMn/ZnΔZn double site mutant, which cannot bind Mn or Zn, ΔarlRS grew as well as wild type (Figs 1F and S1C). This result confirms that the increased sensitivity of ΔarlRS to CP is due to an inability to cope with either Mn or Zn starvation. Similar to WT CP, ΔarlRS was more sensitive than wild type bacteria to the ΔZn site mutant, which can bind either Mn or Zn. However, the increased sensitivity of ΔarlRS was almost completely abrogated when grown in the presence of the ΔMn/Zn mutant, which can only bind Zn (Figs 1F and S1C). These results indicate that loss of ArlRS impairs the ability of S. aureus to cope with host-imposed Mn starvation.

Autolysis does not contribute to the increased sensitivity to metal starvation

ArlRS has been shown to repress expression of the staphylococcal autolysins LytM, LytN and Atl. As a result, loss of ArlRS can result in increased autolysis of methicillin-sensitive strains of S. aureus [38, 39, 41]. As such, cell lysis could potentially explain the enhanced sensitivity of ΔarlRS to CP. Previous studies revealed that the increased autolysis of strains lacking ArlRS can be reversed by individually deleting Atl or LytM in the ΔarlRS mutant background [41]. To determine if the diminished ability of ΔarlRS to resist Mn limitation is the result of increased autolysis, ΔarlRS lytM:erm, ΔarlRS atl:erm and ΔarlRS lytN:erm double mutants were assessed for CP sensitivity. Loss of LytM, LytN or Atl did not diminish the sensitivity of ΔarlRS to CP (Fig 2A). Control experiments revealed that loss of Atl, LytM, or LytN alone did not alter the sensitivity of S. aureus to CP (Fig 2B). These results indicate that increased sensitivity to CP of strains lacking ArlRS is not a result of increased autolysis. This idea is further supported by the increased sensitivity of the USA300 (JE2) arlR:erm mutant to CP (Fig 1D), as loss of ArlRS does not result in increased autolysis of methicillin-resistant isolates [41]. Cumulatively, these results indicate that increased autolysis does not contribute to the diminished ability of strains lacking ArlRS to resist Mn starvation.

Fig 2. Autolysis does not contribute to increased sensitivity to metal starvation.

Fig 2

The growth of (A) WT (Newman), ΔarlRS, ΔarlRS/lytM:erm, ΔarlRS/atl:erm and ΔarlRS/lytN:erm and (B) WT (Newman), lytM:erm, atl:erm, and lytN:erm were assessed in rich medium in the presence of increasing concentrations of CP. * = p≤0.05 by two-way ANOVA with Tukey’s posttests of selected means. n≥3. Error bars indicate SD.

Loss of ArlRS does not reduce the ability of S. aureus to obtain Mn and Zn

Previous work demonstrated that loss of MntABC and MntH renders S. aureus twice as sensitive to CP as wild type bacteria [13]. Initially, to determine if the increased sensitivity of strains lacking ArlRS is due to decreased expression of Mn importers, the transcript levels of mntA and mntH were assessed by qRT-PCR. Following growth in metal-replete medium, wild type and ΔarlRS expressed comparable levels of both mntA and mntH (Fig 3A). Consistent with previous studies, CP treatment significantly increased mntA transcript levels in wild type bacteria (Fig 3A) [13]. CP also increased mntA expression in the strain lacking ArlRS, suggesting that the increased sensitivity of ΔarlRS is not due to reduced expression of Mn importers. We also assessed the impact that loss of ArlR had on a strain lacking the Mn importers (ΔmntCΔmntH arlR:erm) to grow in the presence of CP. As before, the arlR:erm mutant was more sensitive to CP treatment than wild type bacteria (Figs 3B and S2). However, loss of ArlR in the ΔmntCΔmntH mutant background further increased sensitivity of the transporter double mutant to CP, suggesting that ArlRS and the Mn transporters function independently to promote resistance to Mn starvation. To further evaluate if loss of ArlRS impacts the ability of S. aureus to acquire Mn or Zn, intracellular metal levels in wild type and ΔarlRS were directly assessed using inductively coupled plasma optical emission spectrometry (ICP-OES). This analysis revealed that loss of ArlRS does not impair Mn or Zn acquisition in the absence of CP (Fig 3C), as intracellular metal levels were the same in wild type bacteria and in ΔarlRS. In the presence of CP both WT and ΔarlRS had reduced levels of intracellular Mn (Fig 3C). No reduction in intracellular Zn or Fe were observed in the presence of CP. This observation is consistent with prior studies, which indicated that Mn binding is necessary for maximal antimicrobial activity [21]. Combined, these results indicate that a defect in metal acquisition is not responsible for the increased sensitivity of ΔarlRS to host-imposed metal starvation, suggesting that loss of ArlRS prevents S. aureus from adapting to limited Mn availability.

Fig 3. Loss of ArlRS does not alter Mn and Zn import.

Fig 3

WT S. aureus (Newman) and ΔarlRS were grown in rich medium in the presence and absence of 240 μg/ml of CP. (A) Transcript levels of mntA and mntH were assessed by qRT-PCR. Expression was compared to wild type bacteria grown in the absence of CP. * = p≤0.05 by two-way ANOVA on log-transformed values with Sidak’s multiple comparisons test. n≥3. (B) WT S. aureus (Newman), arlR:erm, ΔmntC ΔmntH and ΔmntC ΔmntH arlR:erm were grown in the presence of increasing concentrations of CP. * = p≤0.05 by two-way ANOVA with Tukey’s posttests of selected means. n≥3. Strains are normalized to growth of parental strains, i.e., arlR:erm is normalized to WT and ΔmntC ΔmntH arlR:erm is normalized to ΔmntC ΔmntH. (C) Intracellular Mn, Zn and Fe levels were determined by ICP-OES. * = p≤0.05 by Student’s t-test. n≥3 Error bars indicate SD. See also S2 Fig.

ArlRS is necessary for establishing invasive S. aureus disease and resisting Mn starvation during infection

ArlRS contributes to hematogenous pyelonephritis and endocarditis in mouse and rabbit models of infection [39, 40, 42]. To determine whether ArlRS also contributes to systemic infection, wild type (C57BL/6) mice were retro-orbitally infected with wild type S. aureus Newman or ΔarlRS. During the course of the infection mice infected with ΔarlRS lost significantly less weight than mice infected with wild type S. aureus (Figs 4A and S3A). Consistent with the weight loss, the ΔarlRS mutant had significantly diminished bacterial burdens in the liver, heart, and kidneys when compared to wild type bacteria (Fig 4B and 4C) indicating that ArlRS plays an important role in establishing systemic disease. To evaluate the contribution of ArlRS to resisting Mn starvation during infection, CP-deficient (C57BL/6 S100A9-/-) mice, which do not remove Mn from liver abscesses [8, 13], were infected with wild type bacteria and ΔarlRS. Compared to C57BL/6 mice, the CP-deficient mice infected with ΔarlRS lost significantly more weight (Figs 4A, S3B and S3C). The CP-deficient mice infected with ΔarlRS also had increased bacterial burdens in the liver when compared to wild type C57BL/6 mice. Notably, despite the substantial virulence defect of the mutant in wild type mice, there was only a minimal difference between wild type S. aureus and ΔarlRS in the livers of CP-deficient mice (less than half a log difference vs. a 4 log difference). These results indicate that ArlRS contributes to systemic disease and that this two-component system is critical for resisting host-imposed Mn starvation during infection.

Fig 4. ArlRS is necessary for establishing invasive S. aureus infection and for resisting Mn sequestration during infection.

Fig 4

Wild type C57BL/6 (C57) and CP-deficient C57BL/6 S100A9-/- (CP-/-) mice were infected with either S. aureus Newman (wild type) or ΔarlRS and (A) mean weight loss and (B-C) bacterial burdens in the (B) liver and (C) heart and kidneys were assessed after four days of infection. (A) See S3 Fig for pair wise comparisons that include error bars. * = p≤ 0.05 relative to C57BL/6 mice infected with wild type S. aureus and # = p≤ 0.05 relative to C57BL/6 mice infected with ΔarlRS by two-way ANOVA with Tukey’s posttest corrected for repeated measurements. (B-C) * = p≤0.05 as determined by Mann-Whitney test. The lines indicate the mean. The data are the results from three independent experiments. See also S3 Fig.

Alteration in carbon source utilization promotes resistance to Mn starvation

While the results so far demonstrate that ArlRS contributes to resisting host-imposed Mn starvation both in culture and during infection, the underlying mechanism is not apparent. ArlRS is a global regulator that is involved in many cellular processes including virulence factor gene regulation [3739]. It is unlikely that the regulation of toxins and other virulence factors whose targets are absent in media would have an effect on resisting metal limitation in culture. In addition to controlling virulence factor expression, ArlRS negatively regulates the expression of genes encoding for several phosphotransferase systems (PTS) and positively regulates the expression of enzymes potentially involved in amino acid utilization [39]. This includes a locus that encodes for a putative alanine dehydrogenase, threonine/serine deaminase, and amino acid importer. This locus is induced upon exposure to CP and this induction is dependent on ArlRS (Fig 5). Glucose and other sugars are the preferred carbon source utilized by S. aureus and many other bacteria to generate energy [43, 44]; however, energy can also be generated using amino acids. While the metal dependency of glycolytic enzymes in S. aureus is unknown, Mn is a critical cofactor involved in sugar utilization by both Bradyrhizobium and S. pneumoniae [45, 46]. In contrast to sugars, amino acids can bypass the potentially Mn-dependent steps of glycolysis by being directly converted to pyruvate or TCA cycle intermediates [44, 47, 48]. Cumulatively, these observations lead to the hypothesis that Mn and Zn starvation may impair glycolysis. Furthermore, they suggest that the carbon source utilized could impact staphylococcal CP sensitivity and that ArlRS contributes to resisting Mn limitation by shifting S. aureus away from using sugars as an energy source to amino acids. If this hypothesis is correct, S. aureus would be expected to be more resistant to CP-induced Mn sequestration when using amino acids as opposed to glucose as a carbon source. Furthermore, loss of ArlRS would be expected to reduce the ability of S. aureus to grow when amino acids are provided as the sole carbon source and alter staphylococcal metabolism when both nutrient types are present.

Fig 5. ArlRS enhances gene expression in response to calprotectin.

Fig 5

WT S. aureus (Newman) and ΔarlRS were grown in rich medium in the presence and absence of 240 μg/ml of CP and transcript levels of the threonine/serine deaminase (NWMN_1348) was assessed by qRT-PCR. Expression was compared to wild type bacteria grown in the absence of CP. * = p≤0.05 by one-way ANOVA with Sidak’s multiple comparisons test. Error bars indicate SD. n≥3.

To test this hypothesis, a defined medium compatible with CP growth assays, which allows the carbon source to be altered, was developed (Fig 6A). This medium was then used to assess the sensitivity of S. aureus to CP when glucose or casamino acids were provided as the sole energy source. These assays revealed that S. aureus Newman is more sensitive to CP when glucose was provided as the sole carbon source compared to bacteria using casamino acids (Figs 6B and S4A). Similar results were also observed when a defined medium containing purified amino acids as an energy source was used (S4B Fig). USA300 (JE2) was also more sensitive to CP when only glucose was available as a carbon source. (Figs 6C and S4C). To determine whether the increased sensitivity of S. aureus to CP when glucose is used as a carbon source is dependent on Mn or Zn sequestration, the experiment was also performed with the ΔMn/Zn and ΔZn site mutants. While decreased growth in glucose-containing medium was observed when bacteria were growing in the presence of the ΔZn mutant (binds both Mn and Zn), growth in the presence of the ΔMn/Zn mutant (binds only Zn) was comparable to that of growth in medium containing amino acids, meaning that no growth defect was observed (Fig 6D). Additionally, the addition of excess Mn to glucose-containing medium reversed the phenotype (Fig 6E). Combined, these results suggest that Mn sequestration is responsible for the reduced ability of S. aureus to grow in glucose-containing medium in the presence of CP. If using glucose as a carbon source requires more Mn than amino acids, mntA expression would be expected to be higher in medium containing only glucose as an energy source relative to medium containing amino acids when Mn availability is restricted. Consistent with our hypothesis, mntA levels increased in the presence of intermediate concentrations of CP, but not in Mn-replete medium, when bacteria were grown in the presence of glucose but not in amino acids (Fig 6F). Cumulatively, these results indicate that utilizing glucose as carbon source increases the cellular demand for Mn when compared to when amino acids are used. Vitko et al. have previously shown that lactate is produced when bacteria are grown in glucose-containing medium but not when they are grown in amino acid-containing medium [49]. When Newman and USA300 (JE2) were grown in medium containing both glucose and amino acids in the presence of CP, lactate production decreased with increasing CP concentrations (Fig 6G and 6H). This observation is consistent with the idea that S. aureus shifts away from utilizing glucose as a carbon source when Mn is limiting and that utilizing amino acids as a carbon source minimizes the cellular demand for this metal.

Fig 6. Alteration in carbon source utilization promotes resistance to Mn starvation.

Fig 6

(A) Growth of S. aureus WT (Newman) and ΔarlRS in defined medium lacking a carbon source (DM) and medium supplemented with glucose (glc) or casamino acids (AA). (B-D) Growth assays were performed in defined medium containing either glucose (glc) or casamino acids (AA) as the sole carbon source in the presence of increasing concentrations of CP for (B) Newman, (C) USA300 (JE2), and (D) Newman with 120 μg/ml of WT CP, the ΔMn/Zn mutant or the ΔZn mutant. * = p≤0.05 by two-way ANOVA with Bonferroni’s posttest corrected for repeated measurements. n≥3. (E) WT (Newman) was grown in defined medium containing either glucose (glc) or casamino acids (AA) as a carbon source in the presence and absence of 120 μg/ml of CP and in the presence and absence of 500 μM MnCl2. (F) WT (Newman) was grown in defined medium containing either glucose (glc) or casamino acids (AA) as a carbon source in the presence and absence of 120 μg/ml of CP and transcript levels of mntA were assessed by qRT-PCR. Expression was compared to wild type bacteria grown in glucose-containing medium in the absence of CP. * = p≤0.05 by one-way ANOVA on log-transformed values with Dunnett’s multiple comparisons test. n≥3. L-Lactate production was measured for bacteria pre-cultured in NRPMI and assayed in defined medium containing both glucose and casamino acids in the presence of increasing concentrations of CP for (G) WT (Newman) and ΔarlRS and (H) WT (USA300 (JE2)) and arlR:erm. ND = not determined due to insufficient growth. * = p≤0.05 by one-way ANOVA on log-transformed values with Dunnett’s multiple comparisons test. n≥3. Error bars indicate SD for all panels except panels G and H, in which error bars indicate SEM. See also S4 Fig.

Next, the ability of ArlRS mutants to utilize amino acids as an energy source was assessed. Analysis of the ΔarlRS derivative of Newman revealed that this strain was severely delayed in growth when utilizing amino acids as a sole carbon source (Figs 6A and S4D), suggesting a role for ArlRS in amino acid utilization. More modest but still significant reductions were also observed with arlR:erm derivatives of S. aureus USA300 (JE2) and SH1000 when only amino acids were provided as an energy source (S4E and S4F Fig). To evaluate if loss of ArlRS alters staphylococcal metabolism, the production of lactate was assessed in the ΔarlRS and arlR:erm derivatives of Newman and USA300 (JE2) following growth in the presence and absence of CP (S4G–S4J Fig). Both of the mutants had decreased lactate production relative to the parent strain regardless of CP treatment. Notably, differing from wild type, the strains lacking ArlRS did not reduce their production of lactate at inhibitory concentrations of CP (Fig 6G and 6H). In conjunction with the growth phenotypes, these results suggest that loss of ArlRS disrupts staphylococcal metabolism and results in reduced growth in the presence of amino acids as a carbon source. Combined, these results support the idea that switching from utilizing sugars to amino acids as an energy source reduces the staphylococcal demand for Mn enhancing the ability of S. aureus to resist host-imposed metal starvation. They also suggest that ArlRS critically contributes to this process.

Discussion

Transition metals such as Fe, Mn and Zn are important for virtually all forms of life, as they are involved in numerous biological processes ranging from metabolism to regulation of virulence factor expression [46, 50]. To combat invaders, the host takes advantage of this essentiality by starving invaders for these metals. Recent work has revealed that in addition to restricting Fe availability, the essential transition metals Mn and Zn are also withheld by the host. Despite expressing high-affinity Mn acquisition systems, S. aureus, and presumably other successful pathogens, experience metal starvation during infection [8, 9]. However, the adaptations that allow pathogens to overcome host-imposed Mn and Zn starvation are unknown. The investigations in this study revealed that to successfully cope with host-imposed Mn starvation, S. aureus must alter core metabolic pathways. Previous studies have emphasized the importance of sugar consumption and fermentation to staphylococcal virulence [49, 5154]. These obsevations include the finding that the catabolite control protein (CcpA), which promotes the consumption of sugars, and an expanded repertoire of glucose importers enhances the ability of S. aureus to cause disease [53, 54]. At the same time other studies sugest that uptake of amino acids facilitate the development of staphylococal disease [55]. In this study, we found that when bacteria encounter Mn starvation the presence of amino acids enhances the growth of the bacterium. These prior observations in conjunction with the current results emphasize the dynamic nature of sites of infection and further highlight the important contribution of metabolic plasticity to staphylococcal virulence and bacterial pathogenesis in general [49, 51, 52, 56, 57]. This work also revealed that the two-component system ArlRS enhances the ability of S. aureus to grow when amino acids are available as a sole carbon source and contributes to the ability of S. aureus to resist host-imposed Mn starvation during infection. This observation significantly expands the contribution of this two-component system to staphylococcal disease, which is canonically associated with regulation of toxin production and biofilm formation [3740].

Recently, CP has been reported to bind Fe (II) with high affinity leading to the suggestion that the antimicrobial activity of the protein is derived from the ability to bind Fe, not Mn [58]. However, consistent with prior studies of A. baumannii [19], analysis of metal levels in S. aureus revealed that CP does not reduce intracellular Fe levels (Fig 3C). In contrast, in both S. aureus and A. baumannii CP reduced the accumulation of Mn [19]. These results suggest, at least for these two pathogens, that Fe sequestration is not a major contributor to the antimicrobial activity of CP. Additionally, the virulence defects in wild type mice of staphylococcal ΔmntCΔmntH and ΔarlRS mutants, which are more sensitive to Mn starvation in culture, are reversed in CP-deficient mice [13]. These results, in conjunction with the inhibition of Mn-dependent enzymes during infection [9], further support the body of work indicating that Mn sequestration by CP contributes to host defense.

Canonically, glycolysis is thought to be a magnesium-dependent process. However, many bacteria contain a Mn-dependent isoform of phosphoglycerate mutase and other glycolytic enzymes such as enolase and pyruvate kinase that are either dependent on Mn or are highly activated by small amounts of Mn [24]. The increased sensitivity of S. aureus to Mn starvation when only glucose is available as a carbon source suggests that at least one essential step in glycolysis is dependent on Mn. This observation adds S. aureus to the growing list of organisms, including S. pneumoniae and Bradyrhizobium japoincum, which are dependent on Mn in order to consume glucose [45, 46]. The presence of Mn-utilizing glycolytic enzymes in a variety of microbes and the dependency of glycolysis in some pathogens on this metal suggests that host-imposed Mn starvation may also impede the ability of other pathogens to utilize sugars as an energy source.

The Fe-sparing response, the repression of Fe-rich enzymes when the availability of this metal is limited, enhances the ability of bacteria to grow in Fe-poor environments. This response allows bacteria to prioritize the usage of Fe by reducing the production of non-essential Fe-dependent proteins thereby preserving the limited quantity of available Fe for essential functions [59, 60]. The preferred carbon source of S. aureus and many other bacteria is glucose [43, 44]; however, energy can also be generated by utilizing amino acids. As such, glucose utilization is not strictly essential in S. aureus. In contrast to glycolysis, which can require Mn, the degradation of amino acids (e.g., alanine, serine and threonine) utilizes enzymes that do not employ this metal as a cofactor [44, 47, 48]. This observation suggests that relative to utilizing sugars, amino acid consumption should decrease the cellular demand for Mn, increasing the availability of this metal for essential Mn-dependent enzymes (Fig 7). Both the reduced expression of mntABC in Mn-limited medium when S. aureus is utilizing amino acids vs. glucose as a carbon source and the observation that growth on amino acids diminished staphylococcal sensitivity to Mn starvation support this idea. The latter observation suggests that consumption of amino acids instead of sugars is functionally a Mn-sparing response analogous to that of Fe. At higher concentrations of CP, S. aureus is equally sensitive to metal limitation regardless of whether the bacteria were grown in glucose- or amino acid-containing medium. Inhibition of Mn-dependent processes, which cannot be circumvented by switching carbon source utilization, could explain this observation. In response to Mn limitation, S. pneumoniae also downregulates glycolytic enzymes and increases the expression of amino acid utilization genes [46]. This observation and the current studies suggest that switching from utilizing sugars to amino acids is likely a conserved response to host-imposed Mn starvation.

Fig 7. Working model of how calprotectin impacts staphylococcal metabolism and the contribution of ArlRS to resisting Mn limitation.

Fig 7

In manganese (Mn)-replete environments (A) sugars serve as the primary energy source for S. aureus. However, in Mn-poor environments (B), such as in the presence of the Mn-binding protein calprotectin (CP), glycolysis is inhibited. ArlRS appears to enhance the ability of S. aureus to resist Mn limitation in part by increasing amino acid (AA) catabolic pathways and reducing the expression of alternative sugar importers.

While the utilization of amino acids as an energy source reduces the cellular demand for Mn, in most bacteria, including S. aureus, catabolite repression prevents them from utilizing non-preferred carbon sources, such as amino acids, when a preferred carbon source is present [61, 62]. ArlRS represses the expression of alternative sugar uptake systems and stimulates the expression of genes encoding for enzymes involved in amino acid utilization [39]. As such, ArlRS provides a mechanism by which S. aureus can override the normal carbon source preference of the cell. In response to CP, ArlRS positively regulates the expression of proteins predicted to be involved in the catabolism of alanine and serine. Differing from Liang et al, loss of ArlRS did not impact the expression of these proteins in the absence of CP. This difference can likely be explained by differences in growth conditions. These two amino acids can be converted directly to pyruvate, bypassing any metal-dependent enzymes in glycolysis [39, 44, 47, 48]. Notably, a global screen for staphylococcal factors that contribute to abscess formation identified alanine and serine importers as contributing to the ability of S. aureus to cause disease [55]. As with most two-component systems, the signal sensed by ArlS is currently unknown. The necessity of ArlRS to resist Mn starvation suggests that Mn availability alters the activity of this system. ArlRS may respond directly to Mn availability or indirectly by sensing a disruption of glycolysis or other Mn-dependent processes induced by Mn limitation. However, additional experimentation is necessary to evaluate this possibility.

ArlRS contributes to the ability of S. aureus to cause disease in several models of infection [42]. In addition to regulating metabolic processes, ArlRS increase the production of surface proteins and influences the expression of numerous virulence factors, biofilm formation, as well as autolysis and cell growth. It also directly and/or indirectly interacts with other regulators [37, 39]. Thus, a reduced ability to grow on amino acids may not be the only factor that contributes to the diminished ability of strains lacking ArlRS to resist CP. As ArlRS regulates the expression of other staphylococcal regulators, including Agr, LytSR, MgrA and Rot, the factors that are directly vs. indirectly regulated by this system are unknown [3739]. While the direct targets are unknown, it does link Mn availability to virulence factor expression. Even though the benefit to S. aureus of co-regulating presumably Mn-independent virulence factors is not immediately apparent, this does appear to be a common theme amongst bacterial pathogens. In Borrelia burgdoferi, Mn influences BosR expression, which in turn regulates expression of the alternative sigma factor, RpoS. This alternative sigma factor facilitates the adaptation of B. burgdoferi to the mammalian host [63]. S. pneumoniae uses the Mn-responsive regulator PsaR to regulate the expression of adhesins [6467].

Due to the continued emergence of antibiotic resistance, bacterial pathogens remain a serious threat to human health. The current study provides new insight into the mechanisms utilized by pathogens to overcome nutritional immunity. It suggests that alterations in carbon source utilization and reducing the cellular demand for Mn is important for resisting host-imposed Mn starvation. These results significantly broaden our understanding of how bacteria overcome nutritional immunity. The continued study of this bacterial response and the associated metabolic changes has the potential to identify new opportunities for therapeutic intervention.

Materials and Methods

Ethics statement

All experiments involving animals were reviewed and approved by the Institutional Animal Care and Use Committee of the University of Illinois Urbana-Champaign (IACUC license number 15059) and performed according to NIH guidelines, the Animal Welfare Act, and US Federal law.

Bacterial strains

For routine overnight cultures, bacteria were grown in 5 ml of tryptic soy broth (TSB) or Chelex-treated RPMI plus 1% Casamino acids (NRPMI) supplemented with 1 mM MgCl2, 100 μM CaCl2 and 1 μM FeCl2 [13] in 15 ml conical tubes at 37°C on a roller drum. As needed, 10 μg/ml of chloramaphenicol was added for plasmid maintenance. S. aureus strain Newman and its derivatives were used for all of the experiments, unless otherwise indicated. For experiments using USA300 (JE2) and derivatives (USA300 (JE2) arlR:erm, USA300 (JE2) lytM:erm, USA300 (JE2) lytN:erm and USA300 (JE2) atl:erm), strains were obtained from the Nebraska library [68]. Newman ΔarlRS was generated by amplifying the 5’ and 3’ flanking regions (~1 Kb up- and downstream) of arlRS using the indicated primers (Table 1). 5’ and 3’ fragments were cloned into the pKOR1 knockout vector via site-specific recombination. The deletions were created using allelic replacement, as described previously [69]. All constructs were verified by sequencing and all mutant strains were confirmed to be hemolytic by growth on TSA blood agar plates. To generate constructs for complementation studies, the arlRS coding sequence was amplified with the indicated primers (Table 1) and cloned into the pOS1 vector under the control of the Plgt promoter. The lytM, atl and lytN mutants in Newman and Newman ΔarlRS and arlR mutants in SH1000, Newman and Newman ΔmntCΔmntH were constructed by transducing the lytM:erm, atl:erm, lytN:erm and arlR:erm alleles via Φ85 phage from USA300 (JE2) lytM:erm, USA300 (JE2) atl:erm, USA300 (JE2) lytN:erm and USA300 (JE2) arlR:erm.

Table 1. PCR primers used in this study.

Name Sequence
ArlRS K/O 3’ Fwd GGGGACAAGTTTGTACAAAAAAGCAGGCTCGTAATAGTACGTTGTAACATCGGTACAAGTGC
ArlRS K/O 3’ Rev GGTGTACAAATGACGCAAATATTTTAATCATGACTGAGACGT CAATCAAAGTCATAGG
ArlRS K/O 5’ Fwd CAGTCATGATTAAAATATTTGCGTCATTTGTACACCTCATATTACG
ArlRS K/O 5’ Rev GGGGACTTTGTACAAGAAAGCTGGGTCGATAGAGAAAGACC TACATTGCTGCG
ArlRS 5’ Comp AGTCCATATGACGCAAATTTTAATAGTAGAAGATGAAC
ArlRS 3' Comp AGTCGGATCCTTAAAATATGATTTTAAACGTTGTTCCTTTG
16S rRNA-F GCTGCAGCTAACGCATTAAGCACT
16S rRNA-R TTAAACCACATGCTCCACCGCTTG
MntA RT Left TCTAGATGAGCCGTTTGTCG
MntA RT Right GCTTTTGATAGATCATGGTGGA
MntH RT Left AATTCGATCATCGCAGTTCA
MntH RT Right GCCACCTTGCATTGATGTTA
NWMN_1348 Fwd GAACCATGCACAAGGTGTTG
NWMN_1348 Rev ATAACCTTTGCCCCATAGCC
hla F CTGAAGGCCAGGCTAAACCACTTT
hla R GAACGAAAGGTACCATTGCTGGTCA

CP growth assays

CP growth assays were performed, as described previously [9, 21]. Briefly, overnight cultures were back-diluted 1:50 into fresh TSB (5 ml in a 15 ml conical tube) and grown for 1 h at 37°C on a roller drum. The cultures were then diluted 1:100 into 96-well round-bottom plates containing 100 μl of growth medium (38% TSB and 62% calprotectin buffer (20 mM Tris pH 7.5, 100 mM NaCl, 3 mM CaCl2, 10 mM β-mercaptoethanol)) in presence of varying concentrations of CP. The growth medium was supplemented with 1 μM MnCl2 and 1 μM ZnSO4 except for assays with the Newman arlRS:erm transposon mutant. For all assays, the bacteria were incubated with orbital shaking (180 RPM) at 37°C and growth was measured by assessing optical density (OD600) every 2 hours. Prior to measuring optical density, the 96-well plates were vortexed. For CP growth assays using defined medium, a medium based on the one previously reported by Richardson et al. [51] was used. For these assays, the preculture was the same as a growth assay using TSB in the growth medium. The growth medium for assays using defined medium consisted of 38% medium and 62% CP buffer (20 mM Tris pH 7.5, 100 mM NaCl, 1 mM CaCl2, 10 mM β-mercaptoethanol). The defined medium (2.6X) consisted of 0.5 g/L NaCl, 1.0 g/L NH4Cl, 2.0 g/L KH2PO4, 7.0 g/L Na2HPO4, 0.228 g/L biotin, 0.228 mg/L nicotinic acid, 0.228 mg/L pyridoxine-HCl, 0.228 mg/L thiamine-HCl, 0.114 mg/L riboflavin, 0.684 mg/L calcium pantothenate, 0.104 g/L phenylalanine. 0.078 g/L lysine, 0.182 g/L methionine, 0.078 g/L histidine, 0.026 g/L tryptophan, 0.234 g/L leucine, 0.234 g/L aspartic acid, 0.182 g/L arginine, 0.078 g/L serine, 0.15 g/L alanine, 0.078 g/L threonine, 0.130 g/L glycine, 0.208 g/L valine and 0.026 g/L proline. The defined medium was then supplemented with 6 mM MgSO4, 1 μM FeCl2, 1 μM MnCl2 and 1 μM ZnSO4. Casamino acids (6.5%), glucose (1.3%) or glucose (1.3%) and 18 amino acids (1 mM alanine, serine, threonine, lysine, asparagine, glutamic acid, isoleucine, arginine, histidine, methionine, valine, proline, cystidine, glycine, phenylalanine, tyrosine, leucine and tryptophan) were provided as carbon sources as indicated. In the figures, “DM” refers to defined medium without a carbon source, “glc” refers to defined medium with glucose as a carbon source, “AA” refers to defined medium with casamino acids as a carbon source and “glc+18AA” refers to glucose and 18 amino acids as a carbon source. For complementation experiments, overnight cultures were back-diluted 1:50 into fresh TSB and grown for 2 h at 37°C [9, 21, 51]. When a metal starvation step was included the bacteria were grown overnight in NRPMI supplemented with 1 mM MgCl2, 100 μM CaCl2 and 1 μM FeCl2 and directly inoculated 1:100 in to the assay medium. Calprotectin was purified, as previously described [9, 21]. The initial ArlRS transposon mutant was identified during optimization experiments for screening a Tn917 mutant library. For these assays bacteria arrayed in 96-well plates were grown overnight in NRPMI supplemented with 1 mM MgCl2, 100 μM CaCl2 and 1 μM FeCl2. These cultures were then assayed for CP sensitivity, as described above.

Expression analysis

To assess the expression of mntA, mntH and NWMN_1348, S. aureus was grown as for CP inhibition assays in complex medium in the presence and absence of 240 μg/ml of CP or in defined medium in the presence and absence of 120 μg/ml of CP. Bacteria were harvested during log phase growth (OD600 = ~0.1), samples were collected, an equal volume of ice-cold 1:1 acetone-ethanol was then added to the cultures, and they were frozen at -80°C until RNA extraction. RNA was extracted and cDNA was generated, as previously described [7072]. Gene expression was assessed by quantitative reverse transcription-PCR (qRT-PCR) using the indicated primers (Table 1, [13]) and 16S was used as a normalizing control.

ICP-OES analysis

To assess intracellular metal levels in wild type and ΔarlRS, S. aureus strains were grown as for CP inhibition assays using complex medium in the presence and absence of 240 μg/ml of CP. Bacteria were harvested during log phase growth (OD600 = ~0.1), washed twice with 0.1 mM EDTA, washed twice with water, and digested with nitric acid. Prior to nitric acid digestion an aliquot was used to determine the total number of bacteria in the sample. After digestion, ICP-OES was performed by the Microanalysis facility at the University of Illinois Urbana-Champaign.

Animal infections

Mouse infections were performed, as described previously [8, 9], with the exception that mice were anesthetized with isoflurane. Briefly, 9-week old mice were infected retro-orbitally with approximately 1 x 107 CFU in 100 μl of sterile phosphate-buffered saline. Following injection, the infection was allowed to proceed for 96 h before the mice were sacrificed. Livers, hearts and kidneys were removed, the organs were homogenized, and bacterial burden was determined by plating serial dilutions.

L-Lactate assay

L-lactate production was assayed, as described previously [49]. Briefly, bacteria were grown as for CP inhibition assays described above using NRPMI overnight cultures and back-diluted 1:100 into defined medium in the presence and absence of 60, 120, 240 and 480 μg/ml of CP. Samples were harvested every hour during log phase, heat inactivated (70°C for 5 min), and supernatants were collected. Samples were stored at -20°C. L-Lactic acid concentrations were measured using a Roche Yellow Line kit (R-Biopharm).

Supporting Information

S1 Fig. ArlRS promotes resistance to host-imposed Mn starvation.

(A) Growth of WT S. aureus (Newman), ΔarlRS and arlR:erm in the presence and absence of 240 μg/ml of CP. n≥3. (B) WT S. aureus (Newman) and ΔarlRS were grown in rich medium and transcript levels of hla were assessed by qRT-PCR. Expression was compared to wild type bacteria. n≥3. (C) Growth of WT S. aureus (Newman) and ΔarlRS pre-cultured in NRPMI in the presence of 240 μg/ml of CP and the ΔMn/Zn, ΔZn and ΔMn/ZnΔZn mutants. * = p≤0.05 by two-way ANOVA with Tukey’s posttests of selected means. n≥3. Error bars indicate SD.

(TIF)

S2 Fig. Loss of ArlRS prevents S. aureus from adapting to limited Mn availability.

WT S. aureus (Newman), arlR:erm, ΔmntC ΔmntH and ΔmntC ΔmntH arlR:erm were grown in the presence of increasing concentrations of CP. Growth was assessed by measuring optical density. n≥3.

(TIF)

S3 Fig. ArlRS is necessary for establishing invasive S. aureus infection and for resisting Mn sequestration during infection.

Graphs showing individual comparisons of the data presented in Fig 4A. Wild type C57BL/6 (C57) and CP-deficient C57BL/6 S100A9-/- (CP-/-) mice were infected with either S. aureus Newman (wild type) or ΔarlRS and weight loss was determined over time. (A) WT mice infected with wild type S. aureus vs. WT mice infected with ΔarlRS, (B) WT mice infected with ΔarlRS vs. CP-/- mice infected with ΔarlRS, and (C) CP-/- mice infected with wild type S. aureus vs. CP-/- mice infected with ΔarlRS. * = p≤ 0.05 by two-way ANOVA with Tukey’s posttest corrected for repeated measurements. Error bars indicate SD.

(TIF)

S4 Fig. Growth in amino acid-containing medium promotes resistance to Mn sequestration.

Growth assays were performed in defined medium containing either glucose (glc) or casamino acids (AA) as a carbon source in the presence and absence of 120 μg/ml of WT CP for (A) Newman and (C) USA300. (B) Growth of Newman in defined medium supplemented with glucose (glc) only or with glucose and 18 amino acids (glc+18AA) in the presence and absence of 60 μg/ml of WT CP. Growth in defined medium supplemented with casamino acids (AA) for (D) Newman and the Newman ΔarlRS derivative, (E) USA300 and the USA300 arlR:erm derivative and (F) SH1000 and the SH1000 arlR:erm derivative. * = p≤0.05 by two-way ANOVA with Bonferroni’s posttest corrected for repeated measurements. Growth in defined medium supplemented with glucose and amino acids in the presence and absence of CP for (G) Newman, (H) the ΔarlRS derivative, (I) USA300 and (J) the arlR:erm derivative. * = p≤0.05 by two-way ANOVA with Bonferroni’s posttest corrected for repeated measurements. n≥3. Error bars indicate SD.

(TIF)

Acknowledgments

We would like to thank Dr. Eric Skaar whose laboratory this work began in and Dr. Thomas Vogel for providing the CP-deficient mice.

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This work was supported by the National Institute of Health: K22 AI104805 and R01 AI118880 and March of Dime Basil O'Conner Starter Scholar Award: #5-FY15-30. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Wertheim HF, Vos MC, Ott A, van Belkum A, Voss A, Kluytmans JA, et al. Risk and outcome of nosocomial Staphylococcus aureus bacteraemia in nasal carriers versus non-carriers. Lancet. 2004;364(9435):703–5. 10.1016/S0140-6736(04)16897-9 [DOI] [PubMed] [Google Scholar]
  • 2. CDC. Antibiotic Resistance Threats in the United States, 2013: Centers for Disease Control and Prevention; 2013. [cited 2013]. [Google Scholar]
  • 3. WHO. Antimicrobial Resistance Global Report on Surveillance: World Health Organization; 2014. [cited 2014]. [Google Scholar]
  • 4. Andreini C, Bertini I, Cavallaro G, Holliday GL, Thornton JM. Metal ions in biological catalysis: from enzyme databases to general principles. Journal of biological inorganic chemistry: JBIC: a publication of the Society of Biological Inorganic Chemistry. 2008;13(8):1205–18. [DOI] [PubMed] [Google Scholar]
  • 5. Waldron KJ, Rutherford JC, Ford D, Robinson NJ. Metalloproteins and metal sensing. Nature. 2009;460(7257):823–30. 10.1038/nature08300 [DOI] [PubMed] [Google Scholar]
  • 6. Kehl-Fie TE, Skaar EP. Nutritional immunity beyond iron: a role for manganese and zinc. Current opinion in chemical biology. 2010;14(2):218–24. Epub 2009/12/18. 10.1016/j.cbpa.2009.11.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Weinberg ED. Iron availability and infection. Biochimica et biophysica acta. 2009;1790(7):600–5. 10.1016/j.bbagen.2008.07.002 [DOI] [PubMed] [Google Scholar]
  • 8. Corbin BD, Seeley EH, Raab A, Feldmann J, Miller MR, Torres VJ, et al. Metal chelation and inhibition of bacterial growth in tissue abscesses. Science. 2008;319(5865):962–5. 10.1126/science.1152449 [DOI] [PubMed] [Google Scholar]
  • 9. Kehl-Fie TE, Chitayat S, Hood MI, Damo S, Restrepo N, Garcia C, et al. Nutrient metal sequestration by calprotectin inhibits bacterial superoxide defense, enhancing neutrophil killing of Staphylococcus aureus . Cell Host Microbe. 2011;10(2):158–64. Epub 2011/08/17. 10.1016/j.chom.2011.07.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Cassat JE, Skaar EP. Iron in infection and immunity. Cell Host Microbe. 2013;13(5):509–19. 10.1016/j.chom.2013.04.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Hood MI, Skaar EP. Nutritional immunity: transition metals at the pathogen-host interface. Nat Rev Microbiol. 2012;10(8):525–37. 10.1038/nrmicro2836 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Bullen JJ. The significance of iron in infection. Rev Infect Dis. 1981;3(6):1127–38. [DOI] [PubMed] [Google Scholar]
  • 13. Kehl-Fie TE, Zhang Y, Moore JL, Farrand AJ, Hood MI, Rathi S, et al. MntABC and MntH contribute to systemic Staphylococcus aureus infection by competing with calprotectin for nutrient manganese. Infect Immun. 2013;81(9):3395–405. Epub 2013/07/03. 10.1128/IAI.00420-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Clohessy PA, Golden BE. Calprotectin-mediated zinc chelation as a biostatic mechanism in host defence. Scandinavian journal of immunology. 1995;42(5):551–6. [DOI] [PubMed] [Google Scholar]
  • 15. Gebhardt C, Nemeth J, Angel P, Hess J. S100A8 and S100A9 in inflammation and cancer. Biochem Pharmacol. 2006;72(11):1622–31. 10.1016/j.bcp.2006.05.017 [DOI] [PubMed] [Google Scholar]
  • 16. Bianchi M, Niemiec MJ, Siler U, Urban CF, Reichenbach J. Restoration of anti-Aspergillus defense by neutrophil extracellular traps in human chronic granulomatous disease after gene therapy is calprotectin-dependent. The Journal of allergy and clinical immunology. 2011;127(5):1243–52.e7. 10.1016/j.jaci.2011.01.021 [DOI] [PubMed] [Google Scholar]
  • 17. Urban CF, Ermert D, Schmid M, Abu-Abed U, Goosmann C, Nacken W, et al. Neutrophil extracellular traps contain calprotectin, a cytosolic protein complex involved in host defense against Candida albicans. PLoS Pathog. 2009;5(10):e1000639 10.1371/journal.ppat.1000639 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Achouiti A, Vogl T, Urban CF, Rohm M, Hommes TJ, van Zoelen MA, et al. Myeloid-related protein-14 contributes to protective immunity in gram-negative pneumonia derived sepsis. PLoS Pathog. 2012;8(10):e1002987 10.1371/journal.ppat.1002987 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Hood MI, Mortensen BL, Moore JL, Zhang Y, Kehl-Fie TE, Sugitani N, et al. Identification of an Acinetobacter baumannii zinc acquisition system that facilitates resistance to calprotectin-mediated zinc sequestration. PLoS Pathog. 2012;8(12):e1003068 Epub 2012/12/14. 10.1371/journal.ppat.1003068 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Korndorfer IP, Brueckner F, Skerra A. The crystal structure of the human (S100A8/S100A9)2 heterotetramer, calprotectin, illustrates how conformational changes of interacting alpha-helices can determine specific association of two EF-hand proteins. J Mol Biol. 2007;370(5):887–98. 10.1016/j.jmb.2007.04.065 [DOI] [PubMed] [Google Scholar]
  • 21. Damo SM, Kehl-Fie TE, Sugitani N, Holt ME, Rathi S, Murphy WJ, et al. Molecular basis for manganese sequestration by calprotectin and roles in the innate immune response to invading bacterial pathogens. Proceedings of the National Academy of Sciences of the United States of America. 2013;110(10):3841–6. 10.1073/pnas.1220341110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Hayden JA, Brophy MB, Cunden LS, Nolan EM. High-affinity manganese coordination by human calprotectin is calcium-dependent and requires the histidine-rich site formed at the dimer interface. J Am Chem Soc. 2013;135(2):775–87. 10.1021/ja3096416 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Brophy MB, Hayden JA, Nolan EM. Calcium ion gradients modulate the zinc affinity and antibacterial activity of human calprotectin. J Am Chem Soc. 2012;134(43):18089–100. 10.1021/ja307974e [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Kehres DG, Maguire ME. Emerging themes in manganese transport, biochemistry and pathogenesis in bacteria. FEMS Microbiol Rev. 2003;27(2–3):263–90. [DOI] [PubMed] [Google Scholar]
  • 25. Anderson ES, Paulley JT, Gaines JM, Valderas MW, Martin DW, Menscher E, et al. The manganese transporter MntH is a critical virulence determinant for Brucella abortus 2308 in experimentally infected mice. Infect Immun. 2009;77(8):3466–74. 10.1128/IAI.00444-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Bearden SW, Perry RD. The Yfe system of Yersinia pestis transports iron and manganese and is required for full virulence of plague. Molecular microbiology. 1999;32(2):403–14. [DOI] [PubMed] [Google Scholar]
  • 27. Berry AM, Paton JC. Sequence heterogeneity of PsaA, a 37-kilodalton putative adhesin essential for virulence of Streptococcus pneumoniae . Infect Immun. 1996;64(12):5255–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Campoy S, Jara M, Busquets N, Perez De Rozas AM, Badiola I, Barbe J. Role of the high-affinity zinc uptake znuABC system in Salmonella enterica serovar typhimurium virulence. Infect Immun. 2002;70(8):4721–5. 10.1128/IAI.70.8.4721-4725.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Davis LM, Kakuda T, DiRita VJ. A Campylobacter jejuni znuA orthologue is essential for growth in low-zinc environments and chick colonization. J Bacteriol. 2009;191(5):1631–40. 10.1128/JB.01394-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Dintilhac A, Alloing G, Granadel C, Claverys JP. Competence and virulence of Streptococcus pneumoniae: Adc and PsaA mutants exhibit a requirement for Zn and Mn resulting from inactivation of putative ABC metal permeases. Molecular microbiology. 1997;25(4):727–39. [DOI] [PubMed] [Google Scholar]
  • 31. Horsburgh MJ, Wharton SJ, Cox AG, Ingham E, Peacock S, Foster SJ. MntR modulates expression of the PerR regulon and superoxide resistance in Staphylococcus aureus through control of manganese uptake. Molecular microbiology. 2002;44(5):1269–86. [DOI] [PubMed] [Google Scholar]
  • 32. Janulczyk R, Ricci S, Bjorck L. MtsABC is important for manganese and iron transport, oxidative stress resistance, and virulence of Streptococcus pyogenes . Infect Immun. 2003;71(5):2656–64. 10.1128/IAI.71.5.2656-2664.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Kim S, Watanabe K, Shirahata T, Watarai M. Zinc uptake system (znuA locus) of Brucella abortus is essential for intracellular survival and virulence in mice. The Journal of veterinary medical science / the Japanese Society of Veterinary Science. 2004;66(9):1059–63. [DOI] [PubMed] [Google Scholar]
  • 34. Zaharik ML, Finlay BB. Mn2+ and bacterial pathogenesis. Front Biosci. 2004;9:1035–42. [DOI] [PubMed] [Google Scholar]
  • 35. Anderson AS, Scully IL, Timofeyeva Y, Murphy E, McNeil LK, Mininni T, et al. Staphylococcus aureus manganese transport protein C is a highly conserved cell surface protein that elicits protective immunity against S. aureus and Staphylococcus epidermidis . J Infect Dis. 2012;205(11):1688–96. 10.1093/infdis/jis272 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Diep BA, Phung Q, Date S, Arnott D, Bakalarski C, Xu M, et al. Identifying potential therapeutic targets of methicillin-resistant Staphylococcus aureus through in vivo proteomic analysis. J Infect Dis. 2014;209(10):1533–41. 10.1093/infdis/jit662 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Fournier B, Klier A, Rapoport G. The two-component system ArlS-ArlR is a regulator of virulence gene expression in Staphylococcus aureus . Molecular microbiology. 2001;41(1):247–61. [DOI] [PubMed] [Google Scholar]
  • 38. Fournier B, Hooper DC. A new two-component regulatory system involved in adhesion, autolysis, and extracellular proteolytic activity of Staphylococcus aureus . J Bacteriol. 2000;182(14):3955–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Liang X, Zheng L, Landwehr C, Lunsford D, Holmes D, Ji Y. Global regulation of gene expression by ArlRS, a two-component signal transduction regulatory system of Staphylococcus aureus . J Bacteriol. 2005;187(15):5486–92. 10.1128/JB.187.15.5486-5492.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Walker JN, Crosby HA, Spaulding AR, Salgado-Pabon W, Malone CL, Rosenthal CB, et al. The Staphylococcus aureus ArlRS two-component system is a novel regulator of agglutination and pathogenesis. PLoS Pathog. 2013;9(12):e1003819 10.1371/journal.ppat.1003819 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Memmi G, Nair DR, Cheung A. Role of ArlRS in autolysis in methicillin-sensitive and methicillin-resistant Staphylococcus aureus strains. J Bacteriol. 2012;194(4):759–67. 10.1128/JB.06261-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Benton BM, Zhang JP, Bond S, Pope C, Christian T, Lee L, et al. Large-scale identification of genes required for full virulence of Staphylococcus aureus . J Bacteriol. 2004;186(24):8478–89. 10.1128/JB.186.24.8478-8489.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Deutscher J, Francke C, Postma PW. How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria. Microbiol Mol Biol Rev. 2006;70(4):939–1031. 10.1128/MMBR.00024-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Liebeke M, Dorries K, Zuhlke D, Bernhardt J, Fuchs S, Pane-Farre J, et al. A metabolomics and proteomics study of the adaptation of Staphylococcus aureus to glucose starvation. Mol Biosyst. 2011;7(4):1241–53. 10.1039/c0mb00315h [DOI] [PubMed] [Google Scholar]
  • 45. Hohle TH, O'Brian MR. Manganese is required for oxidative metabolism in unstressed Bradyrhizobium japonicum cells. Molecular microbiology. 2012;84(4):766–77. 10.1111/j.1365-2958.2012.08057.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Ogunniyi AD, Mahdi LK, Jennings MP, McEwan AG, McDevitt CA, Van der Hoek MB, et al. Central role of manganese in regulation of stress responses, physiology, and metabolism in Streptococcus pneumoniae . J Bacteriol. 2010;192(17):4489–97. 10.1128/JB.00064-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Bell SC, Turner JM. Bacterial catabolism of threonine. Threonine degradation initiated by L-threonine-NAD+ oxidoreductase. Biochem J. 1976;156(2):449–58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. O'Connor RJ, Halvorson HO. Intermediate metabolism of aerobic spores. V. The purification and properties of L-alanine dehydrogenase. Arch Biochem Biophys. 1960;91:290–9. [DOI] [PubMed] [Google Scholar]
  • 49. Vitko NP, Spahich NA, Richardson AR. Glycolytic dependency of high-level nitric oxide resistance and virulence in Staphylococcus aureus . MBio. 2015;6(2). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Waldron KJ, Robinson NJ. How do bacterial cells ensure that metalloproteins get the correct metal? Nat Rev Microbiol. 2009;7(1):25–35. 10.1038/nrmicro2057 [DOI] [PubMed] [Google Scholar]
  • 51. Richardson AR, Dunman PM, Fang FC. The nitrosative stress response of Staphylococcus aureus is required for resistance to innate immunity. Molecular microbiology. 2006;61(4):927–39. 10.1111/j.1365-2958.2006.05290.x [DOI] [PubMed] [Google Scholar]
  • 52. Richardson AR, Libby SJ, Fang FC. A nitric oxide-inducible lactate dehydrogenase enables Staphylococcus aureus to resist innate immunity. Science. 2008;319(5870):1672–6. 10.1126/science.1155207 [DOI] [PubMed] [Google Scholar]
  • 53. Li C, Sun F, Cho H, Yelavarthi V, Sohn C, He C, et al. CcpA mediates proline auxotrophy and is required for Staphylococcus aureus pathogenesis. J Bacteriol. 2010;192(15):3883–92. 10.1128/JB.00237-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Vitko NP, Grosser MR, Khatri D, Lance TR, Richardson AR. Expanded Glucose Import Capability Affords Staphylococcus aureus Optimized Glycolytic Flux during Infection. MBio. 2016;7(3). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Valentino MD, Foulston L, Sadaka A, Kos VN, Villet RA, Santa Maria J Jr., et al. Genes contributing to Staphylococcus aureus fitness in abscess- and infection-related ecologies. MBio. 2014;5(5):e01729–14. 10.1128/mBio.01729-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Thiennimitr P, Winter SE, Baumler AJ. Salmonella, the host and its microbiota. Curr Opin Microbiol. 2012;15(1):108–14. 10.1016/j.mib.2011.10.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Thiennimitr P, Winter SE, Winter MG, Xavier MN, Tolstikov V, Huseby DL, et al. Intestinal inflammation allows Salmonella to use ethanolamine to compete with the microbiota. Proceedings of the National Academy of Sciences of the United States of America. 2011;108(42):17480–5. 10.1073/pnas.1107857108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Nakashige TG, Zhang B, Krebs C, Nolan EM. Human calprotectin is an iron-sequestering host-defense protein. Nat Chem Biol. 2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Smaldone GT, Revelles O, Gaballa A, Sauer U, Antelmann H, Helmann JD. A global investigation of the Bacillus subtilis iron-sparing response identifies major changes in metabolism. J Bacteriol. 2012;194(10):2594–605. 10.1128/JB.05990-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Gaballa A, Antelmann H, Aguilar C, Khakh SK, Song KB, Smaldone GT, et al. The Bacillus subtilis iron-sparing response is mediated by a Fur-regulated small RNA and three small, basic proteins. Proceedings of the National Academy of Sciences of the United States of America. 2008;105(33):11927–32. 10.1073/pnas.0711752105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Deutscher J, Kuster E, Bergstedt U, Charrier V, Hillen W. Protein kinase-dependent HPr/CcpA interaction links glycolytic activity to carbon catabolite repression in gram-positive bacteria. Molecular microbiology. 1995;15(6):1049–53. [DOI] [PubMed] [Google Scholar]
  • 62. Henkin TM, Grundy FJ, Nicholson WL, Chambliss GH. Catabolite repression of alpha-amylase gene expression in Bacillus subtilis involves a trans-acting gene product homologous to the Escherichia coli lacl and galR repressors. Molecular microbiology. 1991;5(3):575–84. [DOI] [PubMed] [Google Scholar]
  • 63. Troxell B, Ye M, Yang Y, Carrasco SE, Lou Y, Yang XF. Manganese and zinc regulate virulence determinants in Borrelia burgdorferi . Infect Immun. 2013;81(8):2743–52. 10.1128/IAI.00507-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64. Johnston JW, Briles DE, Myers LE, Hollingshead SK. Mn2+-dependent regulation of multiple genes in Streptococcus pneumoniae through PsaR and the resultant impact on virulence. Infect Immun. 2006;74(2):1171–80. 10.1128/IAI.74.2.1171-1180.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Khan MN, Sharma SK, Filkins LM, Pichichero ME. PcpA of Streptococcus pneumoniae mediates adherence to nasopharyngeal and lung epithelial cells and elicits functional antibodies in humans. Microbes Infect. 2012;14(12):1102–10. 10.1016/j.micinf.2012.06.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Sanchez-Beato AR, Lopez R, Garcia JL. Molecular characterization of PcpA: a novel choline-binding protein of Streptococcus pneumoniae . FEMS Microbiol Lett. 1998;164(1):207–14. [DOI] [PubMed] [Google Scholar]
  • 67. Hendriksen WT, Bootsma HJ, van Diepen A, Estevao S, Kuipers OP, de Groot R, et al. Strain-specific impact of PsaR of Streptococcus pneumoniae on global gene expression and virulence. Microbiology. 2009;155(Pt 5):1569–79. 10.1099/mic.0.025072-0 [DOI] [PubMed] [Google Scholar]
  • 68. Fey PD, Endres JL, Yajjala VK, Widhelm TJ, Boissy RJ, Bose JL, et al. A genetic resource for rapid and comprehensive phenotype screening of nonessential Staphylococcus aureus genes. MBio. 2013;4(1):e00537–12. 10.1128/mBio.00537-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Bae T, Schneewind O. Allelic replacement in Staphylococcus aureus with inducible counter-selection. Plasmid. 2006;55(1):58–63. 10.1016/j.plasmid.2005.05.005 [DOI] [PubMed] [Google Scholar]
  • 70. Collins JA, Irnov I, Baker S, Winkler WC. Mechanism of mRNA destabilization by the glmS ribozyme. Genes Dev. 2007;21(24):3356–68. 10.1101/gad.1605307 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71. Grossoehme N, Kehl-Fie TE, Ma Z, Adams KW, Cowart DM, Scott RA, et al. Control of copper resistance and inorganic sulfur metabolism by paralogous regulators in Staphylococcus aureus . J Biol Chem. 2011;286(15):13522–31. 10.1074/jbc.M111.220012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72. Kehl-Fie TE, Porsch EA, Miller SE, St Geme JW 3rd. Expression of Kingella kingae type IV pili is regulated by sigma54, PilS, and PilR. J Bacteriol. 2009;191(15):4976–86. Epub 2009/05/26. 10.1128/JB.00123-09 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. ArlRS promotes resistance to host-imposed Mn starvation.

(A) Growth of WT S. aureus (Newman), ΔarlRS and arlR:erm in the presence and absence of 240 μg/ml of CP. n≥3. (B) WT S. aureus (Newman) and ΔarlRS were grown in rich medium and transcript levels of hla were assessed by qRT-PCR. Expression was compared to wild type bacteria. n≥3. (C) Growth of WT S. aureus (Newman) and ΔarlRS pre-cultured in NRPMI in the presence of 240 μg/ml of CP and the ΔMn/Zn, ΔZn and ΔMn/ZnΔZn mutants. * = p≤0.05 by two-way ANOVA with Tukey’s posttests of selected means. n≥3. Error bars indicate SD.

(TIF)

S2 Fig. Loss of ArlRS prevents S. aureus from adapting to limited Mn availability.

WT S. aureus (Newman), arlR:erm, ΔmntC ΔmntH and ΔmntC ΔmntH arlR:erm were grown in the presence of increasing concentrations of CP. Growth was assessed by measuring optical density. n≥3.

(TIF)

S3 Fig. ArlRS is necessary for establishing invasive S. aureus infection and for resisting Mn sequestration during infection.

Graphs showing individual comparisons of the data presented in Fig 4A. Wild type C57BL/6 (C57) and CP-deficient C57BL/6 S100A9-/- (CP-/-) mice were infected with either S. aureus Newman (wild type) or ΔarlRS and weight loss was determined over time. (A) WT mice infected with wild type S. aureus vs. WT mice infected with ΔarlRS, (B) WT mice infected with ΔarlRS vs. CP-/- mice infected with ΔarlRS, and (C) CP-/- mice infected with wild type S. aureus vs. CP-/- mice infected with ΔarlRS. * = p≤ 0.05 by two-way ANOVA with Tukey’s posttest corrected for repeated measurements. Error bars indicate SD.

(TIF)

S4 Fig. Growth in amino acid-containing medium promotes resistance to Mn sequestration.

Growth assays were performed in defined medium containing either glucose (glc) or casamino acids (AA) as a carbon source in the presence and absence of 120 μg/ml of WT CP for (A) Newman and (C) USA300. (B) Growth of Newman in defined medium supplemented with glucose (glc) only or with glucose and 18 amino acids (glc+18AA) in the presence and absence of 60 μg/ml of WT CP. Growth in defined medium supplemented with casamino acids (AA) for (D) Newman and the Newman ΔarlRS derivative, (E) USA300 and the USA300 arlR:erm derivative and (F) SH1000 and the SH1000 arlR:erm derivative. * = p≤0.05 by two-way ANOVA with Bonferroni’s posttest corrected for repeated measurements. Growth in defined medium supplemented with glucose and amino acids in the presence and absence of CP for (G) Newman, (H) the ΔarlRS derivative, (I) USA300 and (J) the arlR:erm derivative. * = p≤0.05 by two-way ANOVA with Bonferroni’s posttest corrected for repeated measurements. n≥3. Error bars indicate SD.

(TIF)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.


Articles from PLoS Pathogens are provided here courtesy of PLOS

RESOURCES