Skip to main content
NCBI home page
Cell Stress & Chaperones logoLink to Cell Stress & Chaperones
. 2002 Apr;7(2):130–136. doi: 10.1379/1466-1268(2002)007<0130:rlcbnc>2.0.co;2

Rhizobium leguminosarum chaperonin 60.3, but not chaperonin 60.1, induces cytokine production by human monocytes: activity is dependent on interaction with cell surface CD14

Jo Lewthwaite 1, Roger George 2,*, Peter A Lund 2, Steve Poole 3, Peter Tormay 4, Lindsay Sharp 1, Anthony RM Coates 4, Brian Henderson 1,2
PMCID: PMC514810  PMID: 12380680

Abstract

As part of a program of work to understand the interaction of bacterial chaperonins with human leukocytes, we have examined 2 of the 3 chaperonin 60 (Cpn 60) gene products of the nonpathogenic plant symbiotic bacterium, Rhizobium leguminosarum, for their capacity to induce the production of pro- and antiinflammatory cytokines by human cells. Recombinant R. leguminosarum Cpn 60.1 and 60.3 proteins were added to human monocytes at a range of concentrations, and cytokine production was measured by sandwich enzyme-linked immunosorbent assay. In spite of the fact that the 2 R. leguminosarum Cpn 60 proteins share 74.5% amino acid sequence identity, it was found that Cpn 60.3 induced the production of interleukin (IL)-1β, tumor necrosis factor alpha, IL-6, IL-8, IL-10, and IL-12, but not IL-4, interferonγ, or GM-CSF (granulocyte-macrophage colony-stimulating factor), whereas the Cpn 60.1 protein failed to demonstrate any cytokine-inducing activity. The use of neutralizing monoclonal antibodies showed that the cytokine-inducing activity of Cpn 60.3 was dependent on its interaction with CD14. This demonstrates that CD14 mediates not only lipopolysaccharide but also R. leguminosarum Cpn 60.3 cell signaling in human monocytes.

INTRODUCTION

Chaperonins are evolutionarily conserved intracellular proteins that function in the process of protein folding. In recent years they have been reported to be present on the surface of various bacteria (Yamaguchi et al 1996; Frisk et al 1998) and mammalian cells (Soltys and Gupta 1997). Human chaperonin 60 (Cpn 60) has now been detected in the sera of overtly healthy individuals donating blood (Pockley et al 1999) and is elevated in individuals with atherosclerosis (Xu et al 2000) or early cardiovascular disease (Pockley et al 2000).

The hypothesis that secreted Cpn 60 may play some physiological or pathophysiological role has been supported by reports of the biological activity of these proteins. Thus, exogenously administered chaperonins, from a small number of pathogenic bacteria, stimulate cytokine production by a variety of cells (Friedland et al 1993; Galdiero et al 1997; Marcatili et al 1997; Tabona et al 1998; reviewed by Coates et al 1999), and certain Cpn 60 proteins stimulate bone resorption (Kirby et al 1995; Meghji et al 1997) by cytokine-dependent mechanisms. In addition, human Cpn 60 has also been reported to stimulate cytokine production by human leukocytes (Chen et al 1999).

In spite of the enormous sequence conservation among the Cpn 60s, it has been found that they can demonstrate distinct biological activities. Thus, the Cpn 60 proteins from the oral bacterium, Actinobacillus actinomycetemcomitans and Escherichia coli, are potent stimulators of bone resorption (Kirby et al 1995; Reddi et al 1998). In contrast, the Cpn 60 proteins from mycobacteria have little or no ability to promote bone resorption (Kirby et al 1995; Meghji et al 1997). In this study we have compared 2 of the 3 cpn 60 gene products of the plant symbiotic bacterium, Rhizobium leguminosarum, for their ability to induce human monocytes to produce cytokines. We report that in spite of the high sequence identity between these 2 proteins, they have very different capacities to promote cytokine synthesis.

MATERIALS AND METHODS

Cloning and expression of the R. leguminosarum Cpn 60 proteins

R. leguminosarum Cpn 60.1 and Cpn 60.3 genes were cloned and expressed from the pBAD promoter, as described by Erbse et al (1999). Proteins were purified as described by Erbse et al (1999) from a strain where the chromosomal groEL gene had been deleted (Ivic et al 1997), with further purification of the proteins being performed by mixing with Affi-gel blue (Bio-Rad Laboratories, Hemel Hempstead, UK) for 1 hour at 4°C followed by 40% acetone precipitation. The purity of the recombinant chaperonins was determined by tryptophan fluorescence because neither protein contains tryptophan. Each protein was found to contain less than 1 molecule of tryptophan-containing impurities per chaperone tetradecamer. The chaperonins were shown to be active in protein-folding assays (Erbse et al 1999) and ATPase assays (as described by Horovitz et al 1993).

The lipopolysaccharide (LPS) content of the recombinant Cpn 60 proteins was measured using a commercial Limulus amoebocyte lysate (LAL) assay. All reagents were purchased from Associates of Cape Cod (Liverpool, UK), and the assay was carried out according to the manufacturer's instructions.

Cloning and expression of E. coli flagellin

As a control for the inhibitor polymyxin B, the gene encoding the E. coli flagellin monomer was cloned and expressed. The oligonucleotides 5′GCATGCATGGCACAAGTCATTAATACCAA and 5′AAGCTTAACCCTGCAG CAGAGACAGAACC were designed to amplify this gene. The primers contain recognition sites for the restriction enzymes SphI and HindIII, respectively (underlined). The PCR fragment was initially cloned into pCR®4 Topo (Invitrogen, Leek, The Netherlands), from where it was extracted with SphI and HindIII and subcloned into the SphI and HindIII sites of the pQE30 vector (Qiagen Ltd, Crawley, UK). The pQE flagellin clone was transformed into E. coli. The flagellin gene was expressed by inducing 1:10 dilutions of overnight pQE-flagellin cultures grown to an OD600 of 0.8 with 1 mM isopropyl-β-d-thiogalactopyranoside for 4 hours at 37°C. The cells were harvested and the recombinant flagellin released from the bacteria using B-PER protein extraction reagent (Pierce and Warriner Ltd, Illinois, USA). The polyhistidine-tagged flagellin was purified using Ni-nitrilotriacetic acid–agarose columns under native conditions, as described by the manufacturer (Qiagen). Finally, recombinant flagellin was further purified to homogeneity by gel filtration chromatography, using a Superdex75 column attached to a Pharmacia SMART system (Amersham-Pharmacia Biotech, Amersham, UK).

Preparation of human monocytes

Human monocytes were prepared from buffy coat blood by density gradient centrifugation and differential adherence. Briefly, 20 mL of buffy coat blood was transferred into heparinised sterile Universals (Sterilin) to which an equal volume of Roswell Park Memorial Institute (RPMI) 1640 medium (Sigma, St. Louis, MO) at 37°C was immediately added. The blood-RPMI suspension (35 mL) was carefully layered onto 15 mL of Ficoll-Histopaque 1077 (Sigma) and centrifuged at 400 × g for 30 minutes at room temperature. The mononuclear cell layer was collected and washed twice with RPMI 1640. Cells were resuspended in this medium containing 2% fetal calf serum. Cell viability was assessed by trypan blue exclusion, and 2 × 106 cells in 0.5 mL medium were added to each well of 24-well plates. Plates were incubated for 1 hour at 37°C, then washed with Hank's balanced salt solution to remove nonadherent cells, and cultured as described elsewhere (Tabona et al 1998).

Determination of cytokine production

Monocytes (2 × 106 cells/mL) were exposed to a range of concentrations of recombinant chaperonins. Polymyxin B was added at a concentration of 20 μg/mL to neutralize any contaminating LPS. In some assays the polymyxin B was omitted, and cells were pretreated with the anti-CD14 monoclonal antibody MY4 (Beckman Coulter, High Wycombe, UK) at 15 μg/mL. After 16 hours in the presence of activators, media were collected and cytokine levels determined by 2-site enzyme-linked immunosorbent assay (ELISA). The statistical significance of the differences in cytokine production by unstimulated cells and by those exposed to the chaperonins was determined using Student's t-test. To determine if cytokine synthesis was the result of LPS contamination, we made use of the LPS-binding antibiotic polymyxin B (Sigma). The possibility that the chaperonins were acting by binding to cell-surface CD14 was assessed by use of the CD14-binding and LPS-inhibiting monoclonal antibody MY4 (Beckman Coulter, High Wycombe, UK).

Cytokine assays

Interleukin (IL)-1β, tumor necrosis factor alpha (TNFα), IL-6, and IL-8 antibodies, and all cytokine standards were provided by the National Institute for Biological Standards and Control. IL-1β, TNFα, and IL-6 ELISA methods were as described previously (Tabona et al 1998). Paired antibodies for assay of IL-10, interferonγ (IFNγ), and granulocyte-macrophage cology-stimulating factor (GM-CSF) were from Pharmingen (Oxford, UK), and IL-4 and IL-12 antibodies were from BioSource (Watford, UK). The ELISA protocols for IL-8, IL-10, and IL-12 were similar to that for IL-6 (Tabona et al 1998). The lower limit of sensitivity of these 2-site assays for cytokines is in the range of 10–100 pg/mL.

Sequence comparisons

The 2 R. leguminosarum Cpn 60 protein sequences have been aligned using the Clustal W multiple-alignment method (Thompson et al 1994), and a dot plot using the Pam 250 similarity matrix with a threshold value of 5 has been used to identify areas of maximum sequence dissimilarity.

RESULTS

Endotoxin content of purified R. leguminosarum Cpn 60 proteins

The endotoxin content of R. leguminosarum Cpn 60.1 proteins was low but measurable, in the range 0.01–0.5 ng/μg. All experiments were performed in the presence of 20 μg/mL polymyxin B, a cyclic cationic peptide antibiotic that blocks LPS-induced cellular activation to ensure that the activity was not due to these small amounts of contaminating LPS.

Induction of cytokine synthesis by R. leguminosarum chaperonins

R. leguminosarum Cpn 60.3 activated human monocytes to secrete nanogram quantities of the proinflammatory cytokines IL-1β, TNFα, IL-6, IL-8, and IL-12. It also induced the synthesis of the antiinflammatory cytokine IL-10. The representative response of the monocytes from 1 of the 8 blood samples used in this study is shown in (Fig 1). There was significant variation in the magnitude of cytokine synthesis by individual blood samples (Table 1), although the shape of the dose response for each sample of monocytes was similar. Monocytes exposed to Cpn 60.3 did not produce the cytokines IL-4, IFNγ, or GM-CSF. In contrast to the recombinant 60.3 protein, the recombinant R. leguminosarum Cpn 60.1 did not induce the production of any of the cytokines assayed (data not shown).

Fig. 1.

Fig. 1.

Open in a new tab

 Cytokine production by human peripheral blood monocytes following stimulation with graded concentrations of R. leguminosarum chaperonin 60.3. Results are from a representative experiment and are expressed as mean ± standard error of triplicate cultures. The maximum variation in the amount of cytokine produced by the different samples of human monocytes used in this study is highlighted in Table 1

Table 1.

 The maximum variation in cytokine production by human monocytes exposed to 10 μg/mL R. leguminosarum chaperonin 60.3

graphic file with name i1466-1268-7-2-130-t01.jpg

Open in a new tab

Inhibition of flagellin-induced cytokine synthesis by polymyxin B

The possibility that the polymyxin B used in this study did not block the activity of LPS in a protein-containing solution was checked with a number of recombinant proteins. The effect of 20 μg/mL polymyxin B on the cytokine-inducing activity of recombinant E. coli flagellin incubated with human monocytes over the same range of concentrations as Cpn 60 is seen in Figure 2. This clearly demonstrates that the recombinant protein contains contaminating LPS, which can almost completely be blocked by polymyxin B. The graph shows the effect of polymyxin B on IL-6 synthesis. Other cytokines were also examined, and their synthesis was also blocked by polymyxin B (results not shown).

Fig. 2.

Fig. 2.

Open in a new tab

 Induction of interleukin-6 synthesis by flagellin over the concentration range 10 ng/mL to 10 μg/mL. The inhibitory effect of polymyxin B (PB) is clear. Results are expressed as the mean ± standard error of triplicate cultures

R. leguminosarum Cpn 60.3 stimulation of cytokine production is CD14 dependent

In order to test whether R. leguminosarum Cpn 60.3 activates monocytes through CD14 signaling, the production of the proinflammatory cytokine IL-6 was assessed as a measure of cellular activation. Preincubation of monocytes with the anti-CD14 antibody MY4 blocked IL-6 production in response to either E. coli LPS (Fig 3A) or R. leguminosarum Cpn 60.3 (Fig 3B).

Fig. 3.

Fig. 3.

Open in a new tab

 CD14-dependent production of interleukin (IL)-6 by human monocytes. (A) Lipopolysaccharide-stimulated interleukin (IL)-6 production in the absence (•) or the presence (○) of anti-CD14 antibody. (B) R. leguminosarum chaperonin 60.3–stimulated IL-6 production in the presence of polymyxin B (•) or anti-CD14 antibody (○). Data shown are the means ± standard error for triplicate cultures from a representative experiment

Sequence comparison of Cpn 60.1 and Cpn 60.3

Analysis of the sequences of the 2 proteins reveals 7 runs of sequence where there is significant difference in sequence homology (Fig 4). These are: 1–22, 124–144, 155–164, 212–219, 340–346, 420–436, and 468–484. When these areas are plotted onto the crystal structure of GroEL, they, with the exception of 1–22 and 212–219, are all on the surface of the protein (results not shown).

Fig. 4.

Fig. 4.

Open in a new tab

 Sequence comparison of the 2 rhizobium chaperonin 60 proteins. Areas of maximal sequence dissimilarity are underlined. A 3-dimensional model of the rhizobium chaperonin 60 proteins showing the similarities and differences in amino acid sequences plotted on the surface of the protein

DISCUSSION

There is growing evidence that chaperonins have cell-cell signaling actions (reviewed in Coates et al 1999; Ranford et al 2000). However, almost nothing is known about the structure-activity relationship of the cell-stimulating capacity of these proteins. In previous studies from this group we have shown clear-cut differences between certain Gram-negative Cpn 60 proteins and those from mycobacteria in terms of bone-resorbing activity (Kirby et al 1995; Meghji et al 1997). In this study we have tested 2 of the 3 Cpn 60 gene products of R. leguminosarum, a soil bacterium that can be free-living but that is usually found in symbiosis with leguminous plants that produce nitrogen-fixing root nodules. It has 3 Cpn 60 proteins named 60.1, 60.2, and 60.3 (Wallington and Lund 1994) each of which share 50% amino acid identity with human Hsp60 and between 74.5% and 81.8% identify between themselves. It is thought that R. leguminosarum Cpn 60.1 is the main housekeeping chaperonin. Cpn 60.2 and 60.3 are expressed at very low levels in stressed cells and are not essential for protein folding because deletion mutants lacking these chaperonins demonstrate normal growth (F. Rodriuez-Quinones, M. Maguire, V. Yerko, A. Downie, E. Wallington, P.A. Lund, in preparation). Given the homology of these rhizobium chaperonins to other chaperonins, we assumed that both recombinant chaperonins would have similar cytokine-inducing activity.

We found that Cpn 60.3 reproducibly stimulated monocytes from normal individuals to produce a range of the major proinflammatory cytokines, including IL-1β, TNFα, IL-6, and IL-12, and the chemokine IL-8. It also induced the synthesis of the macrophage-deactivating cytokine IL-10. This chaperonin did not induce the synthesis of the cytokines IL-4, IFNγ, or GM-CSF. There was variation in the maximal responses of the monocytes from the different individuals used in this study. However, the shape of the dose response was uniform. This contrasted with the complete lack of cytokine-inducing activity exhibited by the Cpn 60.1 protein from R. leguminosarum. The latter protein had been shown to be active in protein-folding assays, with both GroES-dependent and -independent substrates (R. George, A. Erbse, P.A. Lund, in preparation), showing that it had itself folded properly and that misfolding was not responsible for the lack of monocyte-activating activity.

A problem in studying recombinant proteins expressed in E. coli is the possibility that the activity is caused by contaminating LPS. Both rhizobium Cpn 60 proteins were expressed in E. coli and were isolated using the same methodology and should have contained similar amounts of this endotoxic material, as was confirmed by the LAL assay. In the presence of the LPS-binding and -inactivating antibiotic polymyxin B, only the Cpn 60.3 expressed cytokine-inducing activity. It is held by certain workers in the field that LPS in protein-containing solutions is more difficult to inhibit with polymyxin B. This has not been our experience, and in order to show that the polymyxin B used in these studies could inhibit the cytokine-inducing activity of LPS-contaminated recombinant proteins, we used it with recombinant E. coli flagellin. We have cloned and expressed this gene for other studies of bacteria-host interactions. When used over the same range of concentrations as Cpn 60.3, it showed some cytokine-inducing activity at concentrations of up to 1 μg/mL—a concentration that gave maximal stimulation of IL-6 synthesis by the rhizobium Cpn 60.3 protein. However, this cytokine-inducing activity could be completely blocked by polymyxin B. This suggests that the cytokine-inducing activity of the rhizobium Cpn 60.3 is an inherent activity of this protein and not the result of LPS contamination that cannot be blocked by polymyxin B.

The inability of R. leguminosarum Cpn 60.1 to induce cytokine production in spite of greater than 70% amino acid identity with Cpn 60.3 suggests that the cytokine-inducing capacity of Cpn 60.3 may reside in a peptide moiety that is not found in Cpn 60.1. Sequence analysis of the R. leguminosarum chaperonins was performed using the Clustal W multiple-alignment method (Thompson et al 1994). A number of regions of reduced homology between Cpn 60.1 and Cpn 60.3 were found, particularly in the C-termini, which showed the least amino acid sequence homology. This sequence analysis may provide candidate regions for peptide analysis to further localize the cytokine-inducing moiety of Cpn 60.3.

A critical question is—how do chaperonins stimulate leukocytes? The best-studied bacterial cytokine inducer is the Gram-negative outer leaflet component LPS, which stimulates a somewhat similar cytokine profile to that reported for Cpn 60.3 (Schletter et al 1995). The high-affinity receptor for LPS is CD14, a glycosylphosphatidylinositol-anchored membrane protein that lacks a cytoplasmic signaling domain (Wright et al 1990; Stelter et al 1996). Cell signaling via CD14 is now believed to require a member of the Toll-like receptor (TLR) family of leukocyte proteins. In the case of LPS, TLR4 is proposed to be the signaling part of a receptor complex (Yang et al 1998; Chow et al 1999) that requires an additional protein component, MD-2, to associate with the extracellular domain of TLR4 (Akashi et al 2000). The resultant complex of TLR4-MD-2 is then capable of activating the intracellular signaling pathways, involving NF-κB and mitogen-activated protein kinases, extracellular regulated kinases, p38, and c-Jun N-terminal kinase (Sweet and Hume 1996), that lead to cytokine production.

We have examined the role of CD14 in the response of human peripheral blood mononuclear cells to Cpn 60 proteins from R. leguminosarum. In our original studies of GroEL, the Cpn 60 of E. coli, we demonstrated that neutralizing anti-CD14 monoclonals did not inhibit its activity (Tabona et al 1998) and that bone from the TLR4-negative mouse strain (C3H/HeJ) still responded to this chaperonin (Kirby et al 1995). However, other workers have reported that the human and chlamydial Cpn 60 proteins activate cells via CD14 (Kol et al 2000; Ohashi et al 2000). In this study we have found that interaction of R. leguminosarum Cpn 60.3 with CD14 is critical to the activation of human monocytes, suggesting that this chaperonin binds to CD14 and, in some as yet unexplained manner, activates cells via TLR4.

What is intriguing about this study is that in spite of the very high sequence homology between the 2 R. leguminosarum Cpn 60 proteins, one can recognise CD14, whereas the other seems oblivious to this protein on the leukocyte cell surface. This suggests that only minor sequence or structural differences (or both) in the Cpn 60 proteins are able to confer ligand-binding specificity and cell activation. The nature of these sequence and structural differences, which so radically polarise the bioactivity of this protein, is the subject of investigation in researchers' laboratories. The recent finding that a single amino acid substitution in GroEL can turn this E. coli chaperonin into a potent insecticidal toxin demonstrates how minor changes in the sequence of Cpn 60 can have significant effects on the bioactivity of this fascinating protein (Yoshida et al 2001).

Acknowledgments

We thank the Sir Jules Thorn Charitable trust for funds provided to J.L. and the Arthritis Research Campaign for funds provided to P.T.

REFERENCES

  1. Akashi S, Shimazu R, Ogata H, Nagai Y, Takeda K, Kimoto M, Miyake K. Cutting edge: cell surface expression and lipopolysaccharide signaling via the toll-like receptor 4-MD-2 complex on mouse peritoneal macrophages. J Immunol. 2000;164:3471–3475. doi: 10.4049/jimmunol.164.7.3471. [DOI] [PubMed] [Google Scholar]
  2. Chen W, Syldath U, Bellmann K, Burkart V, Kolb H. Human 60-kDa heat-shock protein: a danger signal to the innate immune system. J Immunol. 1999;162:3212–3219. [PubMed] [Google Scholar]
  3. Chow JC, Young DW, Golenbock DT, Christ WJ, Gusovsky F. Toll-like receptor-4 mediates lipopolysaccharide-induced signal transduction. J Biol Chem. 1999;274:10689–10692. doi: 10.1074/jbc.274.16.10689. [DOI] [PubMed] [Google Scholar]
  4. Coates ARM, Henderson B, Mascagni P. The unfolding story of the chaperonins. Biotechnol Genet Eng Rev. 1999;16:393–405. doi: 10.1080/02648725.1999.10647985. [DOI] [PubMed] [Google Scholar]
  5. Erbse A, Yifrach O, Jones S, Lund PA. Chaperone activity of a chimeric GroEL protein that can exist in a single or double ring form. J Biol Chem. 1999;274:20351–20357. doi: 10.1074/jbc.274.29.20351. [DOI] [PubMed] [Google Scholar]
  6. Friedland JS, Shattock R, Remick DG, Griffin GE. Mycobacterial 65-kD heat shock protein induces release of proinflammatory cytokines from human monocytic cells. Clin Exp Immunol. 1993;91:58–62. doi: 10.1111/j.1365-2249.1993.tb03354.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Frisk A, Ison CA, Lagergard T. GroEL heat shock protein of Haemophilus ducreyi: association with cell surface and capacity to bind to eukaryotic cells. Infect Immun. 1998;66:1252–1257. doi: 10.1128/iai.66.3.1252-1257.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Galdiero M, Cippolaro de L-Ero G, Marcatili A. Cytokine and adhesion molecule expression in human monocytes and endothelial cells stimulated with bacterial heat shock proteins. Infect Immun. 1997;65:699–707. doi: 10.1128/iai.65.2.699-707.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Horovitz A, Bochkareva ES, Kovalenko O, Girshovich AS. Mutation Ala2→Ser destabilizes intersubunit interactions in the molecular chaperone GroEL. J Mol Biol. 1993;231:58–64. doi: 10.1006/jmbi.1993.1256. [DOI] [PubMed] [Google Scholar]
  10. Ivic A, Olden D, Wallington EJ, Lund PA. Deletion of Escherichia coli groEL is complemented by a Rhizobium leguminosarum groEL homologue at 37°C but not at 43°C. Gene. 1997;194:1–8. doi: 10.1016/s0378-1119(97)00087-5. [DOI] [PubMed] [Google Scholar]
  11. Kirby AC, Meghji S, and Nair SP. et al. 1995 The potent bone resorbing mediator of Actinobacillus actinomycetemcomitans is homologous to the molecular chaperone GroEL. J Clin Investig. 96:1185–1194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Kol A, Lichtman AH, Finberg RW, Libby P, Kurt-Jones EA. Cutting edge: heat shock protein (HSP) 60 activates the innate immune response: CD14 is an essential receptor for HSP60 activation of mononuclear cells. J Immunol. 2000;164:13–17. doi: 10.4049/jimmunol.164.1.13. [DOI] [PubMed] [Google Scholar]
  13. Marcatili A, Cipollaro de l'Ero G, Galdiero M, Folgore A, Petrillo G. TNF-alpha, IL-1 alpha, IL-6, and ICAM-1 expression in human keratinocytes stimulated in vitro with Escherichia coli heat-shock proteins. Microbiology. 1997;143:45–53. doi: 10.1099/00221287-143-1-45. [DOI] [PubMed] [Google Scholar]
  14. Meghji S, White PA, and Nair SP. et al. 1997 Mycobacterium tuberculosis chaperonin 10 stimulates bone resorption: a potential contributory factor in Pott's disease. J Exp Med. 186:1241–1246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ohashi K, Burkart V, Flohe S, Kolb H. Cutting edge: heat shock protein 60 is a putative endogenous ligand of the toll-like receptor-4 complex. J Immunol. 2000;164:558–561. doi: 10.4049/jimmunol.164.2.558. [DOI] [PubMed] [Google Scholar]
  16. Pockley AG, Bulmer J, Hanks BM, Wright BH. Identification of human heat shock protein 60 (Hsp60) and anti-Hsp60 antibodies in the peripheral circulation of normal individuals. Cell Stress Chaperones. 1999;4:29–35. doi: 10.1054/csac.1998.0121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Pockley AG, Wu R, Lemne C, Kiessling R, de Faire U, Frostegard J. Circulating heat shock protein 60 is associated with early cardiovascular disease. Hypertension. 2000;36:303–307. doi: 10.1161/01.hyp.36.2.303. [DOI] [PubMed] [Google Scholar]
  18. Ranford J, Coates ARM, and Henderson B 2000 Chaperonins are cell-signaling proteins: the unfolding biology of molecular chaperones. Exp Rev Mol Med 15 September. Available at http://www-ermm.cbcu.cam.ac.uk/00002015h.htm. [DOI] [PubMed] [Google Scholar]
  19. Reddi K, Meghji S, and Nair SP. et al. 1998 The Escherichia coli chaperonin 60 (groEL) is a potent stimulator of osteoclast formation. J Bone Miner Res. 13:1260–1266. [DOI] [PubMed] [Google Scholar]
  20. Schletter J, Heine H, Ulmer AJ, Rietschel ET. Molecular mechanisms of endotoxin activity. Arch Microbiol. 1995;164:383–389. doi: 10.1007/BF02529735. [DOI] [PubMed] [Google Scholar]
  21. Soltys BJ, Gupta RS. Cell surface localization of the 60 kDa heat shock chaperonin protein (hsp60) in mammalian cells. Cell Biol Int. 1997;21:315–320. doi: 10.1006/cbir.1997.0144. [DOI] [PubMed] [Google Scholar]
  22. Stelter F, Pfister M, Bernheiden M, Jack RS, Bufler P, Engelmann H, Schutt C. The myeloid differentiation antigen CD14 is N- and O-glycosylated. Contribution of N-linked glycosylation to different soluble CD14 isoforms. Eur J Biochem. 1996;236:457–464. doi: 10.1111/j.1432-1033.1996.00457.x. [DOI] [PubMed] [Google Scholar]
  23. Sweet MJ, Hume DA. Endotoxin signal transduction in macrophages. J Leukoc Biol. 1996;60:8–26. doi: 10.1002/jlb.60.1.8. [DOI] [PubMed] [Google Scholar]
  24. Tabona P, Reddi K, and Khan S. et al. 1998 Homogeneous Escherichia coli chaperonin 60 induces IL-1 beta and IL-6 gene expression in human monocytes by a mechanism independent of protein conformation. J Immunol. 161:1414–1421. [PubMed] [Google Scholar]
  25. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673–4680. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Wallington EJ, Lund PA. Rhizobium leguminosarum contains multiple chaperonin (Cpn60) genes. Microbiology. 1994;140:113–122. doi: 10.1099/13500872-140-1-113. [DOI] [PubMed] [Google Scholar]
  27. Wright SD, Ramos RA, Tobias PS, Ulevitch RJ, Mathison JC. CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein. Science. 1990;249:1431–1433. doi: 10.1126/science.1698311. [DOI] [PubMed] [Google Scholar]
  28. Xu Q, Schett G, and Perschinka H. et al. 2000 Serum soluble heat shock protein 60 is elevated in subjects with atherosclerosis in a general population. Circulation. 102:14–20. [DOI] [PubMed] [Google Scholar]
  29. Yamaguchi H, Osaki T, Taguchi H, Hanawa T, Yamamoto T, Kamiya S. Flow cytometric analysis of the heat shock protein 60 expressed on the cell surface of Helicobacter pylori. J Med Microbiol. 1996;45:270–277. doi: 10.1099/00222615-45-4-270. [DOI] [PubMed] [Google Scholar]
  30. Yang RB, Mark MR, and Gray A. et al. 1998 Toll-like receptor-2 mediates lipopolysaccharide-induced cellular signaling. Nature. 395:284–288. [DOI] [PubMed] [Google Scholar]
  31. Yoshida N, Oeda K, Watanabe E, Mikami T, Fukita Y, Nishimura K, Komai K, Matsuda K. Chaperonin turned insect toxin. Nature. 2001;411:44. doi: 10.1038/35075148. [DOI] [PubMed] [Google Scholar]

Articles from Cell Stress & Chaperones are provided here courtesy of Elsevier

RESOURCES