Skip to main content
NCBI home page
Cell Stress & Chaperones logoLink to Cell Stress & Chaperones
. 2002 Jan;7(1):97–106. doi: 10.1379/1466-1268(2002)007<0097:taasit>2.0.co;2

Thermal acclimation and stress in the American lobster, Homarus americanus: equivalent temperature shifts elicit unique gene expression patterns for molecular chaperones and polyubiquitin

Jeffrey L Spees 1,*, Sharon A Chang 1, Mark J Snyder 1, Ernest S Chang 1,2
PMCID: PMC514807  PMID: 11892992

Abstract

Using homologous molecular probes, we examined the influence of equivalent temperature shifts on the in vivo expression of genes coding for a constitutive heat shock protein (Hsc70), heat shock proteins (Hsps) (Hsp70 and Hsp90), and polyubiquitin, after acclimation in the American lobster, Homarus americanus. We acclimated sibling, intermolt, juvenile male lobsters to thermal regimes experienced during overwintering conditions (0.4 ± 0.3°C), and to ambient Pacific Ocean temperatures (13.6 ± 1.2°C), for 4–5 weeks. Both groups were subjected to an acute thermal stress of 13.0°C, a temperature shift previously found to elicit a robust heat shock response in ambient-acclimated lobsters. Animals were examined after several durations of acute heat shock (0.25–2 hours) and after several recovery periods (2–48 hours) at the previous acclimation temperature, following a 2-hour heat shock. Significant inductions in Hsp70, Hsp90, and polyubiquitin messenger RNA (mRNA) levels were found for the ambient-acclimated group. Alternatively, for the cold-acclimated group, an acute thermal stress over an equivalent interval resulted in no induction in mRNA levels for any of the genes examined. For the ambient-acclimated group, measurements of polyubiquitin mRNA levels showed that hepatopancreas, a digestive tissue, incurred greater irreversible protein damage relative to the abdominal muscle, a tissue possessing superior stability over the thermal intervals tested.

INTRODUCTION

Many ectothermic organisms acclimate and survive over wide temperature ranges. Lacking the heat-producing capacity of endotherms, their metabolism is at the mercy of temperature changes dictated by seasons and disturbances. These thermal fluctuations are not trivial. Critical biological processes, including development, growth, and fitness, are all temperature dependent. Responding to thermal variation in the environment, numerous organisms have evolved biochemical adaptations to buffer against temperature changes. These adaptations include homeoviscous and homeophasic alteration of cell membranes (Vigh et al 1998), enhanced protein stability because of specialized amino acid sequence (eg, Thermus aquaticus DNA polymerase) (Somero 1995), elevated concentrations of intracellular osmolytes, such as glycerol, sorbitol, trehalose, and glucose (Yancey et al 1982), antifreeze glycoproteins (Cheng and Chen 1999), and inducible stress proteins (molecular chaperones, heat shock proteins [Hsps]) (Feder and Hofmann 1999).

Production of Hsps is a common cellular response to thermal stress. In addition to chaperoning nascent polypeptides into their native structures, Hsps are known to protect against thermal stress by refolding denatured proteins and preventing protein aggregation (see reviews in Morimoto et al 1990; Hartl 1996; Nover and Scharf 1997; Bukau and Horwich 1998). Some Hsps such as Hsp104 in yeast, Saccharomyces cerevisiae (Sanchez and Lindquist 1990), are required for induced thermotolerance, a process by which an organism previously exposed to a sublethal temperature can subsequently survive a normally lethal heat stress (Schlesinger et al 1982; Lindquist and Craig 1988; Clegg et al 1998).

Intense or prolonged thermal stress can permanently damage proteins, promoting ubiquitination and degradation via the 26S proteasome (Varshavsky 1997; Mykles 1998).

Whereas Hsp expression may be viewed as a measure of reversible protein damage, ubiquitin production and conjugation are considered signs of irreversible protein damage (Parsell and Lindquist 1993; Hofmann and Somero 1996). Through a series of enzymatic reactions, the 76 amino acid ubiquitin polypeptide is covalently bound to damaged proteins or regulatory proteins, such as transcription factors, cell cycle regulators, kinases, phosphatases, and tumor suppressors (Bonifacino and Weissman 1998). The presence and patterning of ubiquitin moieties determine the specificity of the 26S proteasome, which is signaled to degrade particular peptide subunits or entire proteins (Hochstrasser 1996; Varshavsky 1997).

In the American lobster, Homarus americanus, multiple ubiquitin coding regions are transcribed as a single transcript (polyubiquitin), which is posttranslationally processed into individual ubiquitin moieties (Shean and Mykles 1995). Here, we use polyubiquitin gene expression as an indirect measure of protein degradation. As the number of proteins permanently damaged by a particular environmental insult increases, greater numbers of polyubiquitin transcripts are required for ubiquitin production to support the degradative pathway. Polyubiquitin expression is correlated with the degradation of myofibrillar proteins during premolt claw atrophy in the land crab, Gecarcinus lateralis (Shean and Mykles 1995), and in H. americanus (Spees, personal communication).

Because of their remarkable ability to maintain homeostasis and metabolism during long-term thermal acclimatization or acclimation, lobsters are unique organisms for studying thermal acclimation and stress. Lobsters can acclimate and survive at temperatures ranging from −1.0°C to 30.5°C (Lawton and Lavalli 1995). Although one might expect the lobster to become dormant at temperatures below 5°C (at these temperatures growth is minimal), lobsters are known to be active and even to mate at temperatures in the 0–2°C range. In fact, individuals that reach premolt (stage D1) before declining autumn temperatures may continue the molting process, eventually shedding the exoskeleton at temperatures as low as 0°C (Waddy et al 1995).

Throughout the long-term acclimatization to winter thermal regimes, lobsters are likely to change metabolically, down-regulating DNA replication, and altering protein synthesis and enzyme reaction rates. Modifications in both subunit expression and isozyme patterns have been studied in response to temperature changes (Hochachka and Somero 1984; Somero 1995). To maintain both the function and efficiency of enzymatic reactions during thermal acclimation, the structures of some requisite proteins such as carp (Cyprinus carpio) myosin ATPase are known to display specific temperature-dependent differences. Myosins from 30°C-acclimated carp are about 4 times as thermostable as those from 10°C-acclimated carp (Hwang et al 1990). Similar types of conformational changes could occur during the long-term thermal acclimatization of overwintering lobsters. Trausch (1976) found that temperature-mediated changes in the configuration of lactate dehydrogenase profoundly influenced its kinetics in the abdominal muscle (AM) of the lobster Homarus gammarus. Proteins that undergo flexibility changes, conformational adjustments, or isozyme exchanges over different thermal regimes are likely to differ in stability or lability (or both) characteristics (Johnston et al 1973; Hashimoto et al 1982; Hwang et al 1990). With regard to these observations and those concerning plasticity in the heat shock response for marine ectotherms (Dietz and Somero 1992; Dietz 1994; Roberts et al 1997; Tomanek and Somero 1999), we examined thermal acclimation and stress in H. americanus, a eurythermal organism adapted to survive cold overwintering temperatures, as well as thermal shifts during spring and summer reproductive migrations (Crossin et al 1998). Following acclimation of lobsters to ambient and cold temperatures, we examined whether acute temperature shifts over equivalent intervals (13.0°C) would elicit analogous signs of protein denaturation such as Hsp and polyubiquitin expression.

MATERIALS AND METHODS

Animal care

Juvenile lobsters (sibling, intermolt males; mean weight 85.3 ± 17.2 g) reared at the Bodega Marine Laboratory (BML) were acclimated (4–5 weeks) to cold (0.4 ± 0.3°C, n = 44) and ambient (13.6 ± 1.2°C, n = 44) temperatures. Ambient-acclimated lobsters were maintained in a flow-through aquaculture system, held in individual compartments, and fed shrimp 3 times weekly. Detailed descriptions of the aquaculture system and lobster culture techniques at BML are reviewed elsewhere (Chang and Conklin 1993; Conklin and Chang 1993).

Cold-acclimated lobsters were held in 2-L glass jars filled with seawater in a temperature-controlled cold room. Each jar was supplied with an airstone, and water was changed once weekly. Water was changed twice during the first week of acclimation to prevent possible buildup of nitrogenous wastes. These animals were fed peeled shrimp, ad libitum, once weekly (before the water change). Generally, animals would not eat more than once a week, likely because of decreased metabolic requirements. Initial transfer to the cold room occurred in the 2-L glass jars filled with ambient-temperature seawater. Over the next 12 hours, the water temperature gradually equilibrated to ∼0.4°C. Temperatures were monitored and recorded daily for both the ambient- and cold-acclimated groups.

Thermal stress

Both groups received an acute thermal stress (an elevation of 13.0°C) for 2 hours. Ambient-acclimated lobsters were heat shocked in aerated seawater in 2-L glass jars, previously equilibrated in a temperature-controlled (±0.1°C) water bath. Cold-acclimated lobsters were heat shocked by returning them directly to compartments in the flow-through seawater system (13.4°C).

Four animals from each group were sacrificed immediately at several time points during the heat stress (0.25 hour, 0.5 hour, 1 hour, and 2 hours) and after several recovery periods at the previous acclimation temperature, after the 2 hours of heat shock (2 hours, 6 hours, 12 hours, 24 hours, 48 hours, and 96 hours recovery). Four unstressed control animals were also sacrificed from each acclimation group. For all time points and controls, several samples of AM and hepatopancreas (HP) (=midgut gland) were dissected, frozen in liquid N2, and stored at −70°C.

Control experiments

We ran two separate control experiments to look for potential jar effects for the animals that were acclimated in the cold room. To determine whether long-term cold room acclimation in the 2-L jars would affect basal mRNA levels for the stress-responsive genes we examined, 8 lobsters were maintained in the cold room, as described earlier, for 4 weeks. In the place of a flow-through system in the cold room (which was not available), we housed 4 of the animals in 40-L aquarium tanks that were fitted with airstones (these tanks have approximately 20× the volume of the 2-L jars). Water changes (3/4) were performed every other day for the aquarium tanks to simulate a flow-through environment. Four different animals were maintained in 2-L jars, with water changes performed once weekly, as described earlier. After 4 weeks of acclimation, and at the end of a weekly cycle (ie, no water change for the animals in 2-L jars), all 8 lobsters were sacrificed, and AM and HP were dissected, frozen in liquid N2, and stored at −70°C. After 4 weeks of acclimation, the seawater pH from either the 2-L jars or the aquarium tanks was similar to the seawater pH of BML's flow-through system (∼8.0).

We also examined whether heat shocking the cold-acclimated lobsters by returning them to the flow-through system would be different from heat shocking them in the 2-L jars. Eight lobsters were acclimated for 4 weeks in the 2-L jars, as described earlier. Four of these animals were removed from the cold room and heat shocked by direct placement in the flow-through system in individual compartments for 2 hours. Four 2-L jars (aerated and containing fresh seawater) were submerged in the flow-through system up to an inch below the jar rim and equilibrated to the temperature of the system. Four animals were then transferred from the cold room to the 4 jars and heat shocked for 2 hours. The temperature of the flow-through system was 13.6°C. All 8 lobsters were sacrificed, and AM and HP were dissected, frozen in liquid N2, and stored at −70°C.

Molecular probe isolation and Northern analysis

Total RNA was isolated from juvenile H. americanus HP (Totally RNA kit, Ambion, Austin, TX, USA), and 5 μg was reverse transcribed at 37°C using an oligo-dT15 primer (Superscript reverse transcriptase, Stratagene protocol). This complementary DNA (cDNA) was used as template for polymerase chain reaction (PCR). A 500-bp partial clone for lobster Hsp70 was amplified using the following degenerate primers (Cochrane et al 1994): 5′ GC[GCT]AAGAA[TC]CA[AG]G[TC][TC]G[ACGT]ATGAAC 3′ and 5′ GT[AGT]G[AC][CT]TT[AGC]AC[AGC]TC[AG]AAGAT 3′. Using the same template, a 380-bp partial clone for lobster Hsp90 was also isolated using a 5′ GGGAAGCACGAGGAGCGGAGG 3′ forward primer and an oligo-dT15 reverse primer.

Strong nucleotide sequence similarity between Hsp70 and the constitutive Hsp Hsc70 allowed the degenerate Hsp70 primers, described earlier, to anneal and amplify large segments of an Hsc70 cDNA in an anchored PCR approach. This involved the dilution, boiling, and centrifugation of an aliquot of a lobster HP cDNA library. One microliter of this preparation served as a template for separate 50 μL PCR reactions, utilizing the Hsp70 forward and reverse primers, and SP6 and T7 RNA vector promoter primers. A 2100-bp fragment of Hsc70, derived from the Hsp70 forward and SP6 reverse reaction, was cloned and subsequently digested with EcoRI to yield a 600-bp fragment. This fragment was then subcloned into the pCR2 vector (Invitrogen, Carlsbad, CA, USA). Because it consists largely of sequence from the 3′-untranslated region of lobster Hsc70, this 600-bp gene segment was used to measure Hsc70 expression specifically as this probe does not hybridize to the Hsp70 sequence (data not shown).

All PCR reactions were performed under the following conditions: 95°C initial denature, 3 minutes (1 cycle); 95°C, 1 minute; 56°C, 1.5 minutes; 72°C, 2 minutes (35 cycles); 72°C final extension, 10 minutes (1 cycle), using Taq DNA polymerase (PCR buffer, 2.5 mM Mg2+, GIBCO, Grand Island, NY, USA). PCR products were gel-purified (Qiagen kit, Valencia, CA, USA) and cloned into the pCR 2.1 or pCR2 vectors (Invitrogen). PCR products were sequenced by the DNA sequencing facility, University of California, Davis, CA, USA or by Davis Sequencing, Davis, CA, USA. NETBLAST searching (NCBI) was used to confirm the identities of PCR products.

Total RNA was isolated from the dissected AM and HP samples (RNAgents kit, Promega, Madison, WI, USA), quantified with a spectrophotometer, and equally loaded (15 μg AM total RNA, 25 μg HP total RNA) onto denaturing 1 % agarose gels. These gels were washed (15 minutes, H2O with 0.1 % diethyl pyrocarbonate (DEPC), St Louis, MO, USA) and blotted overnight onto nylon membranes (Magnagraph, MSI). Following UV cross-linking (UV Stratalinker 1800), blots were prehybridized (2 hours) in 5× SSPE (75 mm NaCl, 50 mm NaH2 PO4, 5 mm ethylene-diaminetetraacetic acid, 0.1 % DEPC) buffer, 50 % (w/v) formamide, 5× Denhardt's, 1 % sodium dodecyl sulfate (SDS), and 100 μg/mL sheared salmon sperm DNA. The partial lobster Hsp70 clone was 32P-labeled (Prime-It RmT, Stratagene, La Jolla, CA, USA), added directly to the prehybridization solution, and allowed to hybridize overnight at 42°C. Following hybridization, the blots were washed twice with 2× SSPE and placed on a film for 2 days at −70°C.

Following exposure of the film, the blots were stripped with several washes (0.1× standard saline citrate, 0.1 % SDS, 65°C) until the background was minimal and prehybridized, hybridized, and washed as described earlier, except that a partial lobster Hsp90 or polyubiquitin (600 bp; gift of Prof D.L. Mykles) cDNA probe was added. To check for equal loading of RNA, the blots were probed with a 700-bp partial cDNA probe for lobster (H. gammarus) actin (Harrison and El Haj 1994). Separate blots were run to examine Hsc70 mRNA levels with an identical protocol, as described earlier, using the 600-bp partial clone specific for Hsc70 as a probe. Films were scanned on a high-resolution scanner, and densitometry was performed with Scion Image 2.1 software.

RESULTS

Hsp70 gene expression

There were marked differences in Hsp70 gene expression between ambient- and cold-acclimated animals. These differences were apparent in both AM (Fig 1) and HP (Fig 2). All gene expression data were log 10 transformed prior to one-way analysis of variance (ANOVA) to normalize variance. Dunnett's test was used to compare treatment values with control values following significant ANOVA results.

Fig 1.

Fig 1.

Open in a new tab

 Abdominal muscle messenger RNA levels for Hsp70, Hsp90, polyubiquitin (Poly-Ub), and actin (indicator of equal loading) in (A) ambient-acclimated and (B) cold-acclimated lobsters during heat shock and recovery. Data for each acclimation group represent a single gel that was transferred and probed with several complementary DNAs. Polyubiquitin transcripts were hardly detectable in the cold-acclimated group; we did not attempt to quantify these latter data

Fig 2.

Fig 2.

Open in a new tab

 Hepatopancreas messenger RNA levels for Hsp70, Hsp90, polyubiquitin (Poly-Ub), and actin (indicator of equal loading) in (A) ambient-acclimated and (B) cold-acclimated lobsters during heat shock and recovery. Data for each acclimation group represent a single gel that was transferred and probed with several complementary DNAs

In ambient-acclimated AM, significant differences in Hsp70 mRNA levels were detected (ANOVA; P = 0.011; Fig 3A). Further testing of heat shock and recovery values vs control values indicated significant increases in Hsp70 mRNA levels following 1 hour and 2 hours of heat shock, and 6 hours and 12 hours of recovery (after 2 hours of heat shock) (Fig 3A). In contrast, Hsp70 mRNA in cold-acclimated AM never reached significant levels over those of controls, either during the heat shock or during recovery. Cold-acclimated AM showed significant differences among treatments (ANOVA; P = 0.001; Fig 3A), but these differences were because of treatment values being lower than control values. Cold-acclimated AM had significant decreases in Hsp70 mRNA levels following 1 hour of heat shock and 48 hours of recovery (after 2 hours of heat shock) (Fig 3A).

Fig 3.

Fig 3.

Open in a new tab

 Comparisons of (A) Hsp70 and (B) Hsp90 messenger RNA (mRNA) levels in abdominal muscle of ambient- and cold-acclimated lobsters during heat shock and recovery. Data are normalized against actin levels (to control for equal loading) and presented as percent control expression levels. n = 3 for all time points. Error bars represent 1 SD of the mean. Asterisks denote statistical significance from control (no heat shock) mRNA levels within an acclimation group (* P < 0.05)

Hsp70 mRNA levels in ambient-acclimated HP were also significantly different (ANOVA; P < 0.001; Fig 4A). Testing of treatments vs control values indicated increases in Hsp70 mRNA levels following 1 hour and 2 hours of heat shock and 6 hours of recovery (after 2 hours of heat shock) (Fig 4A). No such induction was observed for cold-acclimated HP (ANOVA; P = 0.082; Fig 4A).

Fig 4.

Fig 4.

Open in a new tab

 Comparisons of (A) Hsp70, (B) Hsp90, and (C) polyubiquitin messenger RNA (mRNA) levels in hepatopancreas of ambient- and cold-acclimated lobsters during heat shock and recovery. Data are normalized against actin levels (to control for equal loading) and presented as percent control expression levels. n = 3 for all time points. Error bars represent 1 SD of the mean. Asterisks denote statistical significance from control (no heat shock) mRNA levels within an acclimation group (* P < 0.05).

Hsp90 gene expression

Differences in Hsp90 gene expression were observed between acclimation groups for both AM (Fig 1) and HP (Fig 2). Similar to Hsp70 expression, Hsp90 mRNA levels in ambient-acclimated AM were significantly different (ANOVA; P = 0.003; Fig 3B). Animals that received 2 hours of heat shock, as well as those that received a full 2 hours of heat shock and 2 hours, 6 hours, 12 hours, or 24 hours of recovery had significant values over controls (Fig 3B). In cold-acclimated AM, Hsp90 mRNA levels were significantly different between treatments but not between treatment and control levels (ANOVA; P = 0.017; Fig 3B).

HP Hsp90 gene expression patterns were strikingly different between acclimation groups. Ambient-acclimated animals displayed a significant increase in HP Hsp90 mRNA over control levels at 6 hours recovery, but also a significant decrease after 48 hours recovery (ANOVA; P < 0.001; Fig 4B). Cold-acclimated animals showed a significant inhibition or decrease in expression from the basal levels that appear to be higher than those found in ambient-acclimated controls (compare Hsp90 control mRNA levels for ambient- and cold-acclimated HP; Fig 2) (absolute quantitative assessment of these differences, however, is not available without an internal standard). Measurements of Hsp90 mRNA levels from cold-acclimated HP were significantly less than control values at the 6-hour, 12-hour, 24-hour, and 48-hour time points (ANOVA; P < 0.001; Fig 4B).

Polyubiquitin gene expression

For all tissues examined, under all acclimation regimes, ambient-acclimated HP was the only tissue that showed significant expression of the polyubiquitin gene (ANOVA; P < 0.001; Figs 4C and 5). Expression in ambient-acclimated HP was significantly different from control values at 2 hours and 6 hours recovery (after 2 hours heat shock) (Fig 4C). There were no significant changes in polyubiquitin expression in ambient-acclimated AM (ANOVA; P = 0.90; Fig 5). Cold-acclimated AM polyubiquitin expression was low, and we were unable to accurately quantify it (Fig 1B). Comparison of tissue-specific expression responses for ambient-acclimated AM and HP indicates that AM is a more stable tissue in response to the thermal stress we tested.

Fig 5.

Fig 5.

Open in a new tab

 Comparison of polyubiquitin messenger RNA (mRNA) levels in hepatopancreas and abdominal muscle of ambient-acclimated lobsters during heat shock and recovery. Data are normalized against actin (to control for equal loading) and presented as percent control expression levels. n = 3 for all time points. Error bars represent 1 SD of the mean. Asterisks denote statistical significance from control (no heat shock) mRNA levels within an acclimation group (* P < 0.05)

Hsc70 gene expression

The pattern of Hsc70 gene expression in ambient- vs cold-acclimated animals was consistent with those observed for the other chaperones, Hsp70 and Hsp90. Inductions of Hsc70 mRNA levels were observed in both the AM and HP of ambient-acclimated animals, and not so in the same tissues from cold-acclimated individuals, which received a heat shock over an equivalent interval (Fig 6).

Fig 6.

Fig 6.

Open in a new tab

 Northern analysis of Hsc70 expression in (A) ambient- and (B) cold-acclimated abdominal muscle, and (C) ambient- and (D) cold-acclimated hepatopancreas during heat shock and recovery. Heat shock times are indicated in hours (0.25, 0.5, 1, and 2). A 2-hour heat shock followed by a 2-hour recovery is indicated by 2R. Subsequent times (6, 12, 24, 48, 96) are hours of recovery following the 2-hour heat shock. Any missing time points were excluded because of degradation of RNA

Control experiments

We found no significant differences in basal molecular chaperone or polyubiquitin mRNA levels between the lobsters that acclimated in the cold room in 2-L jars (water changes once a week) and those housed in 40-L aquarium tanks (water changes every other day to simulate a flow-through system). For HP, there were no differences in Hsc70 mRNA levels, P = 0.223; Hsp90 mRNA levels, P = 0.327; or polyubiquitin mRNA levels, P = 0.097 (Student's t-test). For AM, there were no significant differences in Hsc70 mRNA levels (P = 0.458) or Hsp90 mRNA levels (P = 0.486) between the control groups (Student's t-test). Polyubiquitin mRNA levels were too low to quantify in AM from either control group.

Additionally, we found no significant differences in molecular chaperone or polyubiquitin mRNA levels between cold-acclimated animals that were heat shocked in the flow-through system and those that were heat shocked in the 2-L jars (HP: Hsc70 mRNA levels, P = 0.313; Hsp90 mRNA levels, P = 0.370; polyubiquitin mRNA levels, P = 0.908; AM: Hsc70 mRNA levels, P = 0.973; Hsp90 mRNA levels, P = 0.405) (Student's t-test). The lobster Hsp70 probe was the last to be hybridized with the control blots and did not bind well.

DISCUSSION

Gene expression patterns

We used homologous molecular probes to quantify H. americanus gene expression in vivo in different tissues and over long-term recovery periods. To our knowledge, the in vivo expression patterns of multiple stress-responsive genes from separate acclimation states have yet to be examined in the detail described here for any invertebrate, including model organisms such as Drosophila.

Our results illustrate how ectothermic organisms, which naturally undergo long-term seasonal acclimatization to cold temperatures, can respond uniquely to equivalent thermal shifts. The lack of molecular chaperone and polyubiquitin gene expression observed in cold-acclimated lobsters contrasts strongly with results from ambient-acclimated animals heat shocked with an equivalent temperature shift. Ambient-acclimated tissues showed significant increases in Hsp70, Hsp90, and polyubiquitin (HP) mRNA levels relative to control expression levels. In addition, similar induction patterns were evident for the cognate Hsp Hsc70. No significant increases in mRNA levels for any of these genes were observed in tissues from cold-acclimated animals relative to controls.

Tissue specific stress responses

Not all tissues respond in concert with a given thermal stress. Although both AM and HP of ambient-acclimated lobsters displayed signs of reversible protein damage (molecular chaperone expression) in response to an acute thermal stress, only the HP showed significant expression of the polyubiquitin gene, a sign of increased protein degradation or irreversible damage (Mykles 1998). This implies that AM may have been more stable than HP over the thermal interval tested. The protein pools that make up these tissues are, thus, likely to differ in their stability characteristics. Feder and Krebs (1998) reported that the gut of Drosophila larvae stained intensely with trypan blue dye following a severe heat shock, suggesting that it is especially thermosensitive. Interestingly, this tissue also exhibited a prolonged delay in the expression of the Hsp70 protein relative to other tissues examined. They noted that severe heat shock markedly increased trypan blue staining in many tissues, but in inverse relationship to the number of times in which these tissues expressed Hsp70, an indication of the protective effects of this chaperone.

The consistent inhibition of Hsp90 gene expression in the HP of cold-acclimated animals during recovery from acute thermal stress may be caused by the interruption of transcriptional processing. Unlike Hsp70, which is known to lack introns, Hsp90 has several introns and requires splicing to generate a complete message (Yost and Lindquist 1986). Although markedly different from the response of ambient-acclimated animals, this inhibition does indicate that the cold-acclimated animals experienced a stress in response to the shift in temperature. Observing that actin mRNA levels did not change significantly, this may relate to the roles of Hsp90 in multiple signal transduction pathways that may have reacted to the experimental treatment (Pratt 1997). For example, Hsp90 transcription in H. americanus is influenced by the molt cycle and in response to ecdysteroids (steroid-molting hormones) (Chang et al 1999; Spees, personal communication). The Drosophila ecdysteroid receptor is partly activated by Hsp90 (Arbeitman and Hogness 2000), as are most steroid receptors studied to date (Pratt 1997).

Conclusions and further questions

The observed differences in molecular chaperone and polyubiquitin gene expression between ambient- and cold-acclimated lobsters, and between tissues of ambient-acclimated animals may be the result of differences in substrates. Although the Hsp or polyubiquitin systems could themselves differ between acclimation regimes, or between tissues, it is likely that substrate flexibility, conformation, presence or absence, or concentration differences between acclimation groups or tissue types is also important. Denaturation of proteins (substrates) should precede Hsp induction or activation (or both) of ubiquitin- or proteasome-mediated degradation.

The results of our study (and those mentioned earlier) inspire several interesting questions for biochemists and ecologists alike. For a given organism, what are the first proteins to unfold? Is the identity and order in which particular proteins denature conserved between tissues, acclimatization or acclimation states, or organisms? Do multiple organisms in a given ecological community display similar protein denaturation profiles during a perturbation? Given the current state of scientific and technological progress, we are confident that future investigations in physiological ecology can address many of these exciting questions.

Acknowledgments

Special thanks are given to Prof D.L. Mykles, Colorado State University, for supplying the polyubiquitin cDNA clone used in this study. This paper is funded in part by a grant from the National Sea Grant College System, National Oceanic and Atmospheric Administration (NOAA), US Department of Commerce, under grant R/A-108, project NA66RG0477, through the California Sea Grant College system, and in part by the California State Resources Agency (to M.J.S. and E.S.C.), NSF grant 96-31128 (to M.J.S.), and Bodega Marine Laboratory student travel grants (to J.L.S.). The views expressed herein are those of the authors and do not necessarily reflect the views of NOAA or any of its subagencies. The US Government is authorized to reproduce and distribute for governmental purposes. Contribution Number 2152 from the Bodega Marine Laboratory, University of California at Davis.

REFERENCES

  1. Arbeitman MN, Hogness DS. Molecular chaperones activate the Drosophila ecdysone receptor, an RXR heterodimer. Cell. 2000;101:67–77. doi: 10.1016/S0092-8674(00)80624-8. [DOI] [PubMed] [Google Scholar]
  2. Bonifacino JS, Weissman AM. Ubiquitin and the control of protein fate in the secretory and endocytic pathways. Annu Rev Cell Dev Biol. 1998;14:19–57. doi: 10.1146/annurev.cellbio.14.1.19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bukau B, Horwich AL. The HSP70 and HSP60 chaperone machines. Cell. 1998;92:351–366. doi: 10.1016/s0092-8674(00)80928-9. [DOI] [PubMed] [Google Scholar]
  4. Chang ES, Chang SA, Keller R, Reddy PS, Snyder MJ, Spees JL. Quantification of stress in lobsters: crustacean hyperglycemic hormone, stress proteins, and gene expression. Am Zool. 1999;39:487–495. [Google Scholar]
  5. Chang ES, Conklin DE 1993 Larval culture of the American lobster (Homarus americanus). In: CRC Handbook of Mariculture, vol 1, 2nd ed, ed McVey JP. CRC Press, Boca Raton, FL, 489–495. [Google Scholar]
  6. Cheng C-HC, Chen L. Evolution of an antifreeze glycoprotein. Nature. 1999;401:443–444. doi: 10.1038/46721. [DOI] [PubMed] [Google Scholar]
  7. Clegg JS, Uhlinger KR, Jackson SA, Cherr GN, Rifkin E, Friedman CS. Induced thermotolerance and the heat shock protein-70 family in the Pacific oyster Crassostrea gigas. Mol Mar Biol Biotechnol. 1998;7:21–30. [Google Scholar]
  8. Cochrane BJ, Mattley YD, Snell TW. Polymerase chain reaction as a tool for developing stress protein probes. Environ Toxicol Chem. 1994;13:1221–1229. [Google Scholar]
  9. Conklin DE, Chang ES 1993 Culture of juvenile lobsters (Homarus americanus). In: CRC Handbook of Mariculture, vol 1, 2nd ed, ed McVey JP. CRC Press, Boca Raton, FL, 497–510. [Google Scholar]
  10. Crossin G, Al-Ayoub SA, Jury SH, Howell WH, Watson WH III. Behavioral thermoregulation in the American lobster (Homarus americanus) J Exp Biol. 1998;201:365–374. doi: 10.1242/jeb.201.3.365. [DOI] [PubMed] [Google Scholar]
  11. Dietz TJ. Acclimation of the threshold induction temperatures for 70-kDa and 90-kDa heat shock proteins in the fish Gillichthys mirabilis. J Exp Biol. 1994;188:333–338. doi: 10.1242/jeb.188.1.333. [DOI] [PubMed] [Google Scholar]
  12. Dietz TJ, Somero GN. The threshold induction temperature of the 90-kDa heat shock protein is subject to acclimatization in eurythermal goby fishes (genus Gillichthys) Proc Natl Acad Sci U S A. 1992;89:3389–3393. doi: 10.1073/pnas.89.8.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Feder ME, Hofmann GE. Heat-shock proteins, molecular chaperones and the stress response: evolutionary and ecological physiology. Annu Rev Physiol. 1999;61:243–282. doi: 10.1146/annurev.physiol.61.1.243. [DOI] [PubMed] [Google Scholar]
  14. Feder ME, Krebs RA. Natural and genetic engineering of the heat-shock protein Hsp70 in Drosophila melanogaster: consequences for thermotolerance. Am Zool. 1998;38:503–517. [Google Scholar]
  15. Harrison P, El Haj AJ. Actin mRNA levels and myofibrillar growth in leg muscles of the European lobster (Homarus gammarus) in response to passive stretch. Mol Mar Biol Biotechnol. 1994;3:35–41. [PubMed] [Google Scholar]
  16. Hartl FU. Molecular chaperones in protein folding. Nature. 1996;381:571–580. doi: 10.1038/381571a0. [DOI] [PubMed] [Google Scholar]
  17. Hashimoto A, Kobayashi A, Arai K. Thermostability of fish myofibrillar Ca-ATPase and adaptation to environmental temperatures. Bull Jpn Soc Sci Fish. 1982;48:671–684. [Google Scholar]
  18. Hochachka PW, Somero GN 1984 Biochemical Adaptation. Princeton University Press, Princeton. [Google Scholar]
  19. Hochstrasser M. Protein degradation or regulation: Ub the judge. Cell. 1996;84:813–815. doi: 10.1016/s0092-8674(00)81058-2. [DOI] [PubMed] [Google Scholar]
  20. Hofmann GE, Somero GN. Interspecific variation in thermal denaturation of proteins in the congeneric mussels Mytilus trossulus and M. galloprovincialis: evidence from the heat-shock response and ubiquitination. Mar Biol. 1996;126:65–75. [Google Scholar]
  21. Hwang GC, Watabe S, Hashimoto K. Changes in carp myosin ATPase induced by temperature acclimation. J Comp Physiol B. 1990;160:233–239. [Google Scholar]
  22. Johnston IA, Frearson N, Goldspink G. The effects of environmental temperature on the properties of myofibrillar adenosine triphosphatase from various species of fish. Biochem J. 1973;133:735–738. doi: 10.1042/bj1330735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lawton P, Lavalli KL 1995 Postlarval, juvenile, adolescent, and adult ecology. In: Biology of the Lobster Homarus americanus, ed Factor JD. Academic Press, San Diego, CA, 217–259. [Google Scholar]
  24. Lindquist S, Craig EA. The heat-shock proteins. Annu Rev Genet. 1988;22:631–677. doi: 10.1146/annurev.ge.22.120188.003215. [DOI] [PubMed] [Google Scholar]
  25. Morimoto RI, Tissieres A, and Georgopoulos C 1990 Stress Proteins in Biology and Medicine. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [Google Scholar]
  26. Mykles DL. Intracellular proteinases of invertebrates: calcium-dependent and proteasome-ubiquitin-dependent systems. Int Rev Cytol. 1998;184:157–289. doi: 10.1016/s0074-7696(08)62181-6. [DOI] [PubMed] [Google Scholar]
  27. Nover L, Scharf K-D. Heat stress proteins and transcription factors. Cell Mol Life Sci. 1997;53:80–103. doi: 10.1007/PL00000583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Parsell DA, Lindquist S. The function of heat-shock proteins in stress tolerance: degradation and reactivation of damaged proteins. Annu Rev Genet. 1993;27:437–496. doi: 10.1146/annurev.ge.27.120193.002253. [DOI] [PubMed] [Google Scholar]
  29. Pratt WB. The role of the hsp90-based chaperone system in signal transduction by nuclear receptors and receptors signaling via MAP kinase. Annu Rev Pharmacol Toxicol. 1997;37:297–326. doi: 10.1146/annurev.pharmtox.37.1.297. [DOI] [PubMed] [Google Scholar]
  30. Roberts DA, Hofmann GE, Somero GN. Heat-shock protein expression in Mytilus californianus: acclimatization (seasonal and tidal-height comparison) and acclimation effects. Biol Bull. 1997;192:309–320. doi: 10.2307/1542724. [DOI] [PubMed] [Google Scholar]
  31. Sanchez Y, Lindquist SL. HSP104 required for induced thermotolerance. Science. 1990;248:1112–1115. doi: 10.1126/science.2188365. [DOI] [PubMed] [Google Scholar]
  32. Schlesinger MJ, Ashburner M, and Tissieres A 1982 Heat Shock: From Bacteria to Man. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [Google Scholar]
  33. Shean BS, Mykles DL. Polyubiquitin in crustacean striated muscle: increased expression and conjugation during molt-induced claw muscle atrophy. Biochim Biophys Acta. 1995;126:312–322. doi: 10.1016/0167-4781(95)00167-0. [DOI] [PubMed] [Google Scholar]
  34. Somero GN. Proteins and temperature. Annu Rev Physiol. 1995;57:43–68. doi: 10.1146/annurev.ph.57.030195.000355. [DOI] [PubMed] [Google Scholar]
  35. Tomanek L, Somero GN. Evolutionary and acclimation-induced variation in the heat-shock responses of congeneric marine snails (genus Tegula) from different thermal habitats: implications for limits of thermotolerance and biogeography. J Exp Biol. 1999;202:2925–2936. doi: 10.1242/jeb.202.21.2925. [DOI] [PubMed] [Google Scholar]
  36. Trausch G. Effect of temperature upon catalytic properties of lactate dehydrogenase in the lobster. Biochem Syst Ecol. 1976;4:65–68. [Google Scholar]
  37. Varshavsky A. The ubiquitin system. Trends Biochem Sci. 1997;22:383–387. doi: 10.1016/s0968-0004(97)01122-5. [DOI] [PubMed] [Google Scholar]
  38. Vigh L, Maresca B, Harwood JL. Does the membrane's physical state control the expression of heat shock and other genes? Trends Biochem Sci. 1998;23:369–374. doi: 10.1016/s0968-0004(98)01279-1. [DOI] [PubMed] [Google Scholar]
  39. Waddy SL, Aiken DE, and DeKleijn DPV 1995 Control of growth and reproduction. In: Biology of the Lobster Homarus americanus, ed Factor JD. Academic Press, San Diego, CA, 217–259. [Google Scholar]
  40. Yancey PH, Clark ME, Hand SC, Bowlus RD, Somero GN. Living with water stress: evolution of osmolyte systems. Science. 1982;217:1214–1222. doi: 10.1126/science.7112124. [DOI] [PubMed] [Google Scholar]
  41. Yost JH, Lindquist S. RNA splicing is interrupted by heat shock and is rescued by heat shock protein synthesis. Cell. 1986;45:185–193. doi: 10.1016/0092-8674(86)90382-x. [DOI] [PubMed] [Google Scholar]

Articles from Cell Stress & Chaperones are provided here courtesy of Elsevier

RESOURCES