Structural and functional analysis of an anchorless fibronectin-binding protein FBPS from Gram-positive bacterium Streptococcus suis

Significance

Gram-positive bacteria have evolved to use host fibronectin via molecules called “fibronectin-binding proteins” (FnBPs) to execute their host-interaction functions. The anchorless FnBPs, for which neither structural information nor a well-defined function is available, were recently proposed to be important virulence factors. Our work illustrates the organization of fibronectin/fibrinogen-binding protein from Streptococcus suis (FBPS), a representative member of the anchorless FnBP group from S. suis, by small-angle X-ray scattering and describes two terminal-half structures at high resolution. The C-terminal half of FBPS interacts with fibronectin and the N-terminal half attaches to the bacterial surface. Functionally, FBPS contributes to the bacterial pathogenesis both as an adhesin and as a chemokine stimulator.

Abstract

The anchorless fibronectin-binding proteins (FnBPs) are a group of important virulence factors for which the structures are not available and the functions are not well defined. In this study we performed comprehensive studies on a prototypic member of this group: the fibronectin-/fibrinogen-binding protein from Streptococcus suis (FBPS). The structures of the N- and C-terminal halves (FBPS-N and FBPS-C), which together cover the full-length protein in sequence, were solved at a resolution of 2.1 and 2.6 Å, respectively, and each was found to be composed of two domains with unique folds. Furthermore, we have elucidated the organization of these domains by small-angle X-ray scattering. We further showed that the fibronectin-binding site is located in FBPS-C and that FBPS promotes the adherence of S. suis to host cells by attaching the bacteria via FBPS-N. Finally, we demonstrated that FBPS functions both as an adhesin, promoting S. suis attachment to host cells, and as a bacterial factor, activating signaling pathways via β1 integrin receptors to induce chemokine production.

The Streptococcus suis serotype 2 (S. suis 2) is an important zoonotic pathogen causing swine infections (1). Occasionally S. suis can also cause human infections that result in meningitis, septicemia, arthritis, and other mild diseases or, in some extreme cases, severe postinfection sequelae or death, consequently generating worldwide public concern (2–4). In 2005, a large outbreak (215 cases) of human S. suis infections was reported in Sichuan Province, China (5–7). A previous outbreak of human S. suis infections occurred in Jiangsu Province, China in 1998 (8, 9). Most cases of the disease, in both swine and humans, are caused by S. suis 2, and therefore almost all studies on virulence factors and the pathogenesis of infection focus on this serotype (10–12).

S. suis can adhere to and invade eukaryotic cells; this adherence is likely a prerequisite for the bacterium invasion and establishment of disease in the host (1, 3). As with other Gram-positive bacteria, S. suis can express specific cell-surface components called “adhesins” to mediate adherence to host cells (13, 14). Most of these adhesins function by binding to various components of the host extracellular matrix (ECM) (14, 15). One of the most common adhesin–ECM interactions involves the recruitment of fibronectin, a ubiquitous extracellular protein (14) which is abundant in the circulation system and at various extracellular sites (16). Intriguingly, fibronectin can bind to both host cells and bacteria and therefore is considered an essential molecule for mediating the adherence of Gram-positive bacteria to host organisms. Moreover, via its interaction with integrins, fibronectin also plays a role in triggering the signal transduction events that facilitate bacterial invasion into eukaryotic cells (17).

Bacterial pathogens are able to use host fibronectin for pathogenesis by expressing multiple fibronectin-binding proteins (FnBPs). These FnBPs are microbial surface components recognizing adhesive matrix molecules (MSCRAMM) (13) and can be categorized into two groups based on their surface-anchoring mechanisms (18). One group of FnBPs is covalently anchored to the bacterial surface. Members of this group, such as streptococcal fibronectin-binding protein 1 (SfbI) of Streptococcus pyogenes (19) and FnBPA of Staphylococcus aureus (20), contain an N-terminal signal peptide for secretion, a C-terminal hydrophobic region, and a charged tail within which a hydrophobic domain contains the LPXTG motif for covalent anchorage to cell-wall peptidoglycan. In these proteins the fibronectin-binding activity is located in the C-terminal half of the molecules. Here sequence repeats, characterized as the high-affinity fibronectin-binding repeats (FnBRs) (21), were found to assemble into tandem β-zippers which align with sequential type I modules in fibronectin (22, 23). In recent years, another group of FnBPs, represented by PavA of Streptococcus pneumoniae (24) and Fbp54 of S. pyogenes (25), has been identified in many Gram-positive bacteria. Distinct from the LPXTG-mediated attachment, members of this FnBP group lack a canonical signal peptide and an LPXTG-like motif and instead use an unknown mechanism for surface localization (18). These anchorless adhesins have important biological functions and form a new class of virulence factors (26–29). However, unlike the LPXTG-anchored FnBPs, there currently is a paucity of structural and functional data regarding the anchorless FnBPs, which share only a low sequence homology.

Here we have characterized the structural and functional features of the anchorless FnBP of S. suis 2 (FBPS). The structure was solved in its N- and C-terminal halves, FBPS-N and FBPS-C, respectively, which unexpectedly revealed two protein folds. Furthermore, we have elucidated the organization of these domains by small-angle X-ray scattering (SAXS) and show that the FBPS N-terminal half attaches to the bacterial surface, whereas the C-terminal half mediates adhesion to the host cells. Moreover, we have characterized the role of FBPS as both an adhesin and a virulence-contributing factor by comparing the attachment of WT and Δfbps mutant bacteria to HEp-2 cells and by analyzing FBPS-mediated activation of downstream signaling pathways. These results demonstrate that FBPS can both promote the adherence of S. suis to HEp-2 cells and activate host kinases to induce IL-6 and IL-8 production via integrin receptors. We further compared the structure of FBPS-N with that of another family member, the FnBP of S. aureus, whose structure had been deposited in the Protein Data Bank (PBD) but had not yet been analyzed, revealing their common structural characteristics and distinct features.

Results

Crystal Structure of the N-Terminal Half of the FBPS.

The FBPS of S. suis 2 consists of 552 amino acids and exhibits high sequence similarity to PavA of S. pneumoniae (74% identity) and Fbp54 of S. pyogenes (70% identity) (Fig. S1). To explore the structural features of FBPS, we first used the full-length protein for crystallization trials. The solved structure unexpectedly contained only FBPS-N. The final model, which is refined to 2.1-Å resolution (Table S1), contains 267 amino acids extending from S2 to K268. The overall structure involves two distinct domains (domains I and II), one extra small helix (αn7), and two extremely long loops connecting the domains and the helix. Domain I is a nine-stranded β-barrel core wrapped by several surface helices and loops. Topologically, the domain residues first assemble into an α-helix (αn1) and a four-stranded front-sheet with four consecutive antiparallel β-strands (βn1–βn4) and then proceed via a loop-connecting bridge over the face of the βn1–βn4 strands to form another helix (αn2) and a rear-sheet composed of the remaining five core-barrel strands (βn5–βn9) arranged in an antiparallel manner. Sterically, the two helices locate between and clamp the two barrel-sheets on the opposite sides. Domain I is linked to domain II by a long βn9/αn3 interloop that flows underneath the βn5–βn9 strands (Fig. 1 A and B).

Fig. S1.

Structure-based sequence alignment of representative anchorless FnBPs of different microorganisms. Black arrows denote β-strands, and spinal lines indicate α-helices. The potential trypsin recognition site between FBPS-N and FBPS-C is highlighted with a dotted blue box. The βn10/βn11 hairpin loop, which is dramatically longer in the FBPA of Staphylococcus aureus than in the FBPS of S. suis, is highlighted with a dotted red box. The first three residues that are devoid of electron densities in the FBPS-C structure are indicated by question marks.

Table S1.

Crystallographic data measurement and refinement data

Data collection and refinement	FBPS-N (native)	FBPS-N (SeMet)	FBPS-C (native)	FBPS-C (SeMet)
Data collection
Space group	P41212	P41212	P21	P21
Cell dimensions
a, b, c, (Å)	70.6, 70.6, 110.2	70.5, 70.5, 110.0	40.3, 103.6, 83.3	40.5, 104.1, 84.5
α, β, γ, (°)	90.0, 90.0, 90.0	90.0, 90.0, 90.0	90.0, 92.2, 90.0	90.0, 92.3, 90.0
		Peak		Peak
Wavelength (Å)	1.0000	0.9795	1.0000	0.9795
Resolution* (Å)	50.0–2.10 (2.18–2.10)	50.0–2.80 (2.90–2.80)	50.0–2.60 (2.69–2.60)	50.0–2.90 (2.95–2.90)
Rsys or Rmerge*†	0.084 (0.512)	0.096 (0.497)	0.115 (0.338)	0.125 (0.539)
I/σI*	29.98 (3.76)	25.46 (4.31)	17.57 (2.98)	15.23 (1.49)
Completeness* (%)	97.6 (90.0)	100.0 (100.0)	97.1 (79.4)	88.2 (44.1)
Redundancy*	12.9 (10.2)	15.2 (14.6)	6.5 (3.7)	6.3 (2.3)
Total reflections	214,164	202,544	137,034	88,862
Unique reflections	16,622	13,350	21,058	14,070
Refinement
Resolution (Å)	33.60–2.10		38.61–2.60
Rwork/Rfree‡	0.216/0.246		0.219/0.249
No. atoms
Protein	2,159		4,001
Water	129		89
B-factors
Protein	40.0		58.9
Water	39.0		58.5
Rmsd
Bond lengths (Å)	0.013		0.010
Bond angles, degrees	1.215		1.315
Ramachandran plot§
Most favored region (%)	86.8		91.6
Additionally allowed region (%)	12.0		8.2
Generously allowed region (%)	1.2		0.2
Disallowed region (%)	0		0

^*Values for the outmost resolution shell are given in parentheses.

^†R_merge = Σ_iΣ_hkl | I_i-<I> | /Σ_iΣ_hklI_i, where I_i is the observed intensity and <I> is the average intensity from multiple measurements.

^‡R_work = Σ | | F_o |− | F_c | | /Σ | F_o |, where F_o and F_c are the structure-factor amplitudes from the data and the model, respectively. R_free is the R factor for a subset (5%) of reflections that was selected before refinement calculations and was not included in the refinement.

^§Ramachandran plots were generated by using the program PROCHECK.

Fig. 1.

Crystal structure of FBPS-N and FBPS-C. (A) Overall fold of FBPS-N. Domain I, domain II, and the C-terminal α-helix are colored green, cyan, and magenta, respectively. The domain linkers are in orange for the loop connecting domains I and II and blue for the loop linking domain II with the terminal helix. The secondary elements are labeled according to their occurrence within the structure. (B) Topological view of the FBPS-N structure. The α-helices and β-strands are colored as in A. (C) Comparison of our FBPS-N of S. suis with FnBP-N of S. aureus (PDB ID code 3DOA). Domain I of FBPS-N is highly similar to domain I of FnBP-N; however, in domain II, the αn4/ αn5 loop, the αn5/αn6 loop, and the β-hairpin are shorter in FBPS-N than in FnBP-N. (D) Topological view of the FnBP-N structure. (E) Overall fold of FBPS-C. Two molecules of essentially the same structure are observed in the asymmetric unit; only one of them is multicolored and labeled. The structure can be divided into two domains, which are colored magenta and yellow, respectively. A 33-residue loop in domain I, which is devoid of traceable electron densities, is indicated by a dashed curve. The secondary structure elements are successively marked based on their occurrence within the structure. (F) Topological view of the same structure.

In contrast to domain I, which is predominantly β-stranded, domain II of FBPS-N is a purely α-helical structure. In this domain, four helices (αn3–αn6) cluster together, forming an independent bundle-like fold. Following this domain, the αn6/7 interloop flows back toward the βn4–αn2 bridge loop of domain I forming two short β-strands (βn10–βn11) arranged in an antiparallel manner defining a small β-hairpin structure that forms tyrosine-mediated hydrogen bonds (K237–Y264 and Y239–Y265) with the final α-helical structure of the FBPS-N (αn7). Moreover, the αn7 helix is further stabilized by hydrogen bonding to the βn4–αn2 bridge of domain I. (Fig. 1 A and B).

The PDB contains a structure, the FnBP-N of S. aureus (PDB ID code 3DOA) resolved by Structural Genomics Consortium that is a homolog of our FBPS-N but whose analysis had not been described. We compared the two structures and found that FBPS-N has a fold similar to that in FnBP-N and that their overall structures are similar (Fig. 1 C and D). Detailed superimposition analysis revealed that domain I is almost exactly the same in FBPS-N and FBPS-N, but domain II is moderately different in the two structures. The α_n4/α_n5 loop, α_n5/α_n6 loop, and the β-hairpin are shorter in the FBPS-N structure than in the FnBP-N structure (Fig. 1 C and D).

Structure of the C-Terminal Half of the FBPS.

The crystal structure of FBPS-C starting with residue A269 was resolved at a resolution of 2.6 Å (Table S1). Clear electron densities can be traced unambiguously from the fourth residue (D272) to the very end residue (I552), with the exception of amino acids T320 to P354, which were devoid of any traceable densities. The FBPS-C structure also can be divided into two domains (domains I and II). Domain I is a purely helical structure that consists of three topologically consecutive α-helices. The first two helices, αc1 and αc2, are extremely long, with an estimated length of 74 and 64 Å, respectively, and are arranged in a cross shape with an interangle of ∼20° to form a long coiled coil. The domain II-distal ends of these domain I helices are linked via a long and flexible loop (αc1/αc2 loop) that is formed by the 33 untraceable residues (T320–P354). The final relatively small third helix (αc3) of FBPS-C domain I is located on one longitudinal side of the coiled structure, proximal to domain II, and assembles into a stable three-helix bundle with helices αc1 and αc2 (Fig. 1 E and F).

Domain II of FBPS-C consists of amino acids E432 to I552, forming an overall globular fold. The domain is composed of six antiparallel β-strands (βc1–βc6) and three α-helices with αc5 located in the center of a ring formed by the βc1–βc6 strands and αc6 and αc4 forming stabilizing hydrogen bond interactions with domain I αc3 (Fig. 1E). Topologically, this domain exhibits a characteristic structure with a tandem arrangement of three ββα motifs (Fig. 1F).

Architecture of Full-Length FBPS.

Having solved the individual FBPS-N and FBPS-C crystal structures, we were able to examine the architecture of the full-length protein in solution further by SAXS. The FBPS-N and FBPS-C structures fit well into the SAXS map, and from the side view we can see that FBPS-N and FBPS-C are organized in a cis orientation, like a human arm, and that the axis lines of these two N- and C-terminal structures meet at an angle of about 90° (Fig. 2). From the top view, we can see that the FBPS-N domain II and FBPS-C domain II are on one side, and the FBPS-N domain I and FBPS-C domain I are on the other side (Fig. 2).

Fig. 2.

Architecture of full-length FBPS. The FBPS-N and FBPS-C structures have been fitted into the SAXS envelopes of FBPS.

FBPS Promotes S. suis Adherence by Attaching Bacteria via FBPS-N and Adhering to Host Cells with FBPS-C.

A typical feature of FnBPs is their ability to promote bacterial adherence to host cells by bridging the bacteria and the ECM. Thus we also tested whether FBPS could function as such an adhesin in S. suis pathogenesis. The fbps gene was knocked out from the virulent S. suis strain 05ZYH33 (7) to yield a mutant strain, Δfbps, and successful construction of the deletion mutant was confirmed by a PCR-based assay (Fig. S2). Overall, deletion of the fbps gene did not affect the in vitro growth rate of the bacterial cells in Todd–Hewitt broth supplemented with 2% yeast extract (THY medium) (Fig. S3). The elimination of FBPS did not completely abrogate the cell adherence of S. suis; however, a statistically significant decrease in surface attachment to HEp-2 cells was observed for Δfbps compared with the WT strain. Upon complementation, the mutant strain regained its adhesion capacity to a level similar to that of WT S. suis (Fig. 3A).

Fig. S2.

Construction and confirmation of the Δfbps mutant S. suis by multiple-PCR analysis. The primer combinations used in PCR are presented above the lanes. Genomic DNA from the following strains was used as templates: WT S. suis (lanes 1, 3, 5, 7, 9, 11, and 13) and Δfbps mutant (lanes 2, 4, 6, 8, 10, 12, and 14). M indicates the DNA ladder marker. The theoretical size of each PCR product is as follows: lane 1, 1,712 bp; lane 2, 1,183 bp; lane 3, 1,659 bp; lane 4, blank ; lane 5, blank; lane 6, 1,130 bp; lane 7, 1,683 bp; lane 8, blank; lane 9, 1,688 bp; lane 10, blank; lane 11, blank; lane 12, 1,154 bp; lane 13, blank; lane 14, 1,159 bp.

Fig. S3.

Bacteria growth curves in THY medium. Growth curves of the WT and the Δfbps S. suis strains are profiled. Each data point represents the mean ± SD.

Fig. 3.

FBPS contributes to S. suis adherence. (A) Adhesion of WT S. suis (black bar), the Δfbps mutant (white bar), and complemented S. suis (gray bar) to HEp-2 cells. Data are presented as means ± SD of three independent experiments. **P < 0.005. (B and C) Pull-down assays characterizing the binding capacities of different FBPS proteins to the bacterial or the host cells. (B) Proteins pulled down by the indicated bacterial cells. (C) Proteins pulled down by HEp-2 cells. (D–F) BIAcore analysis of the binding between FnN30 and different FBPS proteins. Gradient concentrations of the indicated S. suis proteins were flowed over immobilized FnN30. Kinetic profiles are shown. (D) FBPS binding to FnN30. (E) FBPS-N binding to FnN30. (F) FBPS-C binding to FnN30. (G) Adhesion of WT S. suis (black bar), Δfbps mutant (white bar), and complemented S. suis (gray bar) cells to immobilized fibronectin. Data are presented as means ± SD of three independent experiments. ***P < 0.001.

We further probed the binding mechanism of S. suis by investigating the binding of the full-length protein and the two terminal halves to bacterial and host cells. As expected, the full-length protein was able to adhere to both the S. suis and the HEp-2 cells. Interestingly, the bacterial surface-attachment activity of FBPS lies in the N-terminal half of the protein and is specific to the S. suis cells. Neither S. pneumonia nor Group B Streptococcus (GBS) could pull down FBPS or FBPS-N (Fig. 3B). On the other hand, FBPS uses its C-terminal half for host-cell attachment. FBPS-C, rather than FBPS-N, was pulled down by the HEp-2 cells (Fig. 3C).

FBPS Binds to Fibronectin Predominantly via its C-Terminal Half and Contributes Directly to S. suis Adherence.

We further characterized the fibronectin-binding properties of FBPS using a surface plasma resonance (SPR) binding assay. The N-terminal 30-kDa portion of human fibronectin (FnN30) was used in the experiment, because this protein fragment has been shown to be involved in the engagement of bacterial ligands (17). As expected, a potent binding to immobilized FnN30 was observed for the full-length FBPS (Fig. 3D). However, although FBPS-C displayed binding kinetics similar to that observed for the full-length protein, with a dissociation constant (K_d) of 370 nM (Fig. 3F), a negligible interaction was detected for FBPS-N (Fig. 3E). These results indicate that FBPS-C, rather than FBPS-N, represents the predominant domain for fibronectin-binding activity and recognizes the N-terminal fragment of human fibronectin for engagement. Our results also are consistent with a previous study showing that C-terminal truncations of S. pneumoniae PavA cause the protein to lose its capacity for fibronectin interaction (22).

We then sought to investigate whether binding to fibronectin by FBPS contributes directly to S. suis adherence. Therefore we compared the ability of the WT, Δfbps, and complemented bacterial strains to bind to the immobilized human fibronectin. Similar to the cell-based adhesion assay, S. suis binding to fibronectin was impaired dramatically after knockout of the fbps gene; the observed binding level of Δfbps was approximately half that observed for the WT or the complemented strains (Fig. 3G).

FBPS Contributes to IL-6/-8 Production via β1 Integrin Receptors.

A number of surface or secreted components of Staphylococci spp. and Streptococci spp. strongly induce proinflammatory responses (30–32). We therefore investigated whether FBPS contributes to the production of proinflammatory cytokines by testing the amounts of IL-6 and IL-8 secreted by HEp-2 cells after S. suis infection. A strong production of both cytokines was detected when the cells were infected with WT S. suis compared with control cells. The Δfbps bacterium also induced a rapid expression of IL-6 and -8 in HEp-2 cells but at a decreased level. Complementation with the intact fbps gene faithfully restored the HEp-2 secretion of IL-6 and -8 (Fig. 4 A and B). Moreover, by blocking the β1 integrin receptors with a specific antibody, we were able to show that these receptors are crucial for the induction of this cytokine release, because a decreased secretion of IL-6 and -8 by HEp-2 cells, which abolished the difference in cytokine levels between WT and complemented strains with the knockout, was observed in the presence of this specific antibody but not in the presence of an isotype control (Fig. 4 A and B).

Fig. 4.

FBPS-dependent cytokine secretion and MAPK activation. (A and B) Secretion of IL-6 (A) and IL-8 (B) by HEp-2 cells upon infection with WT (black bar), Δfbps mutant (white bar), and complemented (gray bar) S. suis strains. Concentrations of IL-6 and IL-8 in HEp-2 supernatants in the absence of any antibodies or in the presence of anti–β1-integrin antibody or an isotype control antibody were measured using ELISA. **P < 0.005, ***P < 0.001; NS, not significant. (C and D) Detection of phosphorylated and nonphosphorylated forms of ERK (C) and p38 (D) in HEp-2 cells infected with WT or Δfbps S. suis. (E and F) Detection of phosphorylated and nonphosphorylated forms of ERK (E) and p38 (F) in HEp-2 cells incubated with individual FBPS proteins or BSA (an irrelevant protein control). The proteins were visualized at the indicated time points using specific antibodies. A representative Western blot result is shown.

We further explored the host signaling pathway underlying FBPS-induced cytokine production. The MAPKs such as ERK and p38 are shown to be phosphorylated upon bacterial infection and play an important role in IL-8 production induced by YadA, an FnBP identified in Yersinia pseudotuberculosis (33). We therefore examined whether ERK and p38 are activated by phosphorylation upon S. suis infection and compared the activation pattern of the two kinases in WT and Δfbps strains. Rapid and strong activation of both kinases was observed when HEp-2 cells were incubated with WT S. suis. The phosphorylation was maximally increased 10–20 min after infection and remained detectable for at least 45 min after infection. The Δfbps infection also activated ERK and p38, but the levels were significantly lower than those observed in the WT strain over the same time period. In addition, deletion of the fbps gene caused a dramatic delay in kinase activation, with maximal phosphorylation occurring 45 min postinfection (Fig. 4 C and D). The two kinases also were activated effectively by purified FBPS and FBPS-C proteins but not by BSA or FBPS-N (Fig. 4 E and F), demonstrating the important role of FBPS-C in activating host proinflammatory responses.

Discussion

FnBPs have been implicated in the pathogenesis of many important bacterial pathogens (17). Known FnBPs can be categorized into two groups: those with an LPXTG motif for surface localization and those lacking similar anchoring motifs (18). In this study, we illustrate the structural features of the latter anchorless group using a representative member from S. suis, FBPS. The structure of FBPS was solved in its N- and C-terminal halves, and its full-length architecture in solution was determined by SAXS. FBPS-N and FBPS-C are independent in structure. Furthermore, our functional assays revealed that FBPS-N attaches to the bacterial surface, whereas FBPS-C binds to host cells and interacts with fibronectin. Therefore it is a reasonable inference that the anchorless FnBPs are composed of two relatively independent halves with both structural and functional variances. It is interesting that FBPS-N ends with an α-helix (αn7) and FBPS-C begins with another α-helix (αc1). Therefore it is possible that helices αn7 and αc1 are actually one helix that is digested at a potential trypsin-recognition site (K268/A269) during crystallization. In our experience, however, such an arrangement is energetically unfavorable, and our SAXS data suggest that a small, flexible interdomain loop connects the N- and C- terminal domains. In addition, the flexible characteristics of a loop could confer steric motility to FBPS-C (relative to FBPS-N), thereby allowing the protein to fulfill its role as a bridging adhesin more effectively. Despite a long-term trial for crystallization of full-length FBPS, we repeatedly got the cleaved N/C crystals separately, and the site-mutagenesis construct yielded either the same crystals or none, indicating the separate folding of the N/C domains.

Our SPR analysis clearly illustrates that FBPS is able to bind to fibronectin and that this binding capacity can be largely attributed to the C-terminal half of the protein. However, the observed binding affinity is weaker than that for the other group of FnBPs, which are normally at one- or two-digit nanomolar levels (21). We therefore believe that FBPS represents a relatively low-affinity fibronectin ligand (26). Because FBPS also has been reported to bind to fibrinogen, we investigated by SPR whether FBPS could interact with other ECM components using human collagen I–V as representative examples and found that FBPS binding to the ECM protein fibronectin/fibrinogen appears to be selective, because low levels of binding were observed with collagens I–V and the nonspecific protein control BSA (Fig. S4). Functionally, FnBPs have been characterized as important adhesion molecules that can facilitate bacterial attachment to host cells (13). FBPS fulfills the role as a bacterial adhesin in our adhesive analysis. However, deletion of the fbps gene neither abolished S. suis adherence to HEp-2 cells nor abrogated the bacterial attachment to immobilized fibronectin. Therefore, it is probable that other adhesins in S. suis aid in bacterial adherence (30). Nevertheless, the anchorless FBPS may be present in large amounts as a secreted protein, freely contacting fibronectin and thereby enabling the activation of multiple integrins (31). Different signaling pathways, as reported in other bacteria (33, 34), have been shown to be modulated in this way to facilitate bacterial pathogenesis. Moreover, we have shown that FBPS can activate downstream signaling pathways by phosphorylating ERK and p38 and induce the production of IL-6 and -8 via β1 integrin receptors. Interestingly, a pathogenetic study on GBS revealed that enhanced chemokine expression leads to increased neutrophil infiltration and promotes bacterial dissemination in CNS (32). Given the previous observation that FBPS contributes to S. suis pathogenesis in pigs (26), it is tempting to speculate that FBPS represents an effective virulence-contributing factor, contributing to CNS diseases caused by S. suis, such as meningitis, and could represent an important target for structure-based drug development.

Fig. S4.

An SPR assay testing the interactions between FBPS and collagen types I, II, III, and V. Here, we tested the binding capacities of FBPS, FBPS-N, and FBPS-C to different types of collagen and to FnN30 at a concentration of 60 μM. FBPS and FBPS-C show obvious binding capacity to FnN30 but very weak binding to collagen types I, II, III, and V. FBPS-N does not bind to the FnN30 or to collagen types I, II, III, or V. BSA was used as a negative control.

Materials and Methods

Cloning, Expression, and Purification of Native and Selenomethionine-Labeled Proteins.

The fbps gene encoding FBPS was PCR-amplified from the genomic DNA of S. suis 05ZYH33 (7) with the primers FBPS-F and FBPS-R (for sequences, see Table S2). The coding fragment for FBPS-N (residues 1–268) was amplified with primers FBPS-F and FBPS-N-R, and that for FBPS-C (residues 269–552) was amplified with primers FBPS-C-F and FBPS-R. The products were cloned into pET-21a and transformed into Escherichia coli strain BL21 (DE3) for expression. To facilitate purification, these plasmids contained an extra His-tag–coding sequence encoded by the vector.

Table S2.

Primers used for PCR amplification and detection

Primer name	Characteristics or function	Source
FBPS-F	5′–GGAATTCCATATGTCTTTTGACGGATTTTT–3′ (NdeI site underlined)	Present work
FBPS-R	5′–CCGCTCGAGGATTTTCATGGATTTTATTTTATC–3′ (XhoI site underlined)	Present work
FBPS-N-R	5′–CCGCTCGAGCCTTATCCTGATAGTAGAAGTCCAG–3′ (XhoI site underlined)	Present work
FBPS-C-F	5′–GGAATTCCATATGGCGGAGCGGGATCGGGT–3′ (NdeI site underlined)	Present work
LAP1	5′–CCGGAATTCTGTAGAATAATAGTCTTG–3′ (EcoR I site underlined)	Present work
LAP2	5′–CGCGGATTCAGTTTTCCTCTTTCTAATAGC–3′ (BamH I site underlined)	Present work
RAP1	5′–AAAACTGCAGTTCATGGATTTTTCTG–3′ (PstI site underlined)	Present work
RAP2	5′–CCCAAGCTTAGAAAGAGACGATGAAGC–3′ (Hind III site underlined)	Present work
LA-F	5′–GAGTTATAGCTATTAGAAAGAGG–3′	Present work
RA-R	5′–CTTCAATACAGAAAAATCCATG–3′	Present work
Spc-F	5′–GCAGGATCCGTTCGTGAATACATGTTATA–3′ (BamH I site underlined)	Present work
Spc-R	5′–GGCTGCAGGTTTTCTAAAATCTGAT–3′ (PstI site underlined)	Present work
REMU-F	5′–CGCGGATCCTCCTTTTATTTCAATTATTAG–3′ (BamH I site underlined)	Present work
REMU-R	5′–CCGGAATTCCTAGATTTTCATGGATTTTATTTTATC–3′ (EcoR I site underlined)	Present work

The native proteins were expressed by the addition of 1 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) to exponential phase cultures. After a 4-h incubation at 37 °C, the cells were harvested by centrifugation, disrupted by sonication, and clarified by centrifugation. FBPS, FBPS-N, and FBPS -C then were purified further by Ni-NTA affinity chromatography and gel filtration.

For the production of selenomethionine (SeMet)-labeled proteins, bacteria were grown in M9 minimal medium until midlog phase. Then l-lysine, l-phenylalanine, l-threonine, l-isoleucine, l-leucine, l-valine, and l-SeMet were added to the culture 15 min before the addition of 1 mM IPTG. Following induction, the SeMet-labeled proteins were purified in the same way as native proteins.

Crystallization and Data Collection.

All crystallization experiments were carried out using the hanging-drop vapor-diffusion method at 18 °C. Typically, a 5- to 15-mg/mL protein solution was mixed in a 1:1 ratio with reservoir solution. The FBPS-N crystals were obtained with a solution containing 0.1 M Na citrate (pH 5.6), 20% (wt/vol) PEG 4,000, and 0.2 M NaCl. The FBPS-C protein was crystallized in a solution containing 0.1 M Hepes (pH 7.5), 10% (wt/vol) PEG 4,000, and 500 mM NaCl. Crystals of the SeMet-labeled FBPS-N and FBPS-C were grown under identical conditions. Before data collection, crystals were transferred for no more than 5 s into a cryoprotectant buffer consisting of 25% (vol/vol) glycerol and 75% (vol/vol) reservoir solution. Crystals then were mounted in cryoloops and were flash-cooled in liquid nitrogen. The dataset for FBPS-N was collected at the Beijing Synchrotron Radiation Facility Beamline 1W2B, and that for FBPS-C was collected at the Shanghai Synchrotron Radiation Facility Beamline 17U. The collected intensities were indexed, integrated, and scaled using HKL2000 (32).

Structure Determination and Refinement.

The structures of both FBPS-N and FBPS-C were determined by the single-wavelength anomalous diffraction (SAD) method. The expected Se atoms were located by SHELXD (33), and initial phases were calculated using PHASER (35). The real space constraints were further applied to the electron density map in DM (36). The initial models were built with Autobuild in PHENIX package (34). The native datasets then were used for structure-solving by the molecular replacement method using PHASER from the CCP4 suite (37). Extensive model building and restrained refinement were performed with COOT (38) and REFMAC5 (39). Further rounds of refinement were performed using the phenix.refine (36). The stereochemical quality of the final models was assessed with the program PROCHECK (40).

Data collection and processing statistics are summarized in Table S1. The PDB ID codes are 5H3X for FBPS-N and 5H3W for FBPS-C.

SAXS Data Acquisition and Analysis.

Three concentrations of FBPS (2.5 mg/mL, 5 mg/mL, and 10 mg/mL) were prepared along with the buffer as background control. SAXS experiments were performed at beamline 19U2 of National Center for Protein Science Shanghai at the Shanghai Synchrotron Radiation Facility. The wavelength, λ, of X-ray radiation was set as 1.033 Å. Scattered X-ray intensities were measured using a Pilatus 1M detector (DECTRIS Ltd). The sample-to-detector distance was set so that the detecting range of momentum transfer q [=4π sin θ/λ, where 2θ is the scattering angle] of SAXS experiments was 0.01–0.5 Å⁻¹. To reduce the radiation damage, a flow cell made of a cylindrical quartz capillary with a diameter of 1.5 mm and a wall of 10 µm was used, and the exposure time was set to 1 s. The X-ray beam with a size of 0.40 × 0.15 (horizontal × vertical) mm² was adjusted to pass through the centers of the capillaries for every measurement. To obtain good signal-to-noise ratios, 10 images were taken for each sample and buffer. The 2D scattering images were converted to 1D SAXS curves by azimuthal averaging after solid angle correction and then normalizing with the intensity of the transmitted X-ray beam, using the software package BioXTAS RAW (41). The ATSAS package (42) and GNOM (43) were used for the subsequent data processing and rigid-body modeling. The ab initio models were calculated using the application DAMMIN (44). Consensus models and the normalized spatial discrepancy values were calculated by averaging 20 ab initio models using the application DAMAVER (45). Final statistics for data collection and scattering-derived parameters are presented in Table S3.

Table S3.

Data-collection and scattering-derived parameters for Bio-SAXS

Data collection and parameters	Measurement
Instrument
Beam geometry (horizontal × vertical) (mm2)	0.40 × 0.15
Wavelength (Å)	1.033
Exposure time (s)	1
Concentration range (mg/mL)	2–4
Temperature (K)	283
Structural parameters*
I(0) [from P(r)]	232.03
Rg, Å [from P(r)]	43.9
I(0) (from Guinier)†	221.1
Rg, Å (from Guinier)	42.07
Dmax, Å	124.5
Porod volume estimate (Å3)	12,063
Molecular mass determination*
Molecular mass Mr (from Porod volume)	63,000
Calculated Mr from sequence	64,000
Software used
Primary data reduction	RAW
Data processing	PRIMUS
Ab initio analysis	DAMMIF
Validation and averaging	DAMAVER
3D graphics representations	PyMOL

^*Reported for 2 mg/mL measurement.

^†The Guinier analysis refers to the analysis of the SAXS scattering curve at very small scattering angles (43).

SI Materials and Methods

Bacterial Strains, Cell Lines, and Growth Conditions.

WT, Δfbps, and complemented Streptococcus suis strains were grown in THY medium or were plated on THY agar at 37 °C. Erythromycin (1 mg/mL) and spectinomycin (100 mg/mL) were incorporated in the growth medium when required.

Escherichia coli strains were incubated in LB medium or were plated on LB agar. When required, antibiotics were added at the following concentrations: 100 mg/mL spectinomycin and 50 mg/mL ampicillin. The human HEp-2 cells were cultured in RPMI1640 medium (Gibco) supplemented with 10% (vol/vol) FBS at 37 °C in a 5% CO₂ humidified atmosphere.

Measurement of Molecular Interaction Using SPR.

The SPR assay was carried out with a BIAcore3000 system as previously described (46). FnN30, GST, or collagen IV (purchased from Sigma) was immobilized on the CM5 sensory chip at 2,000 response units (RUs). An uncoated “blank” channel was used as a negative control. All materials were exchanged to or dissolved in Hepes buffer [10 mM Hepes (pH7.5), 150 mM NaCl, 3 mM EDTA, and 0.005% Tween 20]. Increasing concentrations of the recombinant proteins (FBPS, FBPS-N, and FBPS-C) were injected at a flow rate of 30 μL/min at 25 °C, and the binding was monitored and presented as RUs in a sensogram. The kinetic parameter analyses were performed using BIAEVALUATION 3.0 software with a 1:1 Langumuir binding model.

Mutagenesis and Genetic Complementation.

The isogenic Δfbps mutant S. suis strain was generated by in-frame allelic replacement with a constitutively expressed spectinomycin resistance (Spc^R) cassette, as described previously (47). Briefly, the DNA sequences flanking fbps were amplified by PCR using two pairs of primers: LAP1/LAP2 and RAP1/RAP2. After digestion, the DNA fragments were directionally cloned into a pUC18 vector. Then, the Spc^R gene cassette amplified with primers Spc-F/-R was inserted at the BamHI/PstI sites to generate the fbps-knockout plasmid pUC::fbps. To obtain the isogenic Δfbps mutant, competent cells of S. suis 05ZYH33 were subjected to electrotransformation with plasmid pUC::fbps. The insertional mutants were selected on spectinomycin-selective plates. The deletion of the fbps gene was confirmed by colony PCR with a series of different primer combinations including a pair of primers, LA-F/RA-R, that were located upstream and downstream of fbps gene, respectively.

For genetic complementation, a DNA fragment containing the fbps gene and its upstream promoter was amplified by PCR with primers REMU-F/-R and was cloned into the E. coli–S. suis shuttle vector pVA838 (erythromycin resistance) to generate pVA::fbps. Then the Δfbps mutant strain was electrotransformed with pVA::fbps and screened with double selection pressure of spectinomycin and erythromycin.

Determination of S. suis Growth Curves.

WT and Δfbps mutant strains were grown in 10 mL THY medium overnight at 37 °C. Then 1 mL of the culture was added to 100 mL fresh THY medium and was grown at 37 °C. The optical density at the wavelength of 600 nm was measured every hour during the culturing process and plotted as growth curves.

HEp-2 Cell-Adhesion Assay.

The adhesion assay was performed as previously described, with some modifications (48). HEp-2 cells were seeded 24 h before infection in 24-well culture plates at a density of 2 × 10⁵ cells per well. WT, Δfbps, and complemented S. suis strains were grown to stationary phase, pelleted, washed three times with PBS, and resuspended in RPMI 1640 to an OD₆₀₀ of 0.4 (∼10⁸ cfu/mL). Bacteria were added to the HEp-2 cells at a multiplicity of infection of 100. The plates were centrifuged at 800 × g for 10 min to bring the bacteria to the cell surface and then were incubated for 2 h to allow bacteria to adhere to the cells. Then, the cells were washed five times with PBS to remove nonadherent or loosely combined bacteria. The cells were collected and lysed. Serial dilutions of the cell lysate were plated onto Todd–Hewitt broth (THB) agar and incubated overnight at 37 °C. Levels of adhesion were expressed as the total number of cfu recovered per well. All assays were performed in triplicate.

Bacterial and HEp-2 Cell Pull-Down Experiments.

For the bacterial pull-down assay, the Δfbps mutant was grown overnight at 37 °C, diluted 1:100 in THB containing 2 μg/mL FBPS, FBPS-N, or FBPS-C, and grown to an OD₆₀₀ of ∼0.7. The bacteria were harvested by centrifugation and washed several times with PBS. Bacteria pellets were resuspended with 200 μL PBS containing 0.005% Nonidet P-40, disrupted by sonication, and boiled for 5 min to prepare samples for SDS/PAGE. The samples then were separated on 12% gels and subsequently transferred to nitrocellulose membranes for Western blotting with an anti–His-tag antibody.

For the HEp-2 cell pulldown, ∼2 × 10⁶ cells were collected, washed once with PBS, and incubated with FBPS, FBPS-N, or FBPS-C for 5 h at 4 °C. Then the cells were centrifuged and washed several times with PBS. Cells pellets were resuspended with 40 μL PBS and were boiled to prepare samples for SDS/PAGE. The procedures for SDS/PAGE and Western blotting were the same as described above.

Bacteria Binding to Fibronectin.

Bacterial binding to fibronectin was determined by crystal violet staining. In short, three types of S. suis bacteria in 100-μL volumes were added to microtiter plate wells coated with 25 μg of human fibronectin. Following incubation at 37 °C for 2 h, the adherent bacteria were fixed by heating at 60 °C for 30 min and were stained with crystal violet (0.5% solution) for 45 min. Wells subsequently were washed with PBS to remove excess stain. The bacteria-bound dye was released by the addition of citrate buffer (20 mM sodium citrate/citric acid, pH 4.3). After a 45-min incubation at room temperature, the absorbance values were determined at 570 nm.

Cytokine Assessment of HEp-2 Supernatants by ELISA.

HEp-2 cells were infected with the WT, Δfbps, or complemented strain, and supernatants were sampled at 8 h. For the integrin-blocking assays, cells were pretreated for 1 h at 37 °C with either an anti–β1-integrin antibody (Millipore) or an isotype control antibody at a final concentration of 40 μg/mL before infection with bacteria. Concentrations of IL-6 and IL-8 in supernatants were measured using ELISA kits (Dakewe). Supernatant (100 μL) from the infected cells and a series of twofold dilutions of the chemokine standards were mixed with 50 μL of diluted (1:50) biotinylated mouse anti-human monoclonal antibodies against IL-6 or IL-8. The mixture was added to coated 96-well plates and was incubated for 1 h at room temperature. After washing, 100 μL of 1:100-diluted streptavidin-HRP was added to each well. The reaction was developed with tetramethylbenzidine reagent, and the optical density at 450 nm was measured. All samples were assayed in duplicate.

Preparation of Cell Extracts, Gel Electrophoresis, and Western Blotting.

HEp-2 cells in six-well plates were serum-starved overnight and then were infected with the WT or Δfbps strain or were incubated with 0.5 μM individual proteins (BSA, FBPS, FBPS-N, or FBPS-C). At different time points after infection, the cells were washed with PBS and resuspended in 150 μL lysis buffer. Cell extracts were boiled for 10 min and separated on 12% (vol/vol) SDS/PAGE gels. Then the proteins were transferred to nitrocellulose membranes and probed with primary antibodies against p38, phospho-p38, ERK1/2, and phospho-ERK1/2 (Santa Cruz) (all antibodies at 1:1,000 dilution) overnight at 4°C. After washing, the membranes were incubated with HRP-conjugated secondary antibodies (diluted 1:3,000). The bands were visualized using the Pierce ECL Western Blotting Substrate (Thermo).