Skip to main content
NCBI home page
Molecular Therapy logoLink to Molecular Therapy
. 2016 Oct 4;24(11):1949–1964. doi: 10.1038/mt.2016.163

Adaptive Immune Response Impairs the Efficacy of Autologous Transplantation of Engineered Stem Cells in Dystrophic Dogs

Clementina Sitzia 1,2, Andrea Farini 1,2, Luciana Jardim 2, Paola Razini 1, Marzia Belicchi 1,3, Letizia Cassinelli 1, Chiara Villa 1, Silvia Erratico 3, Daniele Parolini 1, Pamela Bella 1, Joao Carlos da Silva Bizario 4, Luis Garcia 5, Marcelo Dias-Baruffi 2, Mirella Meregalli 1,3, Yvan Torrente 1,3,*
PMCID: PMC5154479  PMID: 27506452

Abstract

Duchenne muscular dystrophy is the most common genetic muscular dystrophy. It is caused by mutations in the dystrophin gene, leading to absence of muscular dystrophin and to progressive degeneration of skeletal muscle. We have demonstrated that the exon skipping method safely and efficiently brings to the expression of a functional dystrophin in dystrophic CD133+ cells injected scid/mdx mice. Golden Retriever muscular dystrophic (GRMD) dogs represent the best preclinical model of Duchenne muscular dystrophy, mimicking the human pathology in genotypic and phenotypic aspects. Here, we assess the capacity of intra-arterial delivered autologous engineered canine CD133+ cells of restoring dystrophin expression in Golden Retriever muscular dystrophy. This is the first demonstration of five-year follow up study, showing initial clinical amelioration followed by stabilization in mild and severe affected Golden Retriever muscular dystrophy dogs. The occurrence of T-cell response in three Golden Retriever muscular dystrophy dogs, consistent with a memory response boosted by the exon skipped-dystrophin protein, suggests an adaptive immune response against dystrophin.

Introduction

Duchenne muscular dystrophy (DMD), the most common form of muscular dystrophy, is a lethal X-linked recessive disorder caused by a deficiency of dystrophin protein.1,2,3 In the early phase of the disease; a chronic regenerative process exhausts the self-renewal potential of DMD stem cells (SCs). This condition leads to muscular fibrosis in which most muscle tissue is lost and replaced by connective tissue and, consequently, progressive muscle weakness and atrophy arise.4 DMD patients are confined to wheelchair before the age of 12 years and eventually die from heart and respiratory failure.1,3 No effective treatment exists although novel therapeutic strategies, ranging from new drugs to gene and cell therapy, hold promises for significant advances.5 In particular, different types of SCs have been shown to partially rescue the pathological phenotype in dystrophic mice.3,6,7,8,9,10 We have previously demonstrated the stem characteristics of circulating human CD133+ cells and their ability to restore dystrophin expression and eventually regenerate the satellite cell pool in dystrophic scid/mdx mice after intramuscular and intra-arterial delivery.8,11 We have also isolated CD133+ cells from normal and dystrophic muscular biopsies, showing that the intramuscularly injection of muscle-derived CD133+ cells in DMD patient is a safe and feasible procedure.12 In addition, dystrophic CD133+ cell population derived from skeletal muscle, transduced with a lentivirus carrying antisense oligonucleotides (AONs) able to skip exon 51, can induce the expression of an exon-skipped version of human dystrophin, and participate to muscle regeneration after in vivo transplantation into scid/mdx mice.11 Although these results might have an important impact for DMD therapeutic approach, in order to proceed to a clinical trial it is essential to show efficacy in large animal model of muscular dystrophy, mainly in nonsyngeneic transplants. In this context, the dystrophin-deficient dog, the Golden Retriever muscular dystrophy (GRMD) dog, fulfills a great importance, because it mimics more closely the human disease than other existing mammalian models of dystrophin deficiency.13 GRMD is caused by a frameshift mutation in intron 6 of the dystrophin gene.14,15 It is a severe form of dystrophy, which displays dystrophic muscle lesions, inflammatory foci, progressive fibrosis, fatty infiltration, early locomotor impairment, and premature death due to respiratory or cardiac failure. A wide interindividual variability also figures among the numerous similarities shared by canine and human diseases, even though the walking complications shown by GRMD dogs starting from 8 months of age is a feature only of the canine pathology. Here, we want to assess the long-term efficacy of combined gene and stem cell therapy, represented by the exon skipping correction and the autologous transplantation of muscle-derived CD133+ stem cells (133+musSCs) in GRMD dogs, respectively. The results show that it is possible to transplant engineered CD133+ stem cells into dystrophic dogs to obtain a reconstitution of fibers expressing dystrophin, an improvement in the clinical measure outcomes, and, in many cases, a preservation of walking ability within the first year of treatment. Of note, the occurrence of dystrophin in canine muscle appears only 1 year after the first injection. Surprisingly, the effort to increase dystrophin expression with an additional infusion evokes a dramatic worsening of the clinical conditions in three out of five treated GRMD dogs. These findings set the evidence for the existence of an immune response trigger point mediated by the amount of dystrophin expression in predisposed GRMD dogs.

Results

Experimental plan

Eighteen GRMD dogs were divided on the basis of their phenotype in mild and severe-affected as described in Materials and Methods Section, and treated as described in Table 1. Briefly, n = 10 not-injected GRMD dogs were used as control and named untreated dogs (n = 5 mild and n = 5 severe). Two mild GRMD dogs (C01 and C02) and one severe GRMD dog (C03) were injected with autologous 133+musSCs and named cell-treated dogs. Two GRMD dogs characterized by a mild phenotype (T01 and T02) and three dogs characterized by a severe phenotype (T03, T04, and T05) were injected with their own engineered LVex6-8133+musSCs to correct dystrophic mutation and they were named LVex6-8cell-treated dogs. Multiple infusions were performed (three injections in the course of 1 year) accordingly with previous published data,16 in order to improve the efficacy of cell transplantation.

Table 1. Description of the intra-arterial serial injections of GRMD dogs.

graphic file with name mt2016163t1.jpg

Open in a new tab

Isolation and characterization of canine 133+musSCs

Fluorescence-activated cell sorting (FACS) analysis of 133+musSCs isolated from muscular biopsies of each dog showed the expression of CD133 antigen for <1% of cells, consistently with in vivo distribution. The presence of CD133+ cells was also confirmed through immunofluorescence staining of tibialis cranialis muscle, revealing CD133+ cells within the dystrophic muscle, and surrounding the myofibers (Figure 1a). Freshly isolated 133+musSCs from dystrophic canine muscle showed more than 95% of purity and CD34 antigen coexpression for more than 50% (Figure 1b). 133+musSCs were also positive for CXCR4 (2.3%), but they were negative for CD45 (Figure 1c,d). Moreover, immediately after the isolation, CD133+ cells displayed morphology similar to the human counterpart as previously published (Figure 1e).11 After 7 days in culture in stem cell conceived medium, they displayed a high proliferation rate (Figure 1f). Differentiation assay in specific cell culture medium showed that canine 133+musSCs, like human CD133+ cells,8 could differentiate into endothelium, as confirmed by the assembling of the endothelium tubes (Figure 1g). Confocal images of fluorescent staining showed cell differentiation into satellite cells, as confirmed by co-staining of Pax-7 and desmin (respectively, red and green in Figure 1h). In serum deprived medium condition, 133+musSCs fused and formed myotubes expressing desmin (green in Figure 1i) and myosin heavy chain (red in Figure 1i,j). Proliferation assay revealed a good rate of proliferation of 133+musSCs with no statistical differences (P = 0.1) in the proliferation rate among the dystrophic dogs (Figure 1k), and 2.2 numbers of doublings. MTT assay confirmed that more of 90% of 133+ musSCs were viable and proliferating (Figure 1l).

Figure 1.

Figure 1

Open in a new tab

Characterization of 133+musSCs. (a) In vivo characterization of 133+musSCs (green) around untreated Golden Retriever muscular dystrophy (GRMD) muscle fibers (laminin in violet). (b) Fluorescence-activated cell sorting (FACS) analysis of muscle derived cells from homogenized tibialis cranialis showed CD133 and CD34 coexpression (c,d) FACS characterization of freshly isolated CD133+musSCs: median purity value (95%); CD133 and CD34 coexpression (>50%), and CXCR4 antigen expression (2.3%). No expression of CD45 antigen. (e) 133+musSCs 24 hours after cell sorting, and (f) in proliferation medium for 7 days. (g) Vascular structures of dystrophic 133+musSCs in endothelial differentiation medium for 21 days. (h) Pax7 (green) and desmin (red) coexpression of CD133+musSCs in muscle differentiation medium. (i,j) Desmin positive (green) fused myoblasts, desmin (green), and Myosin Heavy Chain (red) positive completely differentiated myotubes derived from 133+musSCs. (k) 133+muscSC proliferation rate during 4 weeks of culture. (l) Viability and 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) (MTT) assay showed cell viability as a percentage of viable cells on total cells (n = 3 replicates). (m) FACS immunophenotyping of LVex6-8133+musSCs and (n-) in vitro culture optical images. (o) Optical images of LVex6-8133+musSCs in colture in differentiation medium. (p) LVex6-8133+musSCs myotube desmin expression (green). Nuclei were costained with 4′,6-diamidino-2-phenylindole (DAPI) (blue) for all the confocal images. All images were captured with a confocal microscope Leica TCS SP2 (Leica, Germany): 20× magnification. (q,r) Proliferation rate during 4 weeks of culture and (r) viability assessed by MTT assay of LVex6-8133+musSCs demonstrating no change of cell behaviour after lentiviral transduction. (s) Fluorescent in situ hybridization (FISH) analysis of LVex6-8133+musSCs for the expression of U7 probe (red), showing the presence of vector in nuclei (DAPI) of transduced cells (t) and no signal could be observed in not-infected cells.

Canine 133+musSCs transduction and in vitro analysis of skipping efficiency of LVex6-8133+musSCs

Autologous 133+musSCs cells were transduced with lentivirus containing a cassette able to skip exon 6–8 of dystrophin to exclude the GRMD-mutation from mature dystrophin transcript. After infection with LV-ex6-8, the presence of 133+musSCs and their typical morphology were confirmed, respectively by FACS (Figure 1m) and optical (Figure 1n) analysis. To confirm the induced expression of the canine skipped dystrophin mRNA, we performed nested reverse transcription-polymerase chain reaction (RT-PCR) analysis on infected cells. A skipped-exon 5–9 or 5–10 dystrophin mRNA was subsequently detected and a minimum of 107 ip/ml was needed to obtain truncated transcript in LVex6-8133+musSCs. We analyzed the bands obtained by RT-PCR as previously published,17,18 and we calculated the ratio (nontruncated dystrophin/truncated dystrophin) representing the percentage of skipping efficiency (≈ 33/47%) (data not shown). To gain more insight into the intracellular pool of LVex6-8, we labeled LVex6-8133+musSCs with a probe to detect U7 transcript deriving from lentivirus cassette (LNA mRNA detection 5′TEX615 U7). More than 72% of LVex6-8133+musSCs showed localization of LNA mRNA detection 5′TEX615 U7 probe (Figure 1s). LVex6-8133+musSCs maintained their capacity to well differentiate in myotubes expressing MyHC (Figure 1o,p) and presented similar rate of proliferation and viability (Figure 1q,r). Remarkably, no differences were observed in the behavior of infected or untreated cells deriving from mild or severe affected dogs in term of proliferation/viability or differentiative potential (Figure 1r).

Efficacy of autologous LVex6-8133+musSCs transplantation

Intra-arterial injections of 5 × 106cells/kg were performed following the scheme illustrated in Table 1. Dogs were injected with autologous engineered LVex6-8133+musSCs (LVex6-8cell-treated dogs) or with un-modified 133+musSCs (cell-treated dogs): this control group was established to monitor the possible effect of cell-releasing factor on muscle trophism. The experimental protocol allowed us to inject a homogeneous cell suspension, avoiding thrombi formation (see Supplementary Figure S1). There was no visible damage to the vessel wall during or after injection. Biopsies from treated and untreated control dogs were taken at different time points (T0, before the injection; T6 and T12, respectively 6 months and 1 year after the first injection; TS, at sacrifice) from the tibialis cranialis and vastus lateralis, and analyzed for morphology (Azan Mallory-AM) and dystrophin expression. At T0 LVex6-8cell-treated dogs, cell-treated dogs, and the untreated dogs presented a dystrophic phenotype with high variability in myofiber size and with a pattern of degeneration (multifocal groups of necrotic fibers with variable phagocytosis) and regeneration (multifocal groups of small caliber fibers with a basophilic appearance). Endomysial and perimysial connective tissue replacement was also observed together with rare calcified deposits (data not shown). Mild and severe untreated dogs proved evidence of basal percentage of dystrophin expressing fibers ranging 5–7%. AM staining of mild phenotype LVex6-8cell-treated and cell-treated GRMD dogs (C01, C02, T01, and T02) showed a well-preserved morphology throughout the biopsy time points (Figure 2a and Figure 3a and Supplementary Figure S2). Nevertheless, some morphology variability between tibialis cranialis and vastus lateralis was visible (Figure 2a and Figure 3a and Supplementary Figure S2), in line with previous results,19 reporting intra-muscle variability as muscular dystrophy feature. Rare or no signs of dystrophin expression were detected 6 months after the first injection in mild phenotype LVex6-8cell-treated and cell-treated GRMD dogs, matching with the basal dystrophin expression of untreated dogs (T6; Figure 2a and Figure 3a and Supplementary Figure S2). The expression of dystrophin increased only in mild LVex6-8cell-treated dogs at T12 and it was preserved qualitatively uniform up to the sacrifice. No differences in terms of muscle morphology and dystrophin expression among mild LVex6-8cell-treated dogs were evident (T6; Figure 2a and Figure 3a and Supplementary Figure S2). LVex6-8cell-treated severe GRMD dogs and cell-treated severe GRMD one (C03) showed a muscle morphology characterized by cell infiltrates and an important collagen and fat deposition, as evident in AM staining (Figure 2a and Figure 3a and Supplementary Figure S2). Dystrophin expression was undetectable at T6, while through 12 months the number of dystrophin positive myofibers increased in LVex6-8cell-treated dogs (Figure 2a and Figure 3a and Supplementary Figure S2). During these months, severe phenotype dogs displayed a qualitatively more important both inter-dogs and intramuscular variability, regarding morphology and dystrophin expression: in general, the better the muscle morphology was preserved, the higher was the percentage of dystrophin expressing fibers (Table 1). For instance, biopsies from GRMD T04 at T12 revealed well-preserved morphology although signs of muscle necrosis and regeneration were still present. At TS, biopsies from severe LVex6-8cell-treated dogs showed an unexpected and severe decrease in the number of dystrophin expressing myofibers and in GRMD T05 we did not detect dystrophin in any of the analyzed muscles. Figure 2b and Figure 3b showed dystrophin expression change throughout the experimental time in the tibialis cranialis and vastus lateralis of LVex6-8cell-treated dogs: (i) percentage of dystrophin expression changed neither for the mild nor for the severe phenotype at T6 and (ii) at T12 all the LVex6-8cell-treated GRMD dogs showed increased expression of dystrophin up to 60%, even though these data presented a high variability for LVex6-8cell-treated severe GRMD dogs (T03, T04, and T05). Consistently with immunofluorescence staining, at the euthanasia time point only GRMD T01 and T02 maintained dystrophin expression, whereas the severe LVex6-8cell-treated dogs showed completely dystrophin lack. As expected no change in dystrophin expression was observed in cell-treated mild GRMD dogs (C01, C02, and C03), where the percentage of dystrophin expressing fibers ranged ~3% on the total fiber number throughout the follow up (see Supplementary Figure S2b). Measurements of myofiber mean diameters revealed no changes at T6 and T12 in LVex6-8cell-treated mild GRMD dogs (T01 and T02); conversely, in the same period, the severe phenotype LVex6-8cell-treated dogs showed an increased variability and mean diameters of the myofibers, followed by a slight decrease at the euthanasia time points (Figure 2c and Figure 3c). Of note, in case of severe phenotype, there was marked myofiber size variability, increasing through the time points, as confirmed by the high standard deviations of data. No difference in myofiber mean diameter trend was found between tibialis cranialis and vastus lateralis (Figure 2c and Figure 3c). Cell-treated dogs did not show significant changes in myofiber mean diameters, unless for a slight age-dependent mean diameters decrease throughout the time (see Supplementary Figure S2c). Muscular biopsies from LVex6-8cell-treated dogs were tested for the presence of LV-cassette transcript (tLNA mRNA detection 5′TEX615 U7 probe). Following fluorescent in situ hybridization analysis, we demonstrated the presence of muscle fibers with peripheral U7 positive nuclei (Figure 4a). Immunofluorescence experiments showed that many clusters of chimeric muscle fibers, which expressed the truncated form of dystrophin protein, were also positive for the LNA mRNA detection 5′TEX615 U7 probe (Figure 4b,c). Dystrophin expression was also investigated by Western blot analysis: no dystrophin expression was detected in cell-treated dogs (Figure 4d), while significant amount of dystrophin was observed at T12 in LVex6-8cell-treated dogs (Figure 4e). WB also confirmed the loss of dystrophin expression in severe LVex6-8cell-treated dogs at TS (Figure 4e). Finally, to confirm that the positive dystrophin fibers were not revertant fibers, nested RT-PCR was performed on laser-dissected dystrophin positive muscle fibers, showing the presence of canine skipped dystrophin transcript (Figure 4f,g).

Figure 2.

Figure 2

Open in a new tab

In vivo analysis of tibialisis cranialis muscle biopsies. (a) Azan Mallory (AM) images and dystrophin immunostaining of tibialis cranialis sections from each severe phenotype dog injected with LVex6-8133+musSCs at T6, T12, and TS. (b) Histograms representing the time course of dystrophin expression as a percentage of total myofibers. (c) Histograms representing myofiber mean diameters.

Figure 3.

Figure 3

Open in a new tab

In vivo analysis of vastus lateralis muscle biopsies. (a) Azan Mallory (AM) images and dystrophin immunostaining of vastus lateralis sections from each severe phenotype dog injected with LVex6-8 cell treated at T6, T12 and TS. (b) Histograms representing the time course of dystrophin expression as a percentage of total myofibers. (c) Histograms representing myofiber mean diameters.

Figure 4.

Figure 4

Open in a new tab

Efficacy characterization of 133+musSCs. (a) Fluorescent in situ hybridization (FISH) analysis of 5′TEX615 probe (red) demonstrated the presence of muscle fibers with peripheral U7 positive nuclei (arrows) on muscles isolated from LVex6-8 cell treated injected dogs. (b,c) Serial sections of dystrophin (green) positive muscle fibers expressing positive U7 nuclei (arrows; red) in LVex6-8 cell treated GRMD dogs muscles. Magnification 40X for all the images. (d) WB analysis of cell-treated GRMD dogs muscle biopsies showed no detectable dystrophin expression through the time points. (e) WB evaluation of skipped dystrophin expression on muscular biopsies from LVex6-8cell-treated GRMD mild and severe phenotype dogs: no dystrophin expression at T0; detection of skipped dystrophin in all dogs at T12; mild phenotype dog dystrophin expression at TS. Each muscular biopsy was loaded with 70 µg of proteins and a muscle from a control dog was used as positive control (each gel was loaded with serial dilution of control dog; Lane 1:70 µg, Lane 2:35 μg, Lane 3:17.5 μg, and Lane 4:8.75 μg to allow dystrophin quantification). (f) RT-PCR analysis and sequencing of exon skipping product in dystrophin-positive fibers (laser-dissected) from muscular biopsies of LVex6-8cell-treated dogs at T12 and (g) at TS. M: molecular weight marker; T01 and T02: mild phenotype dogs; NT: not treated GRMD dog; T03, T04, and T05: severe clinical phenotype dogs. PCR product sequencing confirmed ligation between the exons after the skipping: (i) no skipping (*), (ii) exon 5 and 9 in frame skipping (**), and (iii) exon 5 and 10 in frame skipping (***). GRMD, Golden Retriever muscular dystrophy; RT-PCR, reverse transcription-polymerase chain reaction; SCs, stem cells.

Clinical and functional measures following injection of cells

All LVex6-8cell-treated, cell-treated and untreated GRMD dogs were followed until death, in regard to body weight, functional tests as six-minute walking test (6MWT) and stair climbing test (SCT), and biochemical parameters (creatine kinase, transaminases, and serum cytokines). To simplify the analysis of such amount of clinical and functional data, we divided the results on the basis of dog phenotype.

Mild phenotype. SCT functional test showed superior results for LVex6-8cell-treated GRMD T01 and T02 dogs compared with both the untreated and cell-treated GRMD C01 and C02 dogs (P- value < 0.05) (Figure 5a). No statistically significant difference was present between the untreated dogs and GRMD C01 and C02. More in details, in the SCT test the untreated dogs from the colony were stable for 15 months, followed by a functional worsening (Δ% = 162 compared with the initial value) in 22 months. Similarly, GRMD C01 and C02 showed stability for 20 months, after that there was a slow and continuous increase of the recorded time (up to Δ% = 75 compared with the initial value), which had continued for the next 22 months (Figure 5a). GRMD T01 and T02 displayed a mean average time of 5.07 ± 0.39 seconds for 31 months. Starting from the month 32, a slow increase of SCT was recorded reaching in 42 months a percentage change of Δ% = 150 compared with the initial value (Figure 5a). Interestingly, LVex6-8cell-treated GRMD T01 and T02 dogs exhibited significantly superior performance in 6MWT functional test compared with GRMD C02 and to the untreated dogs as well (P-value < 0.05) (Figure 5a). Precisely, untreated dogs showed a drop of the 6MWT outcomes, losing about Δ% = −30 in 38 months; GRMD C01 and C02 were stable up to 31 weeks, afterwards GRMD C02 displayed a decrease of the performance in 5 months (Δ% = −21 compared with the initial value) (Figure 5a). GRMD T01 showed an increase up to 61 months (Δ% = 32), followed by a slow decrease (Δ% = −10) in 70 months, while GRMD T02 showed qualitatively better performance until the 34th month (Δ% = 12), followed by a stability period for 5 months and then a performance decrease (Δ% = −30) for the next 30 months (Figure 5a).

Figure 5.

Figure 5

Open in a new tab

Evolution of SCT and 6MWT test before and after the treatment. Graphs representing longitudinal evolution of SCT and 6MWT functional test for mild (a) and severe dogs (b): cell-treated GRMD (green curves) and LVex6-8cell-treated GRMD (red curves) compared with mean value (dark curve) ± SD (dot curves) of untreated colony GRMD dogs. A dark arrow indicates cell injection time. Of note, early on there was an important improvement of SCT and 6MWT in severe LVex6-8cell-treated dogs, unexpectedly followed by a rapid decrease in the curves after the third infusion. GRMD, Golden Retriever muscular; 6WMT, six-minute walking test; SCT, stair climbing test.

Severe phenotype. Severe dogs showed a marked variability in terms of absolute values recorded during the performance. Untreated dogs exhibited a rapid increase of SCT losing the ability to climb in <20 months (Figure 5b). After a stability phase prolonged for 21 months, LVex6-8cell-treated severe GRMD dogs displayed a sudden drop losing the climbing capacity from the 22nd month. Interestingly, they showed quite good performance within the first 24 months, characterized by a decrease of the SCT for all the dogs (Δ% = −42 for T03, Δ% = −37for T04, and Δ% = −32 for T05). In the next 3 months they presented functional data stability, after that all these dogs lost the ability to climb the stairs (around the 29th month) (Figure 5b).

Likewise, LVex6-8cell-treated dogs showed better results in terms of walking meters, compared with both untreated ones and GRMD C03. GRMD C03 showed an initial phase of stability similar to the LVex6-8cell-treated severe GRMD dog followed by marked decrease of the performance (Δ% = −90) at 24 months, afterwards SCT recorded values maintained stability until death (Figure 5b). However, GRMD T03, T04, and T05 showed an increase in the first phase (18 months) of the analysis (T03 Δ% = 68, T04 Δ% = 11, and T05 Δ% = 15) (Figure 5b). GRMD T05 maintained stability for at least 9 months, whereas GRMD T03 and T04 showed a further increase of the minutes walking: T03 Δ% = 71, and T04 Δ% = 47 compared with the previous phase. However the improved performances for all these animals dramatically dropped in 3 months after the third infusion, when they lost their walking ability (Figure 5b).

Analysis of muscle-released serum enzymes

Throughout treatment, serum collected from treated dogs was used to detect the levels of creatine kinase and other enzymes released by damaged muscle fibers; in general, the injections of LVex6-8133+musSCs caused a decrease in enzyme activity, especially in mild GRMD dogs, probably due to improved survival of fibers reconstituted with transplanted cells (see Supplementary Figure S3a). After treatment we also observed peaks of enzymatic activity that probably reflected increased motor activity, as it was also observed in functional tests. At the end of the follow-up, median values were reduced in mild LVex6-8cell-treated GRMD dogs compared with T0 values, whereas this condition was not observed in severe LVex6-8cell-treated GRMD dogs that suddenly died. In cell-treated GRMD dogs, we described a reduction of serum CpK levels immediately after the infusions, partially due to fiber reconstitution and to trophic factors secreted by cells themselves. However, during the follow-up the new dystrophin-negative reconstituted fibers may die causing the exhaustion of this positive effect with no further reduction of CpK levels (see Supplementary Figure S3a). Similar trend was also observed for transaminases (ALT and AST) (see Supplementary Figure S3b,c). Fiber number and diameter increase corresponded to a progressive body weight increase in mild LVex6-8cell-treated GRMD dogs, whereas little variability was observed in severe LVex6-8cell-treated and in severe cell-treated GRMD dogs (see Supplementary Figure S3d).

Survival of LVex6-8cell-treated, cell-treated, and untreated GRMD dogs

Survival curve analysis showed a comparable trend between untreated and cell-treated dogs (35 months of median survival time for mild phenotype and 19.8 months for severe phenotype). Remarkably, mild phenotype LVex6-8cell-treated dogs showed an overall trend toward an increased survival time compared with untreated dogs and to the cell-treated dogs (median survival time for mild phenotype LVex6-8cell-treated dogs: 71 months versus severe phenotype LVex6-8cell-treated dogs: 30 months; P = 0.07) (Figure 6a). Severe LVex6-8cell-treated dog survival time was twofold increase compared with the severe untreated dogs (median survival time 18 and 30 months, respectively; P = 0.003) (Figure 6a). However, variability dependent on the phenotype within LVex6-8cell-treated dogs significantly affected the results. GRMD dogs of the colony commonly present generalized weakness, bradycardia, anorexia, episodic coughing, poor growth, skeletal muscle atrophy, and pelvic limb weakness. Less than half of colony affected GRMD dogs presented aspiration pneumonia which is a common clinical complication of GRMD dogs. Most dogs invariably died from degenerative cardiomyopathy. Histopathologic examination of the GRMD C01, C02, and C03 showed signs of degenerative cardiomyopathy and for GRMD C03 concomitant pneumonia. GRMD T01 and T02 presented pulmonary fibrosis as a prominent finding (data not shown). No signs of pneumonia were found in GRMD T03, T04, and T05. These severe LVex6-8cell-treated dogs had been showing progressive clinical deterioration for 3 months after the third infusion and died suddenly. Heart autoptic biopsies of severe dogs with sudden death showed sign of blood extravasation as in chronic pulmonary heart disease or in shock condition (see Supplementary Figure S5a,b). Furthermore spleen (see Supplementary Figure S5c) and kidneys (see Supplementary Figure S5d) presented the same signs (red cells infiltrating cardiomyocytes or parenchymal tissue in kidneys and spleen) suggesting the onset of a shock condition. No cellular infiltrates (neutrophils, monocytes or leukocytes) were found in autoptic biopsies. The worsening in the functional test results reflected the distinctive dystrophic dog behavior according to the phenotype.

Figure 6.

Figure 6

Open in a new tab

Immune response analysis. (a) Survival rate of untreated and treated Golden Retriever muscular dystrophy (GRMD) dogs. Age-matched severe and mild untreated dogs (dark lines) were compared with LVex6-8cell-treated (red) and cell-treated (green) dogs. It is remarkable that LVex6-8cell-treated GRMD dogs shown an increased survival time compared both with mild and severe untreated colony GRMD dogs, and to cell-treated GRMD dogs. (b) Staining of tibialis cranialis from GRMD T03, T04, and T05 dogs showed cellular infiltrates (DAPI) surrounding dystrophin (green) positive muscle fibers. (c) CD3 positive cells (red) surrounding the basal lamina of dystrophin positive myofibers (green) in T03 muscular biopsies. Immunofluorescence staining magnification showed a characteristic CD3 staining of muscle infiltrating positive cells (red). (c′) Absence of CD3+ cell in T01 muscular biopsy. Histogram representing CD3+ cells count per field on different sections from all treated dogs. (d) Up-regulation of MHC I and II positive myofibers in GRMD T03 dog in comparison to basal expression in U01 untreated GRMD dog. (e) CD4 positive T memory cells resident in the inguinal lymph node of GRMD T03, T04,T05, inguinal lymph node stained with secondary antibody alone was used as negative control and absence of CD4+ reactive clusters in U01 untreated GRMD dog. (f) Peripheral blood mononuclear cells (PBMCs) from all treated dogs, were stimulated either with autologous 133+musSCs (red) or LVex6-8133+musSCs (blue) or with protein extracts from transplanted muscles (green) that expressed high amounts of dystrophin: at T12 weak immunogenicity of lymphocytes from all dogs to autologous CD133+ cells or to LVex6-8133+musSCs and to dystrophin expressing muscle, at TS GRMD T03, T04, and T05 lymphocytes showed a strong reaction against dystrophin positive muscle and a comparable reaction with C01, C02, C03, and T01, T02 GRMD dogs against transduced or untreated cells, indicating the occurrence of an antidystrophin T cell immune response after the third infusion only in severe LVex6-8cell treated GRMD dogs.

Analysis of immune reaction against dystrophin and donor cells

Functional test results and survival curve analyses pinpointed that the third infusion represented a critical moment for determining clinical evolution and worsening of severe LVex6-8cell-treated dog conditions. To test the occurrence of an immune reaction against skipped dystrophin in the transplanted dogs, we performed immunofluorescence staining of cellular infiltrates on autoptic muscle biopsies (Figure 6b). Dystrophin immunofluorescence staining showed the development of an important cell infiltrate surrounding dystrophin positive myofibers (Figure 6b). Infiltrating cells were characterized as CD3 positive cells: few cells were identified in mild LVex6-8cell-treated dogs, while CD3+ cell count demonstrated higher cell infiltrate in severe LVex6-8cell-treated GRMD dogs (T03, T04, and T05) than in mild LVex6-8cell-treated and cell-treated GRMD dogs (Figure 6c). Anti-MHC class I and II staining showed MHC-I and II positive muscle fibers, suggesting an immune response CD4+ and CD8+ cell mediated against newly expressed dystrophin (Figure 6d). In line with these findings, immunofluorescence staining of inguinal lymph node retrieved from T03, T04, and T05 showed CD4 positive cells, likely due to a clonal proliferation of lymphocytes in the germinal lymph node zone (Figure 6e). Moreover, lymphocyte proliferation assay was optimized to test the appearance of cellular immunity against 133+musSCs and LVex6-8133+musSCs and/or against the dystrophin-positive muscle biopsies, both immediately after the third infusion and at the sacrifice. No lymphocyte activation against 133+musSCs as well against LVex6-8133+musSCs was found in all treated mild and severe GRMD dogs both at T12 and TS (Figure 6f). However, peripheral T cells from severe LVex6-8cell-treated dogs reacted against muscle homogenized enriched of skipped dystrophin after the third injection (Figure 6f). Dystrophin mediated immune reaction displayed also an increasing trend throughout the time, up to the sacrifice, as confirmed by the lymphocyte proliferation assay. To confirm the specificity of antidystrophin immune rejection, we performed an enzyme-linked immunosorbent spot (ELISPOT) IFN-γ assay demonstrating the presence of antidystrophin T-cells in two out of three severe LVex6-8cell-treated GRMD dogs, (T04: P = 0.0491 and T05: P = 0.02). Only T03 showed a not significant tendency (Figure 7a). Furthermore, ELISA serum analysis of the IFN-γ levels showed an increased expression after the first two injections and a dramatic increase after the third injection only in severe LVex6-8cell-treated GRMD dogs, reflecting the activation of T-cells in the periphery, while it was unvaried in the other GRMD dogs (Figure 7b). In addition, we did not observe a clear trend of the other cytokines analyzed (TGF-β, IL-1β, and IL-10). In particular, TGF-β and IL-10 peaked at the time of infusions, probably as result of their secretion from injected cells, returning after the treatment at basal levels, independently from the types of cells injected. IL-1β showed high variability within the different phenotypes of GRMD dogs treated, without any correlations with infusions. However, IL-1β increased in proximity of death in severe LVex6-8cell-treated GRMD dogs reflecting an inflammatory state (see Supplementary Figure S4). We also conducted a WB analysis to test reactivity of dog sera from T0, T12, and TS against dystrophin-positive healthy muscle. Presence of serum antibodies against dystrophin was found only in severe LVex6-8cell-treated dogs starting from T12 and increasing through the treatment till TS, while mild LVex6-8cell-treated and cell-treated GRMD dogs did not show dystrophin antibodies even at TS (Figure 7c).

Figure 7.

Figure 7

Open in a new tab

Immune response characterization. IFNγ-ELISpot analysis of PBMCs at TS of severe LVex6-8cell treated GRMD dogs showing a significant positive reaction to a pool of dystrophin peptides (cells + DYS) while no positive reaction was observed in mild LVex6-8cell treated GRMD dogs T01 and T02. Representatives image of significant wells were shown. (b) ELISA of serum IFNγ levels during the treatment and the follow up, infusions were shown by arrows. Severe LVex6-8cell treated GRMD dogs showed a progressive increase in IFNγ levels till death. (c) WB analysis of specific serum IgG antibody against dystrophin. The different lanes contain muscle homogenate from healthy dog expressing full-length dystrophin (1, 3, 5, 7, and 9), from healthy mice (2, 4, 6, and 8) The blots were stained using the NCL-DYS 1 and NCL-DYS 2 that recognizes the carboxyl terminus and the Rod domain of canine and murine dystrophin, serum from severe dog or serum from mild dog at different time point (T0, T12, and TS). The band of ~427 kDa that corresponds to dystrophin appears in the monoclonal antibody-positive control (lane 1 and 2) and in the immunoreactive serum of severe LVex6-8 cell treated GRMD dogs. ELISPOT, enzyme-linked immunosorbent spot; GRMD, Golden Retriever muscular dystrophy; PBMCs, peripheral blood mononuclear cells.

Discussion

Intra-arterial injections of engineered dystrophic muscle CD133+ SCs into murine models of DMD can significantly restore dystrophin expression and skeletal muscle function toward normal.11 In this study, we demonstrated the translational potential of engineered CD133+ cells derived from dystrophic dog muscle of restoring dystrophin expression in the preclinical GRMD model. The GRMD dog is the closest animal model for DMD. GRMD dogs develop progressive and fatal disease similar to human condition in many aspects. Therefore, studies in GRMD dogs are more likely than those in murine models to predict pathogenesis and treatment outcome in DMD boys. As autologous cell therapy for DMD requires genetic modification, preclinical studies with heterologous stem cells in larger animal models are of extreme importance. Recently, a landmark paper in the field16 produced evidences of clinical and pathophysiological restoration in GRMD dogs after stem cell transplantation. Despite the enthusiasm generated by this work for the general topic of muscular dystrophies, many researchers remain skeptical for the use of SCs in DMD: it is becoming unclear whether this approach provides any significant benefit. Given the unmet clinical need for DMD patient therapy, stem cell treatment was translated for use in patients and the first randomized clinical trial was recently completed.20 However, stem cell clinical trials in DMD are facing several limitations such as the costs for GMP stem cell production, their source (heterologous or autologous), the dosage needed to reach a clinical benefit, the variability in disease progression and severity of DMD patients, and last but not less important the number of trial admissible patients. The results described above demonstrate the feasibility of engineered muscle-derived CD133+ SCs autologous transplantation in dystrophic well-characterized older dogs. This approach allowed to obtain (i) an extensive reconstitution of muscle fibers expressing dystrophin, (ii) improvement in the motor function, and (iii) preservation of walking ability and increased survival time. It is important to point out that although we found a damped and barely detectable dystrophin signal throughout the first year of treatment, this data was apparently in contrast with the clinical amelioration observed from the functional tests. Actually, one of the major challenges for a successful transition of gene and cell therapy to the clinic is to define the relationship between genetic manipulation levels, number of cells to be transplanted, and clinically relevant functional improvements. It is not yet known what levels of dystrophin restoration are needed within an established dystrophic environment to successfully modify disease progression.21,22,23,24,25 Moreover, low dystrophin levels in transgenic mice models and patient cohorts have been demonstrated to bring pathological and functional benefits, at least slowing down or preventing disease development.25,26 In addition, the contribution from soluble paracrine molecules secreted from the injected cells rather than from the presence on dystrophin has to be mentioned. It is likely that in the first year of treatment the amelioration seen in the GRMD dogs injected with autologous LVex6-8133+musSCs was due to two uneven components: (i) a burst release of stimulating and restoring muscle factors from injected cells and the recipient tissue, and (ii) an initial low dystrophin expression. On the contrary, the GRMD dogs injected with autologous not engineered dystrophic 133+mus-SCs may only consider the cell paracrine effect contribution by means the trophic factors released by transplanted cells. This paracrine contribution would explain the stability in the progression disease observed in the first year, together with the initial reduction of CpK activity and increase in body weight. More importantly, the high expression of dystrophin observed into GRMD dogs treated with autologous LVex6-8133+musSCs, 1 year later the first infusion, suggest a slow but constant rate of muscle contribution from injected cells. We hypothesized that injected cells first proliferate as myogenic progenitors and second slowly contribute to dystrophin expression during the first year of transplantation. The slow rate of dystrophin expression and the high percentage of dystrophin obtained after treatment with engineered SCs may also indicate an in vivo slow metabolic behavior of these cells probably influenced by the muscle environment (such as fibrosis and inflammation) of older GRMD dogs. The dominant effect of autologous engineered stem cell transplantation consists in a significant improvement of the functional SCT and 6MWT tests on GRMD disease course. These tests are commonly used in the clinical follow-up of DMD patients to monitor the progression of the muscle disease.27,28 To validate these functional tests in GRMD dogs, we performed SCT and 6MWT tests in mild and severe affected dogs of the colony from age 10 months till death. The inclusion of older GRMD dogs, allows classification of the animals in mild and severe phenotype, limiting the heterogeneity of the functional evaluation among dogs. The functional scores obtained showed a remarkable global improvement of the disease progression with improved locomotion for GRMD dogs receiving engineered SCs. More importantly, the systemic effects seem affect positively two of the main requirements for the translation feasibility of this approach: the improvement of the natural course of the GRMD disease and the increase of the lifespan of treated animals. The third infusion surprisingly marked a total inversion not only in the clinical function amelioration trend, but also and even more severely in the muscular histopathology. The third infusion burst an immune reaction against newly formed dystrophin expressing fibers. This reactivity determined a rapid loss of dystrophin expression and a fatal clinical regression, causing dead within 3 months in three out of five LVex6-8cell-treated dogs. These results might be consistent with previous results reporting T-cell mediated immune reaction against dystrophin in DMD patients before and after gene therapy.29 In particular, it was supposed that revertant fibers are expressed in low level to induce T-cell tolerance30; conversely they are able to prime memory T cells and trigger immune rejection once dystrophin reaches a threshold level of expression.29 Also it has been reported that the presence of spontaneous auto-reactive T cells is variable and age-dependent in DMD subjects, suggesting that further factors contribute to the development of an autoimmune response, regardless the specific dystrophin mutation.31 Thus, it is likely that beyond the number of revertant or corrected dystrophin expressing fibers, there is an own dog/patient tendency toward the development of self reactive immune response determined by different players: (i) the timing of revertant fiber appearance, (ii) the maturation of immune system, and (iii) the severity of muscle inflammation triggering the expression of major histocompatibility complex (MHC) I, II, and costimulatory molecules. This way in an inflammatory predisposed environment like in the severe GRMD dogs, the high dystrophin expression after the third infusion would determine MHC-I and II expression, inflammatory cell recruitment, and consequently a T-cell response. Mild GRMD dog environment could be relatively more permissive to dystrophin re-expression, although an age-dependent reaction cannot be excluded. We also observed the presence of antidystrophin antibodies in severe phenotype GRMD dog sera. Though this was the first evidence of a humoral immunity in GRMD dogs, several data suggested B-cell involvement in muscular dystrophy. Firstly, dystrophic muscles typically showed both CD8+ and CD4+ T-lymphocyte and immunoglobulin infiltrate within necrotic fibers.32 Secondly, it has been recently published that Ig treatment could ameliorate dystrophic features in mdx mice,33 and Rituximab (anti-CD20) treatment ameliorate clinical features of dysferlinopathic patients.34 Although we could not verify whether antidystrophin antibodies were pathogenic or not, Th2-activated-B cells and secreted Ig could increase muscular inflammation and promote further MHC expression, culminating in an exacerbated immune reaction. We observed a progressive enhancement of inflammation in dogs that suddenly died after third infusion, as demonstrated by MHC up-regulation and CD3+ cell muscular infiltrates culminating in the production of antidystrophin T cells able to selectively kill reconstituted dystrophin positive fibers. Memory T cells activation (as a result of enhanced antigen expression) could represent either the primum movens for inflammation progression or the consequence of the stronger inflammatory milieu present in severely affected dogs versus mild ones. In fact, up-regulation of costimulatory molecules and high levels of inflammatory cytokines (also promoted by the increased motor activity gained with cell transplantation) could determine the rupture of peripheral tolerance through alteration of balance of muscular T-reg/T-effectors. These data revealed for the first time the development of adaptive immune response against self-dystrophin, even in the context of autologous transplantation. No sign of immune reaction against lentiviral vector was observed confirming the specificity of an autoimmune reaction. Autoptic biopsies of severe dogs with sudden death showed sign of blood extravasation as in chronic pulmonary heart disease or in shock condition. Severe sepsis with multiple organ failure was described as cause of morbidity and mortality after autologous or allogeneic hematopoietic stem cell transplantation named engraftment syndrome (ES).35,36,37,38,39 In ES extreme form, in which profound hemodynamic collapse and multiorgan system failure may develop, the term aseptic shock syndrome has been applied. Manifestations of diffusely increased capillary permeability, presence of antibodies against dystrophin and T cell activation in severe LVex6-8cell-treated GRMD dogs signify a possible immunological component in the autologous stem cell transplantation setting. Since severe GRMD dogs treated with unmodified autologous 133+musSCs did not show any evidence of shock and capillary permeability, we believe that this process may be initiated, or at least aggravated by the expression of dystrophin protein. The pathophysiologic mechanism of ES is multifactorial and may involve prominent cellular interactions of T cells, monocytes, and other effector cells also complement activation and proinflammatory cytokine production and release. Epithelial and endothelial injury from ES with release of proinflammatory cytokines such as interleukin-1 β (IL-1β) and Interferon γ (INF-γ), the effects of early cytokine production on subsequent cellular, and cytokine interactions have been well described.40,41,42,43,44,45 We found a significant increase of IL-1β and INF-γ in severe GRMD dogs receiving LVex6-8133+musSCs confirming the possibility of an ES after the third infusion. Furthermore ELISpot assay demonstrated T-cell reactivity against specific dystrophin peptides. We selected dystrophin peptides covering the first exons of dystrophin (1–6) till the region following canine dystrophin mutation (8–12) considering Mendell's observations that in DMD patients the majority of reactive lymphocytes were directed against region upstream the mutation or newly antigens produced by exon-skipping phenomenon. These data pointed out the need to assess the potential risk toward autoimmune reaction for each treated subject, for consequently calibrating transient or permanent immunosuppression. In this work, we did not observe a humoral response before treatment and we could not determine the presence of a pre-existing T-cells response. However, humoral response may depend on different factors such as the sensitivity and specificity of the method used for antidystrophin detection, the amount of expressed dystrophin and differences in chronic inflammation and immune-system activation. In our opinion, it will be of primary importance to investigate the presence of antidystrophin antibodies and of antidys memory T cells prior to gene/cell therapy and to monitor their appearance during the follow up. Furthermore, emerging importance has been paid to immune system role in skeletal muscle regeneration46 suggesting that new immunosuppressive regime has to be studied to selectively inhibit dangerous component without affecting positive ones such as regulation of muscular T-regs. Moreover, intramuscular transplantation of autologous engineered SCs would be required before systemic infusions to confirm the biological capacity of these cells to rescue the dystrophin expression. Thus, the work reported here lays the critical pillars for future clinical trials based on autologous transplantation of engineered SCs in DMD.

Materials and Methods

GRMD dogs. Animals were housed and cared in USP animal facility (University of Sao Paulo) in a controlled environment (temperature 21 ± 1 °C, 12-hours light/dark cycle) and genotyped at birth as previously described.47 Animal care and experiments were performed in accordance with the Guide of the care and the use of laboratory animals, and approved by the ethical committee of the Biosciences Institute, University of Sao Paulo. All GRMD dogs were 10 months old at the beginning of the study: we chose 10 months old dogs to reduce phenotypic variability, feature of canine model of muscular dystrophy.19 Three healthy dogs were used to analyze and compare the architecture of muscle fibers. GRMD dogs were phenotypically classified as mild and severe according to muscular and skeletal symmetry, histology and respiratory or cardiac problems (modified from ref. 19). Mild phenotype was distinguished for: mild histological alteration, mild fiber hypotrophy, muscular symmetry such as carpal overflexion, carpal varum stifle hypomobility, tarsal overflexion, and genu valgorum. Severe phenotype was defined for: severe histological alteration and general hypotrophy, and marked muscular asymmetry such as severe carpal overflexion, carpal varum, stifle hypomobility, tarsal overflexion and genu valgorum, megaesophagus tongue hypertrophy causing regurgitation. Prior to data collection, all dogs had a complete clinical, orthopedic and neurologic assessment to ensure that there were no underlying conditions that would influence gait. In addition, pain evaluation was performed every day during a complete clinical evaluation by a veterinarian and an analgesia treatment was set up if necessary. Muscle biopsies were taken at T6, T12, and TS; all surgeries were performed under sodium pentobarbital (Dolethal, Vetoquinol SA, Magny Vernois) anesthesia, and all efforts were made to minimize suffering. Dogs were killed by intravenous administration of sodium pentobarbital (2,000 mg) when progressive clinical deterioration rapidly declined, loss of walking ability occurred, and clear decline of test outcomes appeared, accordingly to the report of the American Veterinary Medical Association Panel on Euthanasia, J Am Vet Med Assoc 2013 (pain, weight loss, respiratory, and cardiovascular sign of dysfunction like severe dyspnea and blood loss).

Isolation and characterization of GRMD 133+musSCs. Muscle-derived SCs were isolated by enzymatical and mechanical dissociation of muscular biopsies from GRMD tibialis cranialis, as previously described11: their characterization was performed through a flow cytometer FACS Cytomic FC 500 (Beckman Coulter, BC, Brea, CA), to evaluate cell scattering (Forward and Side scattering), CD133 and CD34 antigen expression (CD133-APC antibody, Miltenyi Biotech, Bergisch Gladbach; anti-CD34-PE, BD Biosciences, Pharmingen, San Josè, CA). CD133+musSCs were isolated from homogenized muscles by immunomagnetic sorting (Miltenyi Biotech).8 Immediately after the isolation, CD133+musSCs were counted with a Burker's chamber using Trypan Blue (Sigma-Aldrich, St. Louis, MO) exclusion method. Aliquots of CD133+musSC fraction (n = 10) were analyzed through a flow cytometry assay to evaluate the purity using CD133-APC antibody. Isolated CD133+musSCs were cultured in proliferating medium for 1 week in order to obtain the correct cell number for the in vivo experiments. 1.5 × 105 CD133+musSCs were incubated with FACS antibodies for five colors-flow cytometry characterizations: anti-CD133-APC, anti-CD34-PE, anti-CD45-FITC (BD Biosciences, Pharmingen), CXCR4-PE-Cy7 (CXC chemokine) (BD Biosciences, Pharmingen). 7AAD antibody was used for assessing cell viability and excluding dead cell fraction. Briefly, cell aliquots were incubated with the antibodies for 20 minutes at +4°C, and subsequently the reaction was blocked by 1% Fetal Calf Serum (FCS) and phosphate buffered saline (PBS) with 0.1% sodium azide. Data were analyzed by the CXP2.1 software (BC Beckman Coulter). For all the experiments, we selected CD133+ cell preparations with a purity >95%. Isolated CD133+ cells were plated in proliferation medium11 at a density of 1.5 × 104 cells/cm2. Cell proliferation was assessed by direct cell count with Trypan Blue dye exclusion. Cell viability was evaluated by 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) MTT colorimetric assay (Roche, Basel, CH). For the MTT assay, cells were harvested at selected time points (day 7, 14, 21, 28, and 35) according to manufacturer protocol, and expressed as % of viable cells on the total cell number. Differentiated 133+musSCs were detected by immunostaining with antibodies against slow MyHCs (slow Myosin Heavy Chains, Novocastra Laboratories, UK) and desmin (Abcam, Cambridge, UK).

In vitro lentiviral vector infection of dystrophic 133musSCs. 2–4 × 104 133+musSCs were harvested after 48 hours from isolation and transduced with a lentiviral vector carrying the exon-6–8 skipping cassette (LV-snRNAex6-8). The lentiviral vector LV-snRNAex6–8 was provided by Genethon Institute (France). 133+musSCs were transduced using 107–108 ip/ml of LV-snRNAex6-8 (LVex6-8133+musSC) and plated onto 96-well tissue culture dishes; 100 µl of Dulbecco's modified essential medium (DMEM, Invitrogen, Life Technologies, Carlsbad, CA), supplemented with 10% Fetal Bovine Serum (FBS) were added. See Supplementary Materials and Methods section.

Analysis of efficiency of exon-skipping by nested RT-PCR. To verify the skipping of dystrophin exon 6–8, the transduced LVex6-8133+musSCs and rescued GRMD muscle-derived dystrophin positive muscle fibers were isolated by laser dissection and collected. Total RNA was extracted using the Trizol reagent (Life Technologies, Thermo Fisher Scientific), and nested RT-PCR was performed. See Supplementary Materials and Methods section.

In vivo injection of 133+musSCs and LVex6-8133+musSC. 5 × 106cells/kg were reconstituted with 100 ml of normal saline supplemented with a small aliquot of heparin (50 U/ml). Serial infusions were performed intra-arterially by catheterism under fluoroscopic guidance16 into both right and left subclavian and femoral arteries of treated GRMD dogs. See Supplementary Materials and Methods section.

Biochemical and histological analysis. Immunoblotting, immunofluorescence, and histological staining were performed as previously described.11 Muscular biopsies of tibialis cranialis and vastus lateralis from all the GRMD dogs (LVex6-8cell-treated, cell-treated, and untreated) were taken immediately after the first injection (data not shown), and at T6, T12, and TS. Muscle biopsies were frozen in cooled isopentane for 30 seconds, followed by 1 minute liquid nitrogen immersion. All the biopsies were cut with a cryostate Leica CM1850 (Leica Microsystems, Wetzlar, Germany) in 12 μm thickness serial sections. Biopsies were stained by AM as described in previous works.48 See Supplementary Materials and Methods section.

Fluorescent in situ hybridization and immunofluorescence analyses of transplanted muscles. Fluorescent in situ hybridization analysis was performed on slide mounted cells and frozen muscle sections. The slides were first treated for 30 minutes with Histochoice Tissue Fixative (Sigma-Aldrich, Saint-Louis, MO), and sections were dehydrated in 70, 80, and 95% alcohol. The denaturation was performed with 70% deionized formamide in 2 × SSC, and the slides were dehydrated again at −20°C. The hybridization step was performed overnight at 37°C. In vitro and in vivo detection of LVex6-8133+musSCs was performed using LNA mRNA detection probe 5′TEX615 U7 (Sequence: 5TEX615/AACCGAATAAGGAACTGTGCT) produced by Exiqon (Exiqon Woburn, MA). Double immunofluorescence staining analysis for the expression of dystrophin (green) and LV-U7ex6-8 (Texas Red) was performed in LVex6-8133+musSC injected GRMD dogs. Nontransplanted canine muscle sections were used as controls. Slides were observed using confocal microscope. Dystrophin-positive myofibers were detected with monoclonal antidystrophin antibodies (NCL dys 1, and NCL-dys 2; Novocastra) at a final dilution of 1:20, as previously described.48

Laser dissection experiments. Dystrophin and Texas Red double positive myofibers were isolated using the laser dissection system Leica LMD6500 (Leica Microsystems), in order to exclude the contribution of revertant myofibers in dystrophin-positive clusters. A 40X objective was used with the following settings: aperture, 9; intensity, 30; speed, 5; and offset, 22. The cut area was transferred by gravity into a 0.2 ml tube cap, placed directly underneath the slide. The tube cap was filled with Trizol Reagent (Life Technologies, Thermo Scientific) to guarantee the isolation of intact RNA. Total RNA was extracted, according to the manufacturer's protocol.

Functional tests. No steroid treatment was administered 6 months before and during the study. The transplanted animals were examined at different times after the injection for the general health conditions (i.e., cardiac and respiratory frequency, temperature, weight, and blood tests) and the endurance compared with the untreated ones. The serum creatine kinase CK (U/l), Transaminase (AST and ALP), were determined for all dogs before and at various time points after transplantation. GRMD dogs were followed for clinical signs such as gait disturbance, mobility disturbance, limb or temporal muscle atrophy, drooling, macroglossia, and dysphagia. Dogs were tested with 6MWT and SCT, in accordance with tests performed in clinical trials in DMD patients. For 6MWT, each dog was encouraged to run down a hallway (15 meters) for 6 minutes and performed distance (meters) was recorded. SCT was performed encouraging dogs to climb the stairs and time was recorded. 6MWT and SCT have been validated in the untreated GRMD colony. The study was designed to comprise one test session monthly, from the age of 10 months till death. Tests were performed encouraging the dog to walk or run or climb the stairs at his preferred speed.

Lymphocyte proliferation assay. Peripheral blood mononuclear cells were isolated from all treated dogs by Ficoll gradient (Sigma-Aldrich) and collected for lymphocyte proliferation assay. The aim was measuring lymphocyte proliferation in response to antigenic peptides. In each well, peripheral blood mononuclear cells from each dog were cocultured with autologous 133+musSCs (in this case referred as CD133+ stem cells) or with LVex6-8133+musSCs (in this case referred as LV-treated CD133+ stem cells) or GRMD muscle extracts (referred as Dys+ muscle) at T12 and TS. Lymphocytes proliferation was assessed through MTT assay. The readout is expressed as count per minute for each well.

ELISpot. Frozen peripheral blood mononuclear cells from LVex6-8cell-treated and cell-treated GRMD dogs were collected at TS for ELISpot experiments as previously described.49 Briefly, cells have been thawed, resuspended and let rest for 1 hour in the CO2 incubator for settling any cell debris and reducing the analysis background. Cells were plated in ELISpot plate following manufacturer's instructions for Canine Interferon-γ ELISpotPlus (Mabtech, Nacka Strand, Sweden). We plated 25 × 104 cells/well together with peptide pool (n = 3 wells for pool were plated). After 48 hours of incubation, cells were removed and spots were detected. Positive reaction was considered when the number of spots/well was two-fold higher than SD of control negative well mean (5 wells with 25 × 104 cells/well without stimulus). Student's t-test was performed to address statistical significance between wells with stimulated cells and well without stimulus. Positive control of reaction was obtained by adding Concanavalin A (Sigma) as a polyclonal stimulus (4 γ/ml). Dystrophin peptides were chosen as follows: 15 aminoacids of length overlapping 10aa covering from exon 1 to exon 6 of canine dystrophin and from exon 8 to 12, to cover the mutation region of canine dystrophin (NCBI Reference Sequence: NM_001003343.1). Furthermore, we chose peptides identical between dogs and humans to recapitulate Mendell work.50

WB on serum samples. The blood samples were collected, incubated for a few hours at 4°C for retracting the blood clot, and spun twice at 9,000g for 5 minutes. Serum aliquots were stored at −80°C until used. TC muscles from healthy dog and mouse (average weight 30–40 mg) were homogenized in a final volume of 400 ml of sodium dodecyl sulfate sample buffer (10% sodium dodecyl sulfate). After sodium dodecyl sulfate-polyacrylamide gel electrophoresis, proteins were transferred onto polyvinylidene difluoride (PVDF: HybondP; Amersham, Little Chalfont, UK). Blots were air dried over night. After WB transfer, the equality of transferred protein per lane was assessed by blotting with antitubulin III antibody. NCL-DYS1 and NCL-DYS2 against the carboxy terminal and ROD domain of dystrophin was used as the positive control at a dilution of 1:50. Sera from dogs LV- treated, cell-treated and untreated were used at a dilution of 1:10. Secondary antibodies, goat-antiCanine IgG (LifeTechnologies) and rabbit antimouse IgG (Agilent Technologies, Santa Clara, CA) were used at dilution of 1:2,000. Antibodies were detected using enhanced chemiluminescence as directed by the manufacturer (ECL; Amersham).

Statistical analysis. Prism 5.0 (Graphpad) was used for analysis. Statistical comparisons were based on Student's t-test or analysis of variance (ANOVA) with Tukey post-hoc test for pairwise comparisons. A confidence level of 95% was considered significant. Survival curves and log-rank test were used to compare experimental groups. The statistical significance differences between more than two groups for all the assay were analyzed by post-hoc Dunn's multiple comparison test after analysis of variance. P-values < 0.05 were considered significant. Percentage variation Δ% was calculated as: ((Xf-Xi)/Xi) × 100, where Xf is the value at the end of selected functional measure period and Xi is the value at the beginning of the same functional measure period.

SUPPLEMENTARY MATERIAL Figure S1. Intra-arterial injection of muscle derived CD133+ stem cells. Figure S2. Additional characterization of mild and severe GRMD dogs. Figure S3. Clinical parameter of GRMD dogs during follow-up. Figure S4. ELISA of serum cytokines expression. Figure S5. Autopsy biopsies characterization. Supplementary Materials and Methods.

Acknowledgments

This work was supported by Associazione Amici Centro Dino Ferrari, Associazione La Nostra Famiglia Fondo DMD Gli Amici di Emanuele, Fondazione Opsis ONLUS, Fondazione TELETHON (GGP09292), Fondazione Cariplo (2008.2007) and the Italian Ministry of Health (RF-2009-1547384). The authors declare no competing financial interests. We thank Michele De Luca for helpful discussions and Carole Drougard for technical assistance. Daniel Raffa is also thanked for his care of the GRMD dogs. This work was performed in Milan (Italy).

Supplementary Material

Supplementary Figures
Click here for additional data file. (9.6MB, zip)

References

  1. Hoffman, EP, Brown, RH Jr and Kunkel, LM (1987). Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell 51: 919–928. [DOI] [PubMed] [Google Scholar]
  2. Watkins, SC and Cullen, MJ (1988). A quantitative study of myonuclear and satellite cell nuclear size in Duchenne's muscular dystrophy, polymyositis and normal human skeletal muscle. Anat Rec 222: 6–11. [DOI] [PubMed] [Google Scholar]
  3. Emery, AE (2002). Muscular dystrophy into the new millennium. Neuromuscul Disord 12: 343–349. [DOI] [PubMed] [Google Scholar]
  4. Péault, B, Rudnicki, M, Torrente, Y, Cossu, G, Tremblay, JP, Partridge, T et al. (2007). Stem and progenitor cells in skeletal muscle development, maintenance, and therapy. Mol Ther 15: 867–877. [DOI] [PubMed] [Google Scholar]
  5. Cossu, G and Sampaolesi, M (2004). New therapies for muscular dystrophy: cautious optimism. Trends Mol Med 10: 516–520. [DOI] [PubMed] [Google Scholar]
  6. Qu-Petersen, Z, Deasy, B, Jankowski, R, Ikezawa, M, Cummins, J, Pruchnic, R et al. (2002). Identification of a novel population of muscle stem cells in mice: potential for muscle regeneration. J Cell Biol 157: 851–864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bachrach, E, Perez, AL, Choi, YH, Illigens, BM, Jun, SJ, del Nido, P et al. (2006). Muscle engraftment of myogenic progenitor cells following intraarterial transplantation. Muscle Nerve 34: 44–52. [DOI] [PubMed] [Google Scholar]
  8. Torrente, Y, Belicchi, M, Sampaolesi, M, Pisati, F, Meregalli, M, D'Antona, G et al. (2004). Human circulating AC133(+) stem cells restore dystrophin expression and ameliorate function in dystrophic skeletal muscle. J Clin Invest 114: 182–195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Rodriguez, AM, Pisani, D, Dechesne, CA, Turc-Carel, C, Kurzenne, JY, Wdziekonski, B et al. (2005). Transplantation of a multipotent cell population from human adipose tissue induces dystrophin expression in the immunocompetent mdx mouse. J Exp Med 201: 1397–1405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dezawa, M, Ishikawa, H, Itokazu, Y, Yoshihara, T, Hoshino, M, Takeda, S et al. (2005). Bone marrow stromal cells generate muscle cells and repair muscle degeneration. Science 309: 314–317. [DOI] [PubMed] [Google Scholar]
  11. Benchaouir, R, Meregalli, M, Farini, A, D'Antona, G, Belicchi, M, Goyenvalle, A et al. (2007). Restoration of human dystrophin following transplantation of exon-skipping-engineered DMD patient stem cells into dystrophic mice. Cell Stem Cell 1: 646–657. [DOI] [PubMed] [Google Scholar]
  12. Torrente, Y, Belicchi, M, Marchesi, C, D'Antona, G, Cogiamanian, F, Pisati, F et al. (2007). Autologous transplantation of muscle-derived CD133+ stem cells in Duchenne muscle patients. Cell Transplant 16: 563–577. [DOI] [PubMed] [Google Scholar]
  13. Valentine, BA, Cooper, BJ, de Lahunta, A, O'Quinn, R and Blue, JT (1988). Canine X-linked muscular dystrophy. An animal model of Duchenne muscular dystrophy: clinical studies. J Neurol Sci 88: 69–81. [DOI] [PubMed] [Google Scholar]
  14. Sharp, NJ, Kornegay, JN, Van Camp, SD, Herbstreith, MH, Secore, SL, Kettle, S et al. (1992). An error in dystrophin mRNA processing in golden retriever muscular dystrophy, an animal homologue of Duchenne muscular dystrophy. Genomics 13: 115–121. [DOI] [PubMed] [Google Scholar]
  15. Kornegay, JN, Bogan, JR, Bogan, DJ, Childers, MK, Li, J, Nghiem, P et al. (2012). Canine models of Duchenne muscular dystrophy and their use in therapeutic strategies. Mamm Genome 23: 85–108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Sampaolesi, M, Blot, S, D'Antona, G, Granger, N, Tonlorenzi, R, Innocenzi, A et al. (2006). Mesoangioblast stem cells ameliorate muscle function in dystrophic dogs. Nature 444: 574–579. [DOI] [PubMed] [Google Scholar]
  17. Wu, B, Benrashid, E, Lu, P, Cloer, C, Zillmer, A, Shaban, M et al. (2011). Targeted skipping of human dystrophin exons in transgenic mouse model systemically for antisense drug development. PLoS One 6: e19906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Yang, L, Niu, H, Gao, X, Wang, Q, Han, G, Cao, L et al. (2013). Effective exon skipping and dystrophin restoration by 2'-o-methoxyethyl antisense oligonucleotide in dystrophin-deficient mice. PLoS One 8: e61584. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ambrósio, CE, Fadel, L, Gaiad, TP, Martins, DS, Araújo, KP, Zucconi, E et al. (2009). Identification of three distinguishable phenotypes in golden retriever muscular dystrophy. Genet Mol Res 8: 389–396. [DOI] [PubMed] [Google Scholar]
  20. Cossu, G, Previtali, SC, Napolitano, S, Cicalese, MP, Tedesco, FS, Nicastro, F et al. (2015). Intra-arterial transplantation of HLA-matched donor mesoangioblasts in Duchenne muscular dystrophy. EMBO Mol Med 7: 1513–1528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Phelps, SF, Hauser, MA, Cole, NM, Rafael, JA, Hinkle, RT, Faulkner, JA et al. (1995). Expression of full-length and truncated dystrophin mini-genes in transgenic mdx mice. Hum Mol Genet 4: 1251–1258. [DOI] [PubMed] [Google Scholar]
  22. Wells, DJ, Wells, KE, Asante, EA, Turner, G, Sunada, Y, Campbell, KP et al. (1995). Expression of human full-length and minidystrophin in transgenic mdx mice: implications for gene therapy of Duchenne muscular dystrophy. Hum Mol Genet 4: 1245–1250. [DOI] [PubMed] [Google Scholar]
  23. Li, D, Yue, Y and Duan, D (2008). Preservation of muscle force in Mdx3cv mice correlates with low-level expression of a near full-length dystrophin protein. Am J Pathol 172: 1332–1341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Li, D, Yue, Y and Duan, D (2010). Marginal level dystrophin expression improves clinical outcome in a strain of dystrophin/utrophin double knockout mice. PLoS One 5: e15286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. van Putten, M, Hulsker, M, Young, C, Nadarajah, VD, Heemskerk, H, van der Weerd, L et al. (2013). Low dystrophin levels increase survival and improve muscle pathology and function in dystrophin/utrophin double-knockout mice. FASEB J 27: 2484–2495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. van Putten, M, Hulsker, M, Nadarajah, VD, van Heiningen, SH, van Huizen, E, van Iterson, M et al. (2012). The effects of low levels of dystrophin on mouse muscle function and pathology. PLoS One 7: e31937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. McDonald, CM, Henricson, EK, Abresch, RT, Florence, JM, Eagle, M, Gappmaier, E et al.; PTC124-GD-007-DMD Study Group. (2013). The 6-minute walk test and other endpoints in Duchenne muscular dystrophy: longitudinal natural history observations over 48 weeks from a multicenter study. Muscle Nerve 48: 343–356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. McDonald, CM, Henricson, EK, Abresch, RT, Florence, J, Eagle, M, Gappmaier, E et al.; PTC124-GD-007-DMD Study Group. (2013). The 6-minute walk test and other clinical endpoints in duchenne muscular dystrophy: reliability, concurrent validity, and minimal clinically important differences from a multicenter study. Muscle Nerve 48: 357–368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Mendell, JR, Campbell, K, Rodino-Klapac, L, Sahenk, Z, Shilling, C, Lewis, S et al. (2010). Dystrophin immunity in Duchenne's muscular dystrophy. N Engl J Med 363: 1429–1437. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Yamano, T, Nedjic, J, Hinterberger, M, Steinert, M, Koser, S, Pinto, S et al. (2015). Thymic B cells are licensed to present self antigens for central T cell tolerance induction. Immunity 42: 1048–1061. [DOI] [PubMed] [Google Scholar]
  31. Flanigan, KM, Campbell, K, Viollet, L, Wang, W, Gomez, AM, Walker, CM et al. (2013). Anti-dystrophin T cell responses in Duchenne muscular dystrophy: prevalence and a glucocorticoid treatment effect. Hum Gene Ther 24: 797–806. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Spencer, MJ, Montecino-Rodriguez, E, Dorshkind, K and Tidball, JG (2001). Helper (CD4(+)) and cytotoxic (CD8(+)) T cells promote the pathology of dystrophin-deficient muscle. Clin Immunol 98: 235–243. [DOI] [PubMed] [Google Scholar]
  33. Zschüntzsch, J, Zhang, Y, Klinker, F, Makosch, G, Klinge, L, Malzahn, D et al. (2016). Treatment with human immunoglobulin G improves the early disease course in a mouse model of Duchenne muscular dystrophy. J Neurochem 136: 351–362. [DOI] [PubMed] [Google Scholar]
  34. Lerario, A, Cogiamanian, F, Marchesi, C, Belicchi, M, Bresolin, N, Porretti, L et al. (2010). Effects of rituximab in two patients with dysferlin-deficient muscular dystrophy. BMC Musculoskelet Disord 11: 157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Armitage, JO (1994). Bone marrow transplantation. N Engl J Med 330: 827–838. [DOI] [PubMed] [Google Scholar]
  36. Bach, PB, Schrag, D, Nierman, DM, Horak, D, White, P Jr, Young, JW et al. (2001). Identification of poor prognostic features among patients requiring mechanical ventilation after hematopoietic stem cell transplantation. Blood 98: 3234–3240. [DOI] [PubMed] [Google Scholar]
  37. Horak, DA and Forman, SJ (2001). Critical care of the hematopoietic stem cell patient. Crit Care Clin 17: 671–695. [DOI] [PubMed] [Google Scholar]
  38. Huaringa, AJ, Leyva, FJ, Giralt, SA, Blanco, J, Signes-Costa, J, Velarde, H et al. (2000). Outcome of bone marrow transplantation patients requiring mechanical ventilation. Crit Care Med 28: 1014–1017. [DOI] [PubMed] [Google Scholar]
  39. Jackson, SR, Tweeddale, MG, Barnett, MJ, Spinelli, JJ, Sutherland, HJ, Reece, DE et al. (1998). Admission of bone marrow transplant recipients to the intensive care unit: outcome, survival and prognostic factors. Bone Marrow Transplant 21: 697–704. [DOI] [PubMed] [Google Scholar]
  40. Antin, JH and Ferrara, JL (1992). Cytokine dysregulation and acute graft-versus-host disease. Blood 80: 2964–2968. [PubMed] [Google Scholar]
  41. Ferrara, JL, Levy, R and Chao, NJ (1999). Pathophysiologic mechanisms of acute graft-vs.-host disease. Biol Blood Marrow Transplant 5: 347–356. [DOI] [PubMed] [Google Scholar]
  42. Jadus, MR and Wepsic, HT (1992). The role of cytokines in graft-versus-host reactions and disease. Bone Marrow Transplant 10: 1–14. [PubMed] [Google Scholar]
  43. Rabinowitz, J, Petros, WP, Stuart, AR and Peters, WP (1993). Characterization of endogenous cytokine concentrations after high-dose chemotherapy with autologous bone marrow support. Blood 81: 2452–2459. [PubMed] [Google Scholar]
  44. Salat, C, Holler, E, Schleuning, M, Eisele, B, Reinhardt, B, Kolb, H et al. (1995). Levels of the terminal complement complex, C3a-desArg and C1-inhibitor in adult patients with capillary leak syndrome following bone marrow transplantation. Ann Hematol 71: 271–274. [DOI] [PubMed] [Google Scholar]
  45. Takatsuka, H, Takemoto, Y, Yamada, S, Wada, H, Tamura, S, Fujimori, Y et al. (2000). Complications after bone marrow transplantation are manifestations of systemic inflammatory response syndrome. Bone Marrow Transplant 26: 419–426. [DOI] [PubMed] [Google Scholar]
  46. Burzyn, D, Kuswanto, W, Kolodin, D, Shadrach, JL, Cerletti, M, Jang, Y et al. (2013). A special population of regulatory T cells potentiates muscle repair. Cell 155: 1282–1295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Honeyman, K, Carville, KS, Howell, JM, Fletcher, S and Wilton, SD (1999). Development of a snapback method of single-strand conformation polymorphism analysis for genotyping Golden Retrievers for the X-linked muscular dystrophy allele. Am J Vet Res 60: 734–737. [PubMed] [Google Scholar]
  48. Sampaolesi, M, Torrente, Y, Innocenzi, A, Tonlorenzi, R, D'Antona, G, Pellegrino, MA et al. (2003). Cell therapy of alpha-sarcoglycan null dystrophic mice through intra-arterial delivery of mesoangioblasts. Science 301: 487–492. [DOI] [PubMed] [Google Scholar]
  49. Ji, N and Forsthuber, TG (2016). ELISPOT techniques. Methods Mol Biol 1304: 63–71. [DOI] [PubMed] [Google Scholar]
  50. Mendell, JR, Rodino-Klapac, L, Sahenk, Z, Malik, V, Kaspar, BK, Walker, CM et al. (2012). Gene therapy for muscular dystrophy: lessons learned and path forward. Neurosci Lett 527: 90–99. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figures
Click here for additional data file. (9.6MB, zip)

Articles from Molecular Therapy are provided here courtesy of The American Society of Gene & Cell Therapy

RESOURCES