Abstract
Background:
We evaluated the genetic diversity of samples identified morphologically as Fasciola spp. from sheep, cattle and goat from Kermanshah Province, western Iran using PCR-RFLP method.
Methods:
We used PCR-RFLP analysis of ribosomal ITS1 fragment using RsaI restriction enzyme to investigate the genetic characteristics of Fasciola species obtained from different hosts (16 sheep, 28 cattle, 4 goats). The species of Fasciola were confirmed by sequencing the 700 bp region of ribosomal ITS1 gene.
Results:
In Kermanshah, F. hepatica was present in 96% of the samples, F. gigantica was found only in two cattle sample. No hybrid forms were detected in the present study.
Conclusion:
Our results contribute to clarify the dark spots of Fasciola genotyping in different parts of Iran.
Keywords: Fasciola hepatica, Fasciola gigantica, Genotype, PCR, Iran
Introduction
Fascioliasis in livestock and humans is caused by two of the most socioeconomically important trematodes: F. hepatica Linnaeus, 1758 and F. gigantica Cobbold, 1855, respectively (1). A number of freshwater snails of the family Lymnaeidae serve as intermediate hosts. Humans and animals are infected by eating aquatic vegetables or drinking water contaminated with the infective meta-cercariae (2).
Human fascioliasis is a foodborne disease, included in the WHO list of neglected tropical diseases (NTD) (3). More than 180 million people are at risk of fascioliasis with 2.4–17 million individuals infected (2). Fasciola hepatica appears mainly in Europe, the Americas and Oceania, and F. gigantica occurs mainly in Africa and Asia (1). The distributions of both species overlap in many countries of Africa and Asia and leads to many problems as for identification (4).
The differentiation of Fasciola species is essential because their intermediate host, epidemiological characteristics, control strategies, host specificity, drug susceptibility and virulence is different (5).
Although fasciolid species can generally be distinguished by morphological characters, but both fasciolid species are polymorphic with many factors affecting the morphology and leading to considerable taxonomic confusion (6).
Nowadays morphological methods are incomplete and imperfect and various molecular and genetic techniques based on DNA analyses have been employed for distinguish species confirmation and genetic structuring of parasitic populations (6, 7). Reaction-restriction fragment length polymorphisms (PCR-RFLP) assay is very rapid, simple, inexpensive, easy to perform and appropriate method for distinguish of F. hepatica from F. gigantica (8–10). However, for more detailed and complete interpretation of the results consequent sequence analysis of target DNA is recommended.
In Iran, the prevalence of fascioliasis is 0.1% to 91.4% in various livestock (11). Ectopic infection with fascioliasis in non-hepatic sites such as the thyroid, eye or skin, have been reported from Iran (12, 13).
Kermanshah Province is located in western of Iran. This province is divided into three distinct portions: Warm, moderate and cold climates and suitable pastures for traditional rearing of domestic animals. F. hepatica and F. gigantica have been reported from a range of mammals including buffalo, cattle, sheep and goat based on morphological features in this province. A small outbreak of 17 cases of human fascioliasis happened in the province in 1998 and verified a new emerging focus of human fascioliasis in western part of the country (14, 15).
The aim of this study was to identify and differentiate Fasciola flukes by PCR-RFLP of ITS1 analysis for epidemiological applications especially in regions where the two species overlap in Kermanshah Province. Besides, we analyzed their phylogenetic relationship with populations from other countries.
Materials and Methods
Parasite
Adults of F. hepatica and F. gigantic were collected from the bile ducts of different livestock at slaughterhouses in Kermanshah, Iran from September 2014 to September 2015. Flukes were washed in saline solution and subsequently stored in 70% ethanol until required for PCR and sequencing.
Genomic DNA Extraction and PCR-RFLP analysis
Genomic DNA was extracted from the adult flukes using DNGTM-plus Kit (CinnaGen, Iran) following manufacturer’s recommendations. The ITS1 region was amplified using two primers forward (5′- TTGCGCTGATTACGTCCCTG -3′) and Reverse (5′- TTGGCTGCGCTCTTCATCGAC -3 ′). The primers were synthesized by Bioneer Company (Korea). PCR amplifications were performed in 15 μl reactions containing of 7.5 μl master mix (Amplicon), 0.5 μl of each primers (5 pmol) (Forward and Reverse), 1.5 μl genomic DNA, and 5 μl distilled water. The reactions were performed as follows: pre-denaturation at 95 ºC for 5 min, 30 cycles of denaturation at 94 ºC for 30 sec, annealing at 50 ºC for 30 sec, elongation at 72 ºC for 30 s, followed by a final extension at 72 ºC for 5 min. The PCR products were separated in 1.5 % agarose gel using Simply Safe (Eurx, Poland). A PCR-RFLP method was used to distinguish specifically F. hepatica from F. gigantica in ITS1with RsaI enzyme (9). To confirm results PCR-RFLP, a fragment of 700 bp from the ITS1 gene was sequenced for seven cases. Sequencing was performed in forward direction using Sanger sequencing (Macrogen Inc. Korea, ABI3730XL).
Data analysis
Sequences were performed using Bioedit Sequence Alignment Editor, version 5.0.9 (Hall, 1999). Then resulted sequences aligned against nr database using BLAST 2.0 to find the closest entries. Multiple sequence alignment was carried out using the ClustalW with default parameters; alignments were visualized using jalview software. Phylogenetic analysis was performed using MEGA 6 package with neighbor joining method and default parameters.
Results
PCR-RFLP Analysis
Overall, 48 adult flukes were collected from 28 cattle, 16 sheep, and 4 goats from the abattoirs of Kermanshah Province.
PCR product of ITS1 resulted in a fragment size of 700 bp. Amplicons were subsequently digested using the Rsa I restriction enzyme. This approach yielded the identification of two genetically distinct banding patterns belonging to the genus Fasciola: the hepatica genotype displays five bands of about 367, 104, 68, 59, 54, and 28 bp, the gigantica genotype shows five bands of about 367, 172, 59, 54, and 28 bp.
Based on RFLP pattern, from 48 Fasciola isolates, 4 isolates (100%) from goat had a RFLP pattern corresponding to F. hepatica, 27 (96%) and 1 (4%) isolates from cattle had an RFLP pattern corresponding F. hepatica and F. gigantica, respectively. Fifteen isolates (94%) and 1 isolates (6%) from sheep had RFLP pattern corresponding to F. hepatica and F. gigantica, respectively (Fig. 1).
Fig. 1:
PCR-RFLP pattern of Fasciola after digestion with Rsa I restriction enzyme. Lane 7: 50bp DNA ladder, Lane 1: F. gigantica from cattle, Lane 2: F. hepatica from cattle, Lane 3: F. hepatica from sheep, Lanes 4: F. gigantica from sheep after digestion with Rsa I restriction enzyme. Lane 5: F. hepatica from cattle before digestion with Rsa I restriction enzyme, Lane 6: F. gigantica from sheep before digestion with Rsa I restriction enzyme
The sequences of 700 bp ITS 1 of the flukes were analyzed and aligned with those of available sequences in GenBank using multalin (http://multalin.toulose.inra.fr/multalin) software in comparison (Fig. 2). There was no nucleotide variation in the ITS-1 rDNA sequences among the F. hepatica and F. gigantica samples examined. Some sequences of F. hepatica and F. gigantica were analyzed and deposited in GenBank (Table 1). One-hundred percent similarities were obtained in comparison of these sequences with all available data of Fasciola spp. in GenBank.
Fig. 2:
Phylogenetic trees were obtained by using MEGA 6.0 (Tamura 3- parameter model) with bootstrap values of 1000 replicates set for neighbor-joining. Fasciolopsis buski was used as the out group. * Sequences from specimens isolated in different hosts from our study
Table 1:
Sequencing profile of Fasciola Spp.
| Specimen code | Species | Haplotype | Host | Sequence analysis | ITS 1 types Accession no. | PCR-RFLP Analysis |
|---|---|---|---|---|---|---|
| 0029 | F. hepatica | H1 | Cattle | F. hepatica | KX179506 | F. hepatica |
| 001 | F. gigantica | G1 | Sheep | F. gigantica | KX179507 | F. gigantica |
| 002 | F. hepatica | H1 | Cattle | F. hepatica | KX179508 | F. hepatica |
| 0017 | F. hepatica | H1 | Cattle | F. hepatica | KX097057 | F. hepatica |
| 0027 | F. gigantica | G1 | Cattle | F. gigantica | KX097058 | F. gigantica |
| 0047 | F. hepatica | H1 | Cattle | F. hepatica | KX097059 | F. hepatica |
| 0013 | F. hepatica | H1 | Sheep | F. hepatica | KX097060 | F. hepatica |
Phylogenic tree
The length of the trimmed aligned ITS 1 sequence was 350 base pairs. Phylogenetic analysis of Fasciola samples based on the ITS1 region revealed 2 haplotypes (1 F. gigantica and 1 F. hepatica) (Figure 2). Therefore suggesting that two species of Fasciola are able to infect domesticated animals and probably human in west of Iran. Some sequences of F. hepatica and F. gigantica in our study were analyzed and deposited in Gen-Bank (Table 1).
Discussion
The present paper provides additional information on the molecular epidemiology of fascioliasis in Kermanshah regions. Characterization of the population genetic variability of Fasciola species is useful as it can help disease surveillance, diagnosis and control of the parasite.
The prevalence of fasciolosis in Kermanshah has been reported to be 0.25% in livestock (16).
Molecular characterization using a PCR-RFLP approach on a nuclear marker has revealed that F. hepatica was more prevalent than F. gigantica in Kermanshah, confirming previous studies that F. hepatica is found in temperate areas while F. gigantica mainly in tropical zones (9). In tropical regions when both species are present, F. gigantica is commonly endemic in lower areas and F. hepatica is endemic in the highlands (17, 18).
The distribution of the two species overlaps in some countries and the presence of hybrid form of Fasciola has been reported from livestock or human in Asian countries, such as Iran (19), Thailand (20), Vietnam (21), and Pakistan (22). Phenotypic differences of the liver fluke have been recognized, suggesting hybridization of the two species. This indicates that intermediate forms may exist within our study region, although none has been found in this study.
Analyses based on the nuclear markers such as ITS 1 and 2 are useful for species confirmation, whereas mitochondrial markers such as cytoch-rome c oxidase (CO1) and nicotinamide dinucleotide dehydrogenase subunit-1 (ND1) are more variable because its mutation rate is often fast and can be used to distinguish closely related species and populations of Fasciola.
Our findings showed that all isolates belonging to F. hepatica and F. gigantica were of common H1 and G1 haplotype, respectively but the comparisons with ITS1 sequences of F. hepatica and F. gigantica from other localities showed nucleotide differences at least in one position.
Haplotype G1 of F. hepatica has been reported already from Ardabil (9) and Guilan (23) from Iran, as well as from Uruguay (24), Egypt (25) and Saudi Arabia (26) as well. Besides, haplotype G1 of F. gigantica has been reported from Zambia (24), Egypt (27), Thailand (28), plus Ardabil from Iran (9).
Two species Fasciola require a particular snail as an intermediate host in order to complete their life cycle. The main intermediate host of F. hepatica in Iran is Lymnaea truncatula while the main intermediate host of F. gigantica is L. gedrosiana (11). The distribution of Fasciola species is determined by the ecological characteristics such as population dynamics, anthropophylic characteristics, type of water bodies the availability of the snail intermediate hosts (29).
Conclusion
Lack of data on the susceptibility of potential intermediate hosts to Fasciola infection in the present study makes it difficult to determine the role of these snails in the transmission of parasite.
Complementary studies are needed to determine the prevalence of Fasciola species and to determine the presence of the parasite in its snail hosts risk area. We cannot forget that the correct identification of lymnaeidae is a key element to detect possible transmission foci and to estimate the infection risk.
Ethical considerations
Ethical issues (Including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors.
Acknowledgments
The study was supported financially by a grant from Tehran University of Medical Sciences No. 26478. The authors declare that there is no conflict of interests.
References
- 1.Mas-Coma S, Valero MA, Bargues MD. (2009). Fasciola, lymnaeids and human fascioliasis, with a global overview on disease transmission, epidemiology, evolutionary genetics, molecular epidemiology and control. Adv Parasitol, 69:41–146. [DOI] [PubMed] [Google Scholar]
- 2.Mas-Coma S, Bargues M, Valero M. (2005). Fascioliasis and other plant-borne trematode zoonoses. Int J Parasitol, 35(11):1255–78. [DOI] [PubMed] [Google Scholar]
- 3.WHO , 2012. Accelerating Work to Overcome the Global Impact of Neglected Tropical Diseases; A Roadmap for Implementation – Executive Summary.
- 4.MAS CS, Bargues M. (1997). Human liver flukes: a review. Res Rev Parasitol, 57(3–4):145–218. [Google Scholar]
- 5.Ashrafi K, Valero M, Panova M, Periago M, Massoud J, Mas-Coma S. (2006). Phenotypic analysis of adults of Fasciola hepatica, Fasciola gigantica and intermediate forms from the endemic region of Gilan, Iran. Parasitol Int. 55(4):249–60. [DOI] [PubMed] [Google Scholar]
- 6.Teofanova D, Yoveva A, Radoslavov G, Hristov P. Issues Associated with Genetic Diversity Studies of the Liver Fluke, Fasciola heptica (Platyhelminthes, Digenea, Fasciolidae). INTECH Open Access Publisher; 2012.
- 7.Rokni M, Mirhendi H, Behnia M, Jalalizand N. (2010). Molecular characterization of Fasciola hepatica isolates by RAPD-PCR and ribosomal ITS1 sequencing. Iran Red Crescent Med J, 2010(1):27–32. [Google Scholar]
- 8.Rokni MB, Mirhendi H, Mizani A, Mohebali M, Sharbatkhori M, Kia EB, Abdoli H, Izadi S. (2010). Identification and differentiation of Fasciola hepatica and Fasciola gigantica using a simple PCR-restriction enzyme method. Exp Parasitol, 124(2):209–13. [DOI] [PubMed] [Google Scholar]
- 9.Aryaeipour M, Rouhani S, Bandehpour M, Mirahmadi H, Kazemi B, Rokni MB. (2014). Genotyping and Phylogenetic Analysis of Fasciola Spp. Isolated from Sheep and Cattle Using PCR-RFLP in Ardabil Province, Northwestern Iran. Iran J Public Health, 43(10):1364. [PMC free article] [PubMed] [Google Scholar]
- 10.Shoriki T, Ichikawa-Seki M, Suganuma K, Naito I, Hayashi K, Nakao M, Aita J, Mohanta UK, Inoue N, Murakami K. (2016). Novel methods for the molecular discrimination of Fasciola spp. on the basis of nuclear protein-coding genes. Parasitol Int, 65(3):180–3. [DOI] [PubMed] [Google Scholar]
- 11.Ashrafi K. (2015). The Status of Human and Animal Fascioliasis in Iran: A Narrative Review Article. Iran J Parasitol, 10(3):306. [PMC free article] [PubMed] [Google Scholar]
- 12.Rokni M. (2008). The present status of human helminthic diseases in Iran. Ann Trop Med Parasitol, 102(4):283–95. [DOI] [PubMed] [Google Scholar]
- 13.Dalimi A, Jabarvand M. (2005). Fasciola hepatica in the human eye. Trans R Soc Trop Med Hyg, 99(10):798–800. [DOI] [PubMed] [Google Scholar]
- 14.Hatami H, Asmar M, Masoud J, Mansouri F, Namdaritabar H, Ramazankhani A. (2012). The first epidemic and new-emerging human fascioliasis in Kermanshah (western Iran) and a ten-year follow up, 1998–2008. Int J Prev Med, 3(4). 266–272. [PMC free article] [PubMed] [Google Scholar]
- 15.Rokni MB, Lotfy WM, Ashrafi K, Murrell KD. Neglected Tropical Diseases-Middle East and North Africa. Springer; 2014:59–90. [Google Scholar]
- 16.Parviz M, Rezaii M, Yahyaei M, Mozafari SH. (2012). Survey of the rate of parasitic infections (Fasciola, Dicroceolium, hydatid cyst) in abbatoires of Kermanshah in 2009–2010. Iran J Vet Lab Res, 1: 4(1): 109. [Google Scholar]
- 17.Malone J, Gommes R, Hansen J, Yilma J, Slingenberg J, Snijders F, Nachtergaele F, Ataman E. (1998). A geographic information system on the potential distribution and abundance of Fasciola hepatica F. gigantica in east Africa based on Food and Agriculture Organization databases. Vet Parasitol, 78(2):87–101. [DOI] [PubMed] [Google Scholar]
- 18.Ashrafi K, Massoud J, Holakouei K, Mahmoodi M, Joafshani M, Valero M, Fuentes M, Khoubbane M, Artigas P, Bargues M. (2004). Evidence suggesting that Fasciola gigantica might be the most prevalent causal agent of fascioliasis in northern Iran. Iran J Public Health, 33(4):31–7. [Google Scholar]
- 19.Amor N, Halajian A, Farjallah S, Merella P, Said K, Slimane BB. (2011). Molecular characterization of Fasciola spp. from the endemic area of northern Iran based on nuclear ribosomal DNA sequences. Exp Parasitol, 128(3):196–204. [DOI] [PubMed] [Google Scholar]
- 20.Wannasan A, Khositharattanakool P, Chaiwong P, Piangjai S, Uparanukraw P, Morakote N. (2014). Identification of Fasciola species based on mitochondrial and nuclear DNA reveals the co-existence of intermediate Fasciola and Fasciola gigantica in Thailand. Exp Parasitol, 146(64–70. [DOI] [PubMed] [Google Scholar]
- 21.Le TH, Van De N, Agatsuma T, Nguyen TGT, Nguyen QD, McManus DP, Blair D. (2008). Human fascioliasis and the presence of hybrid/introgressed forms of Fasciola hepatica and Fasciola gigantica in Vietnam. Int J Parasitol, 38(6):725–30. [DOI] [PubMed] [Google Scholar]
- 22.Chaudhry U, van Paridon B, Shabbir M, Shafee M, Ashraf K, Yaqub T, Gilleard J. (2016). Molecular evidence shows that the liver fluke Fasciola gigantica is the predominant Fasciola species in ruminants from Pakistan. J Helminthol, 90(2):206–13. [DOI] [PubMed] [Google Scholar]
- 23.Sharifiyazdi H, Moazeni M, Rabbani F. (2012). Molecular characterization of human Fasciola samples in Gilan Province, Northern Iran on the basis of DNA sequences of ribosomal and mitochondrial DNA genes. Comp Clini Path, 21(5):889–94. [Google Scholar]
- 24.Itagaki T, Kikawa M, Sakaguchi K, Shimo J, Terasaki K, Shibahara T, Fukuda K. (2005). Genetic characterization of parthenogenic Fasciola sp. in Japan on the basis of the sequences of ribosomal and mitochondrial DNA. Parasitology, 131(05):679–85. [DOI] [PubMed] [Google Scholar]
- 25.Amer S, Dar Y, Ichikawa M, Fukuda Y, Tada C, Itagaki T, Nakai Y. (2011). Identification of Fasciola species isolated from Egypt based on sequence analysis of genomic (ITS1 and ITS2) and mitochondrial (NDI and COI) gene markers. Parasitol Int, 60(1):5–12. [DOI] [PubMed] [Google Scholar]
- 26.Shalaby I, Gherbawy Y, Banaja A. (2013). Molecular characterization of Fasciola species isolated from imported sheep in Taif region (Saudi Arabia). Trop Biomed, 30(1):15–26. [PubMed] [Google Scholar]
- 27.Dar Y, Amer S, Mercier A, Courtioux B, Dreyfuss G. (2012). Molecular identification of Fasciola spp.(Digenea: Fasciolidae) in Egypt. Parasite, 19(2):177–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Ichikawa M, Itagaki T. (2010). Discrimination of the ITS1 types of Fasciola spp. based on a PCR–RFLP method. Parasitol Res, 106(3):757–61. [DOI] [PubMed] [Google Scholar]
- 29.Bargues MD, Artigas P, Khoubbane M, Flores R, Glöer P, Rojas-García R, Ashrafi K, Falkner G, Mas-Coma S. (2011). Lymnaea schirazensis, an overlooked snail distorting fascioliasis data: Genotype, phenotype, ecology, worldwide spread, susceptibility, applicability. PLoS One, 6(9):e24567. [DOI] [PMC free article] [PubMed] [Google Scholar]