Heparanase is required for activation and function of macrophages

Significance

The tumor microenvironment is now considered to play a major role in cancer growth and metastasis. Heparanase is the only enzyme in mammals capable of cleaving heparan sulfate, an activity that is highly implicated in tumor growth, metastasis, and inflammation. Here we provide evidence that heparanase is critically required for the activation and function of macrophages, an important constituent of the tumor microenvironment. Mechanistically, we describe a linear cascade by which heparanase activates Erk, p38, and JNK signaling in macrophages, leading to increased c-Fos levels and induction of cytokine expression in a manner that apparently does not require heparanase enzymatic activity. These results identify heparanase as a key mediator of macrophage activation and function in tumorigenesis and cross-talk with the tumor microenvironment.

Abstract

The emerging role of heparanase in tumor initiation, growth, metastasis, and chemoresistance is well recognized and is encouraging the development of heparanase inhibitors as anticancer drugs. Unlike the function of heparanase in cancer cells, very little attention has been given to heparanase contributed by cells composing the tumor microenvironment. Here we used a genetic approach and examined the behavior and function of macrophages isolated from wild-type (WT) and heparanase-knockout (Hpa-KO) mice. Hpa-KO macrophages express lower levels of cytokines (e.g., TNFα, IL1-β) and exhibit lower motility and phagocytic capacities. Intriguingly, inoculation of control monocytes together with Lewis lung carcinoma (LLC) cells into Hpa-KO mice resulted in nearly complete inhibition of tumor growth. In striking contrast, inoculating LLC cells together with monocytes isolated from Hpa-KO mice did not affect tumor growth, indicating that heparanase is critically required for activation and function of macrophages. Mechanistically, we describe a linear cascade by which heparanase activates Erk, p38, and JNK signaling in macrophages, leading to increased c-Fos levels and induction of cytokine expression in a manner that apparently does not require heparanase enzymatic activity. These results identify heparanase as a key mediator of macrophage activation and function in tumorigenesis and cross-talk with the tumor microenvironment.

Heparanase is an endo-β-glucuronidase that cleaves heparan sulfate (HS) side chains presumably at sites of low sulfation. Traditionally, heparanase activity was correlated with the metastatic potential of tumor-derived cells, attributed to enhanced cell dissemination as a consequence of HS cleavage and remodeling of the extracellular matrix (ECM) barrier (1, 2). Intensive research efforts over the last decade have revealed that heparanase expression is up-regulated in an increasing number of human carcinomas and hematologic malignancies. In many cases, heparanase induction correlates with increased tumor metastasis, vascular density, and shorter postoperative survival of cancer patients (3–6), providing strong clinical support for the protumorigenic function of the enzyme and encouraging the development of heparanase inhibitors as anticancer drugs (3, 7, 8). More recent studies have provided compelling evidence associating heparanase level with all stages of tumor formation, including tumor initiation, growth, metastasis, and chemoresistance (9–14).

Although heparanase up-regulation by tumor cells is well documented, the protumorigenic contribution of heparanase provided by cells composing the tumor microenvironment has not been sufficiently explored. We recently reported that heparanase-neutralizing polyclonal and monoclonal antibodies attenuated the growth of myeloma and lymphoma cells within bones (14). Notably, the neutralizing antibodies also attenuated the growth of Raji lymphoma cells, which do not express heparanase owing to methylation of the gene, implying that neutralization of heparanase contributed by the tumor microenvironment is sufficient to restrain tumor growth (14).

The carcinoma microenvironment includes nontransformed epithelial cells, fibroblasts, endothelial cells, and infiltrated immune cells. Endothelial cells lining blood and lymph vessels are major component of the tumor microenvironment, and antiangiogenesis therapy, targeting vascular endothelial growth factor (VEGF) or its receptor (VEGFR2), is implemented clinically (15). In addition, recent research has revealed the critical roles of inflammatory responses in different stages of tumor development and metastasis (16).

The most plentiful immune cells within the tumor microenvironment are tumor-associated macrophages (TAMs) (16, 17). Functionally, two distinct states have been described for macrophages: M1 (or classically activated) and M2 (or type II, alternatively activated). The M1 phenotype is proinflammatory and characterized by the release of inflammatory cytokines (e.g., IL-1β, TNFα), reactive nitrogen and oxygen intermediates, and microbicidal/tumoricidal activity. In contrast, M2 macrophages are polarized by anti-inflammatory molecules (e.g., IL-4, IL-13) and support angiogenesis, tissue remodeling, and repair (18, 19). Thus, macrophages are thought to play a dual role in tumor growth, initiating an immune response against transformed cells on the one hand and promoting tumor growth and angiogenesis on the other hand (20–23).

Here we used a genetic approach to examine the behavior and function of macrophages isolated from wild-type (WT) and heparanase-knockout (Hpa-KO) mice (24). Hpa-KO macrophages express lower levels of cytokines (e.g,, TNFα, IL-1β) previously shown to be induced by the addition of heparanase or1its overexpression (25), and appear less motile. Inoculating control monocytes (CD11b⁺) together with Lewis lung carcinoma (LLC) cells into Hpa-KO mice resulted in nearly complete inhibition of tumor growth. In striking contrast, inoculating LLC cells together with monocytes isolated from Hpa-KO mice did not affect tumor growth, suggesting that heparanase is required for the proper activation and function of macrophages.

Results

Reduced Cytokine Expression by Hpa-KO Macrophages.

We have previously shown that the exogenous addition or overexpression of heparanase activates macrophages and stimulates cytokine expression (25). Here we examined the expression profile of selected cytokines in macrophages isolated from WT mice and Hpa-KO mice. We first established that WT macrophages exhibited typically high levels of heparanase activity (Fig. 1A, Left), comparable with or even greater than the activity in tumor-derived cells (Fig. 1A, Right), whereas Hpa-KO macrophages lacked such activity (Fig. 1A, Left). We also found that the expression of most cytokines examined was reduced significantly in Hpa-KO macrophages (Fig. 1B). Using a cytokine antibody array, we found corresponding reduced cytokine levels (i.e., MIP-2, TNFα, CXCL1, BLC) in medium conditioned by Hpa-KO vs. control macrophages (Fig. S1A), in agreement with the PCR analyses. Similarly, cytokine expression was reduced in macrophages isolated from mice treated with heparanase-neutralizing antibodies (#1453, 1023; Fig. 1C) (14). Notably, Hpa-KO macrophages respond to the exogenous addition of heparanase, and cytokine expression is increased to levels comparable to those in WT macrophages stimulated with heparanase (Table S1).

Fig. 1.

Reduced cytokine expression and motility of heparanase-deficient macrophages. (A) Heparanase activity. Cell exudates were collected from the peritoneum of control (WT) and Hpa-KO mice at 3 d after thioglycolate administration. (Left) After washing, cells (2 × 10⁶) were lysed by three freeze/thaw cycles, and cell lysates were applied on sulfate-labeled ECM dishes. Determination of heparanase activity was carried out as described in Materials and Methods. (Right) Heparanase activity was evaluated similarly in freshly isolated WT macrophages (Mac) and an equal number (2 × 10⁶) of LLC cells. (B) Cytokine expression. Cell exudates were collected from the peritoneum of control (WT) and Hpa-KO mice at 3 d after thioglycolate administration. Cells were plated on tissue culture dishes, and nonadherent cells were removed after 24 h. Total RNA was extracted from the adherent macrophages, and corresponding cDNAs were subjected to quantitative real-time PCR analyses using a set of primers specific for the indicated cytokines. Cytokine expression in Hpa-KO macrophages is shown graphically in relation to the level in control macrophages set arbitrarily to a value of 1. Note that the expression level of most cytokines is reduced in Hpa-KO macrophages. *P < 0.04. (C) WT C57BL/6 mice were administrated with the indicated anti–heparanase-neutralizing antibody (250 µg/mouse) or control rabbit IgG (Control) 30 min before the administration of thioglycolate. Cell exudate was collected 3 d later, and cytokine expression was evaluated as above. Note the reduced cytokine expression by peritoneal macrophages following treatment with the heparanase-neutralizing antibodies. *P < 0.02. (D) Heparanase small-molecule inhibitor. Cell exudate collected from WT mice was plated on tissue culture dishes for 24 h. The dishes were then washed, and macrophages were incubated under serum-free conditions without (0) or with latent heparanase (1 µg/mL) in the absence (Hepa) or presence of OGT2115 small-molecule heparanase inhibitor (10 µg/mL). Total RNA was extracted after 6 h, and expression of the indicated cytokines was evaluated by real-time PCR. Note that cytokine induction by heparanase is not significantly affected by OGT2115. (E and F) Cell motility. Cell exudate collected from the peritoneum of thioglycolate-treated control (WT) and Hpa-KO mice was plated on inserts coated with fibronectin (cell migration, 3 h; E) or Matrigel (cell invasion, 48 h; F). After washing, macrophages were maintained in serum-free medium, and chemoattraction was initiated by adding medium supplemented with 10% FCS to the lower compartment. (Upper) Quantification of cell migration (E) and invasion (F). (Lower) Representative images of migrating (E) and invading (F) cells. (G) Quantification of cells collected from the peritoneum. Thioglycolate was administrated to control (WT; n = 15) and Hpa-KO (n = 14) mice, and cell exudate was collected from the peritoneum 3 d later. Red blood cells were removed, and remaining cells were counted. The number of Hpa-KO cells is presented graphically as the percentage of cells collected from control mice.

Fig. S1.

(A) Cytokine array. Medium conditioned by macrophages collected from thioglycolate-treated control or Hpa-KO macrophages was applied on cytokine array membrane and detection was carried out as instructed by the manufacturer (R&D Systems). Cytokines noted to be altered are circled. (Right) Quantification of the dot intensities. (B) Phagocytosis. Cell exudates were collected from the peritoneum of WT (Con) and Hap-KO mice at 3 d after thioglycolate administration. Cell exudates (2 × 10⁴) were plated on fibronectin-coated 96-well plates for 24 h, and after washing, zymosan-coated fluorescent bioparticles (10 µL) were added to each well. The appearance of fluorescent signal was monitored over time using the Essen IncuCyte ZOOM system. (C and D) FACS analyses. (C) LLC cells (5 × 10⁵) were implanted s.c. in control and Hpa-KO mice. At termination, tumors were excised, and single-cell suspensions were prepared and subjected to FACS analyses. Shown are the FACS analyses for tumor-associated T cells, macrophages (Mac), and neutrophils. (D) Control (LLC-Vo) and MIP-2–overexpressing (LLC-MIP2) LLC cells (5 × 10⁵) were implanted s.c. in control (WT) and Hpa-KO mice. At termination, tumors were excised, and single-cell suspensions were prepared and subjected to FACS analyses for tumor-associated macrophages (F4/80).

Table S1.

Heparanase (5 µg/mL) stimulates cytokine expression to comparable levels in control (WT) and KO macrophages

Cytokine	WT	WT+Hepa, fold increase	KO	KO+Hepa, fold increase
TNFα	1	128 ± 19	0.63 ± 0.17	123 ± 6.6
IL-6	1	161 ± 55	0.3 ± 0.13	106 ± 67
IL-1β	1	35.8 ± 5.3	0.24 ± 0.07	154 ± 64
MIP-2	1	112 ± 19	0.2 ± 0.1	53.2 ± 34

Cytokine induction does not seem to require heparanase enzymatic activity, because cytokines were induced to comparable levels also in the presence of a small-molecule heparanase inhibitor, OGT2115 (Fig. 1D). Moreover, the migration (Fig. 1E), invasion (Fig. 1F), and phagocytic (Fig. S1B) capacities of Hpa-KO macrophages were decreased compared with WT macrophages. Indeed, fewer monocytes were collected from the peritoneum of Hpa-KO mice after treatment with thioglycolate (Fig. 1G). These results indicate that heparanase is expressed by macrophages and plays a prominent role in their activation, as evidenced by reduced cytokine expression, cell motility, and phagocytosis in Hpa-KO macrophages.

Heparanase from the Tumor Microenvironment Supports Tumor Growth.

To reveal the significance of heparanase contributed by the tumor microenvironment for tumor growth, we implanted LLC cells s.c. in WT and Hpa-KO mice and examined tumor growth. The tumors that developed in the Hpa-KO mice were twofold smaller than those seen in the WT mice (mean, 0.47 ± 0.15 mm vs. 1.3 ± 0.2 mm; P = 0.03) (Fig. 2A). FACS analyses showed that decreased tumor growth was associated with lower numbers of macrophages (P = 0.05; Fig. 2B and Fig. S1C) and T cells (P = 0.01) (Fig. 2C and Fig. S1C) in tumors that developed in Hpa-KO mice compared with those in WT mice. In contrast, the number of neutrophils was not significantly altered (Fig. 2D and Fig. S1C).

Fig. 2.

Host heparanase affects tumor growth. (A–E) Tumor growth in WT vs. Hpa-KO mice. LLC cells (0.5 × 10⁶) were implanted s.c. in control (WT) or Hpa-KO mice (n = 7). At termination, tumors were excised and weighed (A), and single-cell suspension were prepared and subjected to FACS analyses. Graphical representations of macrophages, T cells, and neutrophils in WT and Hpa-KO tumors are shown in B, C, and D, respectively. For BM transplantation (E), WT mice were lethally irradiated, and the BM was replaced with BM cells (5 × 10⁶) collected from WT (WT-WT; n = 6) or Hpa-KO (KO-WT; n = 6) tibias. LLC cells were implanted s.c. 6 wk later, and tumor weight was examined at termination. Note the modest yet statistically significant decrease in tumor weight in the absence of heparanase in BM-derived cells. (F–H) MIP2 overexpression. LLC cells were transfected with MIP2 or an empty vector (Vo), and stably transfected cells were implanted s.c. in WT (n = 6) and Hpa-KO (KO; n = 6) mice. At termination, tumors were excised, weighed (F, Upper), photographed (F, Lower), and fixed in formalin for histological evaluation. Portions of each tumor were taken for RNA extraction and for the preparation of single-cell suspensions and FACS analyses. The number of tumor-resident F4/80-positive macrophages detected by FACS and quantitative real-time PCR analyses for F4/80 and lysozyme 1 are shown graphically in G, Upper and Lower, respectively). (H) Sections of tumor xenografts produced by LLC cells overexpressing MIP2 and implanted in WT or Hpa-KO (KO) mice were subjected to immunostaining applying rat anti-mouse F4/80 antibody. Shown are representative photomicrographs taken at low (4×) magnification (Upper) and high (10×) magnification at the tumor periphery (Middle) and center (Lower). Note that MIP2 overexpression restrains tumor growth in WT mice but not in Hpa-KO mice, associated with a robust increase in macrophage activation, as evidenced by lysozyme 1 expression in WT mice vs. lower induction in Hpa-KO mice. In Hpa-KO mice, macrophages reside mainly in the tumor periphery and fail to populate the tumor mass.

To examine the role of bone marrow (BM)-derived cells in the reduced tumor growth in Hpa-KO mice, WT mice were lethally irradiated, the BM was substituted with BM cells collected from WT (WT-WT) or Hpa-KO (KO-WT) mice, and, following recovery, LLC cells were implanted. Notably, tumor growth was reduced in KO-WT compared with WT-WT mice (P = 0.04) (Fig. 2E), suggesting that the decreased tumor growth in Hpa-KO mice is due in part to the lack of heparanase in BM-derived cells that constitute the tumor microenvironment.

Macrophages Are Trapped at the Periphery of Tumors Developed in Hpa-KO Mice.

We noted that among the cytokines examined, the expression of macrophage inflammatory protein 2-alpha (MIP-2 = CXCL2) was prominently reduced in Hpa-KO macrophages (Fig. 1B and Fig. S1A). This cytokine is highly implicated in macrophage attraction (26), possibly connected to reduced cell motility (Fig. 1G) and lower numbers of macrophages in Hpa-KO tumors (Fig. 2B). To examine this aspect in the context of tumor growth, we transfected LLC cells with MIP-2 gene construct and confirmed a high level of expression by real-time PCR (Fig. S2A). Interestingly, after implantation in WT mice, MIP-2 overexpression resulted in a marked decrease in tumor weight (P = 0.004) (Fig. 2F). In striking contrast, tumor weight was not affected by MIP-2 overexpression once cells were implanted in Hpa-KO mice (Fig. 2F). FACS (Fig. 2G, Upper and Fig. S1D) and real-time PCR (Fig. 2G, Lower) analyses revealed that the number of macrophages in tumors developed by LLC–MIP-2 cells was increased by twofold to threefold compared with control cells (LLC-Vo; Fig. 2G), as expected, but appeared to be similar in magnitude in WT and Hpa-KO mice (Fig. 2G, Upper). Likewise, greater numbers of the classic M1/M2-type macrophages (Fig. S2 B and C), CD4 cells, and CD8 T cells (Fig. S3, Upper and Middle) were quantified following MIP-2 overexpression, but again appeared to be comparable in WT and Hpa-KO mice, whereas the number of neutrophils was not altered (Fig. S3, Lower).

Fig. S2.

Control (Vo) and MIP-2–overexpressing (MIP2) LLC cells (5 × 10⁵) were implanted s.c. in control (WT) and Hpa-KO mice. At termination, tumors were excised, and total RNA was extracted from a portion of the tumors and subjected to PCR analysis for MIP-2 expression. (A) Quantitative real-time PCR analyses for MIP-2. (B and C) Single-cell suspensions were prepared from another portion of the resulting tumors and subjected to FACS analyses. Shown are the FACS analyses for tumor-associated M1 (CD11c; B) and M2 (CD206; C) macrophages. (Right) Quantitation of M1 and M2 macrophages in the resulting tumors.

Fig. S3.

Control (Vo) and MIP-2–overexpressing (MIP2) LLC cells (5 × 10⁵) were implanted s.c. in control (WT) and Hpa-KO mice. At termination, tumors were excised, and single-cell suspensions were prepared and subjected to FACS analyses for tumor-associated CD4 (Upper), CD8 (Middle), and neutrophils (Lower). (Right) Graphical representation of cell numbers.

In striking contrast, macrophage cytotoxic activity, evidenced by lysozyme 1 expression (27), was dramatically increased in WT compared with Hpa-KO macrophages (Fig. 2G, Lower). Thus, whereas MIP-2 overexpression resulted in a >24-fold increase in lysozyme 1 levels in tumors developed by LLC–MIP-2 cells vs. control (LLC-Vo) cells in WT mice, only a 7.7-fold increase was induced by the same cells in tumors developed in Hpa-KO mice (Fig. 2G, Lower Right; lysozyme 1), a highly statistically significant difference (P = 0.004). This results suggests that in the absence of heparanase, macrophages are not properly activated by MIP-2.

Immunostaining further revealed that in tumors produced by LLC–MIP-2 cells in WT mice, macrophages were detected throughout the tumor mass (Fig. 2H, Left). In striking contrast, macrophages were detected primarily at the periphery of tumors developed in Hpa-KO mice (Fig. 2H, Right). These results indicate that in the absence of heparanase, macrophages are not fully activated (lysozyme 1) and do not populate the tumors, in accordance with their inability to attenuate tumor growth.

Hpa-KO Macrophages Do Not Attenuate Tumor Growth.

Given that Hpa-KO macrophages failed to penetrate LLC–MIP-2 tumors (Fig. 2H), we decided to implant freshly isolated monocytes/macrophages together with LLC cells, thereby populating the tumor with macrophages. To this end, cell exudates collected from the peritoneum of WT mice (Fig. 3A, Upper) and Hpa-KO mice (Fig. 3A, Lower) after thioglycolate treatment were subjected to FACS analyses. These exudates contained >90% CD11b⁺ cells (i.e., monocytes) (Fig. 3A, Left) (28), but no CD8 T cells (Fig. 3A, Right).

Fig. 3.

Tumor elimination by WT, but not heparanase-deficient, monocytes. (A) FACS analyses. Cell exudate, collected from the peritoneum of WT (Upper) and Hpa-KO (Lower) mice 3 d after thioglycolate injection, was subjected to FACS analyses using antibodies directed against CD11b (monocytes), F4/80 (macrophages), and CD8-a (CD8 T cells). Note that the cell exudate comprised primarily monocytes (CD11b⁺), but no CD8⁺ T cells. (B–D) Coinjection of LLC and monocytes. LLC cells (3.5 × 10⁵) were implanted in Hpa-KO mice without (LLC; n = 9) or with an equal number of monocytes collected from thioglycolate-treated WT (+Con; n = 6) or Hpa-KO mice (+KO; n = 7). At termination, tumors were excised, weighed (B, Upper), and photographed (B, Lower). Tumor portions were taken for RNA extraction, and the remaining tumors were fixed in paraffin for histological evaluation. (C) Quantitative real-time PCR analyses for macrophages number (F4/80) and activity (i.e., lysozyme 1 and 2) in LLC+Con and LLC+KO tumors shown graphically in relation to LLC-alone tumors set arbitrarily to a value of 1. (D) Real-time PCR analyses for (from top to bottom) the number of CD8 T cells, NK cell number (NK1.1) and activity (granzyme B, perforin), dendritic cell number (Langerin; DC-SIGN), and neutrophils (Ly6G) in LLC alone, with control or KO macrophages. Note the marked attenuation of tumor growth by coinjection of LLC cells with control monocytes, associated with a robust activation of macrophages, T cells, and NK cells. In contrast, coinjection of LLC with KO monocytes failed to activate immune cells and affect tumor growth.

We then mixed WT and Hpa-KO monocytes with LLC cells in a 1:1 ratio and implanted these cells in Hpa-KO mice. LLC cells implanted without monocytes served as a control for the effect of the introduced monocytes. Implantation of WT monocytes together with LLC cells resulted in a prominent (10-fold) decrease in tumor growth (Fig. 3B). In striking contrast, implantation of Hpa-KO monocytes together with LLC cells had no effect on tumor growth (Fig. 3B). The remarkable decrease in tumor growth by the introduction of control monocytes (LLC+Con) was associated with a marked activation of macrophages (Fig. 3C; lysozymes 1 and 2) and natural killer (NK) cells (Fig. 3D; granzyme B, perforine), as well as a significant increase in the recruitment of CD8 T cells and dendritic cells (Fig. 3D), which together likely created a strong antitumor effect, halting tumor growth.

None of these parameters was affected by Hpa-KO macrophages (Fig. 3 C and D). Unlike these cell populations, the number of neutrophils in the tumor xenografts was not altered significantly by the introduction of monocytes (Fig. 3D, Lower), as was noted in the MIP-2 overexpression model system (Fig. S3, Lower). The cytokines most evidently induced in the LLC+Con tumors were TNFα and SDF1 (Fig. 4A), possibly suggesting that these cytokines mediate the killing effect and elimination of LLC tumors. Indeed, we found that heparanase (Fig. 4B, Left), as well as TNFα, MIP2, and SDF1 (Fig. 4B, Right), increased the phagocytic capacity of macrophages, thereby facilitating antigen presentation and enhancing antitumor immune responses.

Fig. 4.

The cytokines TNFα and SDF1 prevail in LLC+Con small tumors. (A) Cytokine expression. Total RNA was extracted from LLC, LLC+Con, and LLC+KO tumors, and corresponding cDNAs were subjected to quantitative real-time PCR analyses using primer sets specific for the indicted cytokines. Expression levels of the cytokines in LLC+Con and LLC+KO tumors is shown graphically in relation to their levels in LLC tumors, set arbitrarily to a value of 1. *P < 0.02. (B) Phagocytosis. Cell exudates were collected from the peritoneum of control WT mice, plated on fibronectin-coated 96-well dishes (2 × 10⁴) for 24 h. After washing, zymosan-coated fluorogenic bioparticles (5 µL) were added to each well. Macrophage phagocytosis capacity was quantified in the absence (Con) or presence of heparanase (Hepa; 1 µg/mL), TNF-α (20 ng/mL), MIP-2 (20 ng/mL), or SDF1 (50 ng/mL). (C) Immunostaining. Here 5-μm sections of tumor xenografts produced by LLC, LLC+Con, and LLC+KO cells were subjected to immunostaining, applying anti-F4/80 antibody. Note that unlike in LLC and LLC+KO tumors, in LLC+Con tumors macrophages populate the entire tumor lesion, correlating with a marked decrease in tumor growth (Fig. 3B). (D) LLC cells (3.5 × 10⁵) were added to an equal number of monocytes collected from the peritoneum of thioglycolate-treated control (WT) or Hpa-KO mice, and cells were implanted in C57BL/6 WT mice. Shown is tumor weight at termination. Note that after implantation in WT mice, the introduction of monocytes has no effect on tumor growth.

Immunostaining also revealed alterations in F4/80-positive macrophage localization in this experimental setting. Whereas macrophages were localized primarily in the periphery of LLC tumors (Fig. 4C), in agreement with our previous results (Fig. 2H), the introduction of control, but not Hpa-KO macrophages, reduced the accumulation of macrophages in the tumor periphery and macrophages appeared to populate the entire tumor mass (Fig. 4C). Notably, when the same experimental procedure was repeated in WT mice, the introduced monocytes had no effect on tumor growth (Fig. 4D), strongly implying that tumor development and elimination critically depend on heparanase contributed by the host. More specifically, the differentiation of CD11b⁺ monocytes to kill-type macrophages and the elimination of LLC tumors apparently require heparanase.

Cytokine Induction by Heparanase Involves the p38 and JNK Signaling Pathways.

To further reveal the molecular mechanism underlying cytokine induction by heparanase, we isolated macrophages from WT and Hpa-KO mice and exposed them to heparanase added exogenously. As reported previously (25), the addition of heparanase stimulated the phosphorylation of Erk in WT macrophages, and even greater increases were seen in Hpa-KO macrophages (Fig. 5A). Notably, however, the addition of heparanase together with the inhibitor of this signaling pathway resulted in only a modest (i.e., twofold) decrease in cytokine expression by heparanase, with the exception of IL-1β expression, which was reduced more significantly (Fig. 5B), suggesting that cytokine induction by heparanase is regulated by other signaling pathways. Indeed, we found that heparanase enhances the phosphorylation levels of p38 (Fig. 5C and Fig. S4A) and JNK (Fig. 5C and Fig. S4B), as is also evident on immunofluorescent staining (Fig. S4C), and exhibits dose-dependency (Fig. S4D). Notably, induction of all of the examined cytokines except IL-1β by heparanase was significantly attenuated by JNK inhibition (Fig. 5D), whereas inhibition of p38 attenuated the induction of IL-1β, but not of the other cytokines (Fig. 5E). This suggests that Erk, p38, and JNK signaling each regulates the induction of a different set of cytokines by heparanase.

Fig. 5.

Cytokine induction by heparanase is mediated by the Erk, p38, and JNK signaling pathways. (A and C) Immunoblotting. Cell exudates were collected from WT and Hpa-KO (KO) mice at 3 d after thioglycolate administration and plated on tissue culture dishes. After 24 h, the dishes were washed, and adhering macrophages were incubated under serum-free conditions for 24 h. Heparanase (5 µg/mL) was then added, and cell lysates were prepared at the indicated time points. Lysate samples were subjected to immunoblotting, applying anti–phospho-ERk (A, Upper), phospho-p38 (p-p38; C, Upper), phospho-JNK (pJNK; C, Middle), and anti-actin (C, Lower) antibodies. (B, D, and E) MEK, JNK, and p38 inhibitors. Heparanase (5 µg/mL) was added to adhering Hpa-KO macrophages alone (Hepa) or 30 min after the addition of MEK (B; PD98059; 30 µg/mL), JNK (D; sp600125; 20 µg/mL), or p38 (E; SB203580; 20 µg/mL) inhibitors. Total RNA was extracted after 6 h, and corresponding cDNAs were subjected to quantitative real-time PCR analyses, applying primer sets specific for the indicated cytokines. Cytokine expression is shown graphically in relation to the levels in control untreated macrophages (Con), set arbitrarily to a value of 1. *P < 0.01. (F) Heparanase enhances Fos expression. (Left) Total RNA was extracted from adhering macrophages isolated from thioglycolate-treated WT (Con) and Hpa-KO (KO), mice and corresponding cDNAs were subjected to quantitative real-time PCR analyses applying primer sets specific for c-Fos and c-Jun. Note the decreased c-Fos, but not c-Jun, expression in Hpa-KO macrophages. (Right) C-Fos and c-Jun expression were similarly examined in adhering macrophages following addition of heparanase (5 µg/mL) for 30 min in relation to control untreated macrophages (Con), set arbitrarily to a value of 1. Note that only c-Fos expression was induced by exogenous heparanase. *P = 0.02. (G) c-Fos induction by heparanase involves the Erk, JNK, and p38 signaling pathways. Heparanase (5 µg/mL) was added to adhering Hpa-KO macrophages alone (Hepa) or 30 min after the addition of JNK (sp600125), p38 (SB), or both JNK and p38 (Hepa+sp600+SB) inhibitors. Macrophages were also incubated with the inhibitors each alone and in combination without heparanase. Total RNA was extracted after 30 min, and corresponding cDNAs were subjected to quantitative real-time PCR analyses applying primer sets specific for c-Fos. c-Fos expression is shown graphically in relation to its level in control untreated macrophages (Con), set arbitrarily to a value of 1. Note that c-Fos induction by heparanase is prevented by the JNK inhibitor and to a lesser extent by the p38 inhibitor. (H) Quantitative real-time PCR analysis of Fos expression in tumors generated by LLC, LLC+Con, and LLC+KO cells. Note that cytokine induction in LLC+Con tumors (Fig. 4A) correlates with increased c-Fos expression.

Fig. S4.

(A and B) p38 and JNK phosphorylation by heparanase. Cell exudates were collected from control (WT) and Hpa-KO (KO) mice at 3 d after thioglycolate administration and plated on tissue culture dishes. After 24 h, the dishes were washed, and adhering macrophages were incubated with heparanase (5 µg/mL) under serum-free conditions. Cell lysates were prepared at the indicated time points and subjected to immunoblotting, applying anti–phospho-p38 (pp38) and anti– phospho-JNK (pJNK) antibodies. The extent of p38 (A) and JNK (B) phosphorylation was quantified by densitometry analyses at each time point compared with control, nontreated cells. (C) Immunofluorescent staining. Cell exudates were collected from WT mice at 3 d after thioglycolate administration and plated on fibronectin-coated coverslips. After 24 h, cells were washed, and adhering macrophages were incubated without (Con) or with heparanase (5 µg/mL) under serum-free conditions for 30 min. The cells were fixed with cold methanol and subjected to immunofluorescent staining, applying anti–phospho-p38 (pp38; Upper, green) and anti–phospho-JNK (pJNK; Lower, green) antibodies. Nuclear counterstaining is shown in red. (D) Macrophages were incubated with the indicated concentration of heparanase for 15 min, and Erk, JNK, and p38 phosphorylation was evaluated by immunoblotting. (E) The c-Fos–luciferase reporter gene was transfected to 293 cells without (Con) or with heparanase gene construct for 24 h. The cells were then washed, and luciferase activity was quantified after a 5-h incubation in serum-free medium. A graphic representation of increased luciferase activity by heparanase is shown. (F) c-Fos induction by heparanase involves the Erk signaling pathways. Heparanase (5 µg/mL) was added to adhering Hpa-KO macrophages alone (Hepa) or 30 min after addition of the PD98059 Erk inhibitors (PD). Total RNA was extracted after 30 min, and corresponding cDNAs were subjected to quantitative real-time PCR analyses, applying primer sets specific for c-Fos. c-Fos expression is shown graphically in relation to its level in control untreated macrophages (Con), set arbitrarily to a value of 1.

Given the numerous cytokines regulated by heparanase (Fig. 1 A–C), we sought a common transcription factor that mediates cytokine gene regulation. Applying nuclear extracts of WT and Hpa-KO macrophages on a transcription factors array revealed that the DNA-binding capacity of several transcription factors was decreased in Hpa-KO macrophages compared with WT macrophages, whereas that of other transcription factors was increased (Table S2). At the transcriptional level, we could only validate decreased expression of the AP1 (c-Fos) transcription factor in Hpa-KO macrophages. Notably, the expression of c-Fos, but not of c-Jun, was decreased in Hpa-KO macrophages (Fig. 5F, Left). Likewise, c-Fos expression was increased after the exogenous addition of heparanase to Hpa-KO macrophages (Fig. 5F, Right), suggesting that c-Fos is the AP1 transcription factor relevant to the observed cytokine induction by heparanase.

Table S2.

DNA-binding capacity of transcription factors in control vs. Hpa-KO macrophages

Factor	Ratio (Control:KO)
AP-1	35.7
Pit	48.89
NRF2(ARE)	146.08
Pax2	122.5
RNUX	9.87
SOX18	72
FOXG1	0.02
FOXO1 (FKHR)	0.03
STAT4	0.015
STAT5	0.05
STAT6	0.048
AP4	0.059
OCT1	0.006
SOX9	0.002
HSF	0.08
Gli-1	0.08
OCT4	0.005
Sp1	0.05
TCF/LEF	0.04
ELK	0.04
p53	0.08
YY1	0.0016
Myb	0.02
Nkx3-2	0.02
Pbx1	0.09
TFIID	0.038
WT1	0.029

We used a c-Fos promoter-luciferase reporter gene and found induction of luciferase activity after cotransfection of this reporter and heparanase gene constructs (Fig. S4E). Moreover, we found that c-Fos levels were increased after the addition of heparanase to WT macrophages, but this elevation was only modestly attenuated by the MEK inhibitor (Fig. S4F). In contrast, c-Fos induction by heparanase was markedly attenuated by the JNK inhibitor, and appeared to be most prominent when the JNK and p38 inhibitors were combined (P = 0.04) (Fig. 5G). Notably, c-Fos expression was increased in parallel with the induction of cytokine expression when LLC cells were inoculated together with control macrophages (Fig. 5H). These results suggest a linear cascade by which heparanase activates Erk, p38, and JNK signaling, leading to increased c-Fos levels and induction of cytokine expression.

Discussion

The role of heparanase in tumor initiation, growth, metastasis, and chemoresistance is emerging, and is encouraging the development of heparanase inhibitors as anticancer drugs (3, 8). Unlike the function of heparanase in cancer cells, very little attention has been given to heparanase contributed by cells composing the tumor microenvironment. We recently reported that heparanase-neutralizing monoclonal antibodies attenuate the growth of human lymphoma cells by targeting heparanase activity contributed by cells of the tumor microenvironment (14), but the nature of these cells has not been characterized. Once implanted in Hpa-KO mice, LLC cells developed significantly smaller tumor xenografts compared with those seen in control WT mice (Fig. 2A), associated with reduced numbers of tumor-associated macrophages (Fig. 2B) and T cells (Fig. 2C and Fig. S1C). Even greater attenuation of tumor growth was noted in El-4 lymphoma cells implanted in Hpa-KO mice compared with control mice (Fig. S5A). Reduced LLC tumor growth after replacement of WT BM with Hpa-KO BM cells (Fig. 2E) suggests that the attenuation of tumor growth in Hpa-KO mice is mediated in part by BM-derived cells that populate the tumor microenvironment.

Fig. S5.

(A) El-4 mouse lymphoma cells (1.5 × 10⁵) were implanted s.c. in WT (Con) and Hap-KO mice, and tumor volume was inspected over time (Upper). At termination, tumors were excised and weighed (Lower). (B) Splenocytes. Spleens were harvested from WT (Con) and Hpa-KO mice. Total RNA was extracted from isolated splenocytes and subjected to quantitative real-time PCR analyses, applying primer sets for the indicated cytokines. (C) Heparanase activity. Active heparanase (100 ng) was applied on sulfate-labeled dishes without (Control) or with OGT2115 (10 µg/mL), and the release of sulfate-labeled HS degradation fragments to the assay buffer was evaluated after 18 h, as described in Materials and Methods. Note the complete inhibition of heparanase enzymatic activity by OGT2115. (D) Macrophages (2 × 10⁶) isolated from WT mice were left untreated (Control) or were incubated with OGT2115 (50 µg/mL) for 18 h. Cells were then collected and subjected to three freeze/thaw cycles, and the resulting extracts were applied on sulfate-labeled dishes. The release of sulfate-labeled HS degradation fragments to the assay buffer was evaluated after 24 h, as described in Materials and Methods.

Although T cells likely to play a role in this tumor model (Fig. 2C) (29), in this work we chose to focus on macrophages because previous studies have shown that heparanase, when added exogenously or stably transfected, activates macrophages to stimulate cytokine expression (25). Similarly, macrophages isolated from tumor xenografts produced by Panc-1 cells overexpressing heparanase were found to be more highly activated than macrophages isolated from control tumors (30). Here we found that macrophages exhibited high levels of heparanase activity (Fig. 1A), but no heparanase activity was detected in macrophages of Hpa-KO mice. Importantly, the expression of most cytokines examined, including, among others, TNFα, IL-1β, IL-10, and IL-6, was reduced in Hpa-KO macrophages compared with control macrophages (Fig. 1B), and reduced cytokine levels were similarly quantified in the culture medium conditioned by Hpa-KO macrophages compared with WT macrophages (Fig. S1A).

Whereas the expression of heparanase is increased in many types of tumors, often associated with more aggressive disease and poor prognosis (4, 5, 31), so far the role of heparanase under normal conditions has not been resolved in settings other than autophagy (13). Our present results suggest that heparanase is intimately involved in the regulation of cytokine expression by macrophages, decisively affecting their function. Likewise, Hpa-KO macrophages exhibit reduced motility capacity, critical for their surveillance nature (Fig. 1 E–G), in agreement with reduced infiltration of Hpa-KO neutrophils and eosinophils to lungs exposed to prolonged smoke exposure or subjected to an allergic inflammatory model, respectively (32, 33). Most appealingly, Hpa-KO macrophages exhibited reduced phagocytic capacity (Fig. S1B), the hallmark of macrophage function as antigen-presenting cells, whereas heparanase enhanced the phagocytic capacity of macrophages (Fig. 4B).

We further noted that the expression of MIP-2 (CXCL2), a chemokine that attracts macrophages to sites of inflammation, was prominently reduced in Hpa-KO macrophages (Fig. 1B), possibly explaining their reduced accumulation in the peritoneum (Fig. 1G), and also that CXCL1 levels were decreased in Hpa-KO macrophages (Fig. S1A, Right). Unexpectedly, overexpression of MIP-2 in LLC cells resulted in reduced tumor growth once cells were implanted in WT mice, but not in Hpa-KO mice (Fig. 2F). As expected, overexpression of MIP-2 in LLC cells (Fig. S2A) resulted in the recruitment of macrophages (Fig. 2G, Upper and Fig. S1D), as well as CD4 and CD8 T cells (Fig. S3), to the resulting tumors, but only at a magnitude comparable to that in WT and Hpa-KO mice, which cannot explain the differential tumor growth observed in the WT vs. the Hpa-KO background (Fig. 2F). Similarly, the differential tumor growth cannot be explained by the recruitment of M1/M2 macrophages (Fig. S2 B and C), but may be explained by the macrophage activation, as evidenced by lysozyme 1 expression. Thus, whereas lysozyme levels were induced by >24-fold by MIP-2 in WT mice, lysozyme induction was threefold lower in Hpa-KO mice (Fig. 2G, Lower). These results clearly show that Hpa-KO macrophages fail to respond to the antitumor effect of MIP-2, yet the therapeutic significance of MIP-2 as an antitumor agent clearly requires further in-depth investigation.

An even stronger antitumor response was evident when monocytes were implanted together with LLC cells in Hpa-KO mice. Strikingly, tumor growth was halted significantly by coimplantation of LLC cells with control monocytes (Fig. 3B), correlating with marked increases in the numbers and activation of tumor-associated macrophages (e.g., F4/80, lysozymes 1 and 2) (Fig. 3C). In striking contrast, coimplantation of Hpa-KO monocytes together with LLC cells had no effect on tumor growth (Fig. 3B) or macrophage recruitment and activation (Fig. 3C). Unlike in the MIP-2 model, coimplantation of LLC cells with control monocytes resulted in the recruitment and activation of T cells, NK cells, and dendritic cells (Fig. 3D), which likely assist in attenuating tumor growth, correlating with a marked induction of TNFα and SDF-1 (Fig. 4A). Taken together, these results indicate that heparanase is critically important for macrophage activation and function; in these experimental settings, macrophages are activated toward a kill phenotype.

Heterogeneity and plasticity have emerged as hallmarks of mononuclear phagocytes (19, 20, 34). Macrophages, like other immune effector cells, have multiple subtypes and various phenotypes depending on the microenvironment. Specifically, macrophages can differentiate to distinct entities classically referred to as M1/kill type, which can slow or stop tumor growth, and M2/repair type, which actively stimulate tumor growth (21, 23). This dichotomous phenotype may explain why macrophages can elicit a poor prognosis in some tumors and a better prognosis in others (i.e., non–small-cell lung cancer) (35, 36). In early tumors, TAMs appear to have proinflammatory, tumoricidal (M1 or “classically activated”) phenotype. These TAMs are phagocytic, present antigens well, produce Th1-type cytokines (e.g., IL-1β, TNFα), and are cytotoxic (18). They may also indirectly promote cytotoxicity by activating other cells of the immune system, such as NK cells and T cells (37). Nevertheless, as the tumor becomes established, macrophages polarize toward “alternatively activated” M2 macrophages that stimulate tumor cell proliferation, migration, angiogenesis, and metastasis (18, 20). The characterization of macrophages as terminally differentiated M1 vs. M2 cells is limited, however, because it describes the extremes of a continuum of functional states, whereas the extent of activation is likely to be dynamic, as occurs in the complex process of tumorigenesis (19). Here, instead we have used markers for the functional state of macrophages (lysozymes 1 and 2), as well as NK cells (granzyme, perforine) (Fig. 2G and Fig. 3) to more accurately assess their competence (27, 38).

Localization of macrophages within tumors appears to be critically important for their function and activation state (39–41). In the MIP-2 overexpression model, reduced macrophage activation in Hpa-KO tumors (Fig. 2G, Lower) was associated with accumulation of macrophages at the tumor periphery (Fig. 2H, Right). Thus, whereas WT and Hap-KO macrophages are attracted to the tumor at similar efficiencies (Fig. 2G, Upper), macrophage penetration and population of the entire tumor mass requires heparanase. Notably, inoculation of control macrophages together with LLC cells into Hpa-KO mice was sufficient to attract macrophages from the tumor periphery to populate the tumor lesion (Fig. 4C). This suggests that the high endogenous activity of heparanase in WT macrophages (Fig. 1A) is used by the Hpa-KO macrophages to penetrate the tumor or that heparanase functions, directly or indirectly (i.e., release of HS-bound chemokines) as chemoattractant. Alternatively, cytokines (e.g., SDF1) secreted by control macrophages may attract peripheral KO macrophages into the tumor. An association between reduced tumor growth and peripheral localization of macrophages has been described in other experimental models (41). Even more importantly, localization of macrophages to the tumor periphery (or tumor front) has been associated with a favorable prognosis in patients with colon cancer (39). This finding is in agreement with the idea that the functions of macrophages vary considerably according to their location within tumors. For example, macrophages are highly proangiogenic in necrotic and hypoxic tumor areas, but accumulation of macrophages in close proximity to well vascularized areas of the tumors correlates with a good prognosis (18, 40). Given the highly necrotic feature of LLC tumors in our experimental settings (Fig. 2H), localization of macrophages to necrotic areas facilitates their activation toward the M1/kill phenotype compared with reduced activation when accumulating at highly vascularized areas of the tumor periphery. Reduced cytokine expression was noted not only in macrophages, but also in cells isolated from Hpa-KO spleen (Fig. S5B). This finding is in agreement with reduced cytokine expression after heparanase gene silencing in T cells (42), whereas cytokine expression was markedly induced by the addition of heparanase to macrophages (Fig. 1D) or to peripheral blood mononuclear cells (25, 30, 43).

How heparanase stimulates cytokine expression is not entirely clear, but it does not seem to require enzymatic activity. We conclude this because cytokines were noted to be induced by heparanase also in the presence of a small-molecule inhibitor, OGT2115 (Fig. 1D), at concentrations that completely neutralize its enzymatic activity (Fig. S5C). In contrast, heparanase activity within macrophages was not affected by OGT2115 (Fig. S5D). This may imply that this compound is unable to cross the plasma membrane, enter lysosomes, or function in the acidic environment of the lysosome, or some other as-yet unidentified deficiency. The function of enzymatically inactive heparanase is in agreement with our previous report (25), but contradicts results presented by others (43). This discrepancy may be due to the use of different cells (mouse thioglycolate-stimulated macrophages vs. human peripheral blood mononuclear cells) or to differing assay conditions. For example, we applied relatively low concentrations of OGT2115 (10 µg/mL) for a short period (6 h) and examined gene expression, whereas Goodall et al. (43) applied much higher concentrations of OGT2115 (200 µg/mL) for a long period (24 h) and evaluated cytokine release.

Toll-like receptors (TLRs) have been identified to lie upstream the signaling cascade that leads to cytokine induction by heparanase (25, 43); however, the underlying molecular mechanism(s) and relevant transcription factor(s) have not yet been characterized. We found that heparanase stimulates the phosphorylation of Erk, p38, and JNK (Fig. 5 A and C) and, more importantly, that inhibition of these pathways practically blocks cytokine induction by heparanase (Fig. 5 B, D, and E). These findings are in agreement with the critical involvement of p38 and JNK signaling in the mediation of TLR responses leading to cytokine induction (44, 45). Using a transcription factors array, we found that AP1 expression is enhanced by heparanase, and validated that heparanase stimulates the expression of c-Fos, but not of c-Jun (Fig. 5F). Furthermore, c-Fos expression was elevated in parallel with the strong cytokine induction that accompanied the inoculation of control macrophages together with LLC cells (Fig. 5H), whereas c-Fos induction by heparanase was significantly reduced by inhibitors of p38 and JNK (Fig. 5G). This suggests a linear cascade that starts with heparanase-mediated TLR activation at the cell membrane, continues with Erk/p38/JNK activation, and leads to AP1-mediated gene transcription.

Taken together, our results reveal a role for endogenous heparanase in macrophage function. More specifically, our results strongly indicate that heparanase is critically important for macrophage activation. The outcome of macrophage activation in the experimental settings used in this study was tumor eradication, but it is likely that the same principle holds true in settings where activation of macrophages leads to tumor progression. Thus, heparanase inhibitors should be carefully used in cancer types (e.g., pancreatic carcinoma) (6) and conditions where macrophages play a protumorigenic function, but not in other types (e.g., non–small-cell lung carcinoma) (36) to preserve the antitumor function of macrophages.

Materials and Methods

Cells and Cell Culture.

LLC cells have been described previously (46). Mouse peritoneal monocytes/macrophages were harvested from the peritoneal fluid of WT or Hpa-KO C57BL/6 mice at 3 d after i.p. injection of thioglycolate (0.5 mL; 40 mg/mL), essentially as described previously (25). Peritoneal exudate cells (5 × 10⁶) were plated in a 60-mm dish for 24 h and then cultured in DMEM supplemented with glutamine, pyruvate, antibiotics, and 10% (vol/vol) FCS in a humidified atmosphere containing 5% (vol/vol) CO₂ at 37 °C. Nonadherent cells were removed after 24 h by washing, and the cells that remained attached were considered macrophages (25). Cell migration and invasion assays were performed essentially as described previously (47).

Cell Lysates, Heparanase Activity, and Protein Blotting.

Preparation of cell lysates, protein blotting, and measurement of heparanase enzymatic activity were carried out as described previously (13, 14, 48).

Real-Time PCR Analyses.

Total RNA was extracted with TRIzol (Sigma-Aldrich), and RNA (1 µg) was amplified using the One-Step PCR Amplification Kit (ABgene), according to the manufacturer's instructions. The PCR primer sets used in this study are listed in Table S3. Cytokine expression was normalized to actin. Data are expressed as the mean level of expression normalized to actin and represent the mean ± SEM of triplicate samples. The results are representative of three independent experiments (43).

Table S3.

Primer sets used in this study

Gene	Forward (5′-3′)	Reverse (5′-3′)
VEGF-A	GTACCTCCACCATGCCAAGT	GCATTCACATCTGCTGTGCT
VEGF-C	GAGGTCAAGGCTTTTGAAGGC	CTGTCCTGGTATTGAGGGTGG
MIP-2 (human)	TGCAGGTTCACCTCAAG	TGAGACAAGCTTTCTGCCCA
TNFα	TCAGCCTCTTCTCATTCCTG	TGAAGAGAACCTGGGAGTAG
IL-1β	TGAGCTGAAAGCTCTCCACC	CTGATGTACCAGTTGGGGAA
SDF-1	TGCATCAGTGACGGTAAACCA	TTCTTCAGCCGTGCAACAATC
CXCR-4	GACTGGCATAGTCGGCAATG	AGAAGGGGAGTGTGATGACAAA
IL-10	GCTCTTACTGACTGGCATGAG	CGCAGCTCTAGGAGCATGTG
IL-6	TAGTCCTTCCTACCCCAATTTCC	TTGGTCCTTAGCCACTCCTTC
MCP-1	GCCCAGCACCAGCACCAG	GGCATCACAGTCCGAGTCACAC
Actin	ATGCTCCCCGGGCTGTAT	CATAGGAGTCCTTCTGACCCATT
F4/80	GATACAGCAATGCCAAGCAGT	TTGTGAAGGTAGCATTCACAAGTGTA
Lysozyme 1 (Lyz1)	GATGGCTACCGTGGTGTCAA	AGCTCGTGTGTTATAATTGCTCTCA
Lysozyme 2 (Lyz2)	GTGCAAAGAGGGTGGTGAGA	CAGATCTCGGTTTTGACAGTGTG
iNOS	TCTGCAGCACTTGGATCAGG	TTCGGAAGGGAGCAATGCCC
Arginase-1 (Arg1)	GCAAGGTGATGGAAGAGACCT	GACATCAAAGCTCAGGTGAATC
CD4	GAAGATTCTGGGGCAGCATGGCAAAG	TTTGGAATCAAAACGATCAA
CD8	CTGCGTGGCCCTTCTGCTGTCCT	GGGACATTTGCAAACACGCT
NK1.1	GCTGTGCTGGGCTCATCCT	TTGATGGTTTTTGTACTAAGACTCGCA
Granzyme B (GzmB)	TGTCTCTGGCCTCCAGGACAA	CTCAGGCTGCTGATCCTTGATCGA
Perforin (Prf1)	GTACAACTTTAATAGCGACACAGTA	AGTCAAGGTGGAGTGGAGGT
Langerin (Cd207)	GGACTACAGAACAGCTTGGAGAATG	TACTTCCAGCCTCGAGCCAC
DC-SIGN (Cd209)	AGGTGCTCTTCCTAGCTGTTTGTT	TTCCTGAGAACTGGGTATTTTGTAG
Ly6g	TGCCCCTTCTCTGATGGATT	TGCTCTTGACTTTGCTTCTGTGA
c-FOS	CGGGTTTCAACGCCGACTA	TTGGCACTAGAGACGGACAGA
c-JUN	CCTTCTACGACGATGCCCTC	GGTTCAAGGTCATGCTCTGTTT

Antibodies and Reagents.

Anti-heparanase neutralizing antibodies (1453, 1023) have been described previously (14). Rat anti- mouse F4/80 antibody was purchased from Serotec, and antibodies to phospho-p38 and phospho-JNK were purchased from Cell Signaling Technology. Anti–phopsho-Erk and the small-molecule heparanase inhibitor OGT 2115 (49) were obtained from Santa Cruz Biotechnology. Anti-actin monoclonal antibody was purchased from Sigma-Aldrich. The selective MEK (PD98059), p38 (SB203580), and JNK (sp600125) inhibitors were purchased from Calbiochem and were dissolved in DMSO as stock solutions. DMSO was added to the cell culture as a control. Cytokine and transcription factor arrays were purchased from R&D Systems and Signosis, respectively. MIP2 cDNA was purchased from OriGene. The c-Fos–luciferase gene construct was kindly provided by Seung Ki Lee, Seoul, South Korea (50). The luciferase reporter assay was carried out essentially as described previously (51). Preparation of latent heparanase protein has been described previously (25).

Tumorigenicity and Immunohistochemistry.

LLC cells were detached with trypsin/EDTA, washed with PBS, and brought to a concentration of 3.5 × 10⁶ cells/mL. Peritoneal exudate cells were collected from WT and Hpa-KO mice at 3 d after thioglycolate administration and subjected to FACS analysis. Preparations exhibiting >90% CD11b⁺ cells (i.e., monocytes) (28) were mixed with LLC cells in a 1:1 ratio, and the cell suspension (7 × 10⁵/0.1 mL) was inoculated s.c. at the right flank of 6- to 8-wk-old WT and Hpa-KO C57BL/6 mice. Xenograft size was determined by externally measuring tumors in two dimensions using calipers.

At the end of the experiment, mice were killed, and tumors were removed and weighed. RNA was extracted from a small portion of each tumor, and the remaining portion was fixed in formalin and embedded in paraffin. Then 5-µm formalin-fixed, paraffin-embedded sections were subjected to immunostaining with the indicated antibodies using the Envision Kit (Dako) according to the manufacturer’s instructions, as described previously (25).

Flow Cytometry.

Freshly isolated macrophages or single-cell suspensions prepared from tumor xenografts were subjected to flow cytometry essentially as described previously (52). The antibodies used for flow cytometry analyses are listed in Table S4.

Table S4.

Antibodies used in flow cytometry

Antigen	Supplier	Clone
CD8-a	Biolegend	53–6.7
CD4	Biolegend	GK1.5
CD3-e	Biolegend	145–2c11
CD11B	BD	N1/70
NK1.1	Biolegend	PK136
Ly6C	Biolegend	HK1.4
Ly6G	BD	1A8
Ly6G+Ly6C (GR.1)	BD	RB-8C5
F4/80	Biolegend	BM8
CD206	Biolegend	C068C2
CD11C	Biolegend	N418

BM Transplantation.

BM transplantation was performed as described previously (52).

Phagocytosis.

Macrophage phagocytosis capacity was evaluated using zymosan-coated IncuCyte pHrodo Bioparticles (Essen) according to the manufacturer's instructions. In brief, 3 d after the administration of thioglycolate macrophages were collected from the peritoneum and plated (2 × 10⁴) on fibronectin-coated 96-well plates for 24 h. Cells were then washed, and the zymosan-coated fluorogenic bioparticles (5 µL) were added. Once the bioparticles were engulfed by phagocytosis and entered the acidic phagosome, a substantial increase in fluorescence was observed and monitored by quantitative live cell imaging (IncuCyte ZOOM Live Cell Analysis System; Essen).

Statistics.

Data are shown as mean ± SE. The significance of data were determined using the two-tailed Student's t test. Categorical variables were compared using the χ² test or Fisher’s exact test. A P value ≤ 0.05 was considered statistically significant. All experiments were repeated at least three times, with similar results obtained.