Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Dec 13.
Published in final edited form as: Mech Dev. 2016 Aug 20;142:10–21. doi: 10.1016/j.mod.2016.08.003

Regeneration in bipinnaria larvae of the bat star Patiria miniata induces rapid and broad new gene expression

Nathalie Oulhen 1,+, Andreas Heyland 1,2,*,+, Tyler J Carrier 1,3, Vanesa Zazueta-Novoa 1, Tara Fresques 1, Jessica Laird 1, Thomas M Onorato 4, Daniel Janies 5, Gary Wessel 1,*
PMCID: PMC5154901  NIHMSID: NIHMS826033  PMID: 27555501

Abstract

Background

Some metazoa have the capacity to regenerate lost body parts. This phenomenon in adults has been classically described in echinoderms, especially in sea stars (Asteroidea). Sea star bipinnaria larvae can also rapidly and effectively regenerate a complete larva after surgical bisection. Understanding the capacity to reverse cell fates in the larva is important from both a developmental and biomedical perspective; yet, the mechanisms underlying regeneration in echinoderms are poorly understood.

Results

Here, we describe the process of bipinnaria regeneration after bisection in the bat star Patiria miniata. We tested transcriptional, translational, and cell proliferation activity after bisection in anterior and posterior bipinnaria halves as well as expression of SRAP, reported as a sea star regeneration associated protease (Vickery et al., 2001b). Moreover, we found several genes whose transcripts increased in abundance following bisection, including: vasa, dysferlin, vitellogenin 1 and vitellogenin 2.

Conclusion

These results show a transformation following bisection, especially in the anterior halves, of cell fate reassignment in all three germ layers, with clear and predictable changes. These results define molecular events that accompany the cell fate changes coincident to the regenerative response in echinoderm larvae.

Keywords: vasa, SRAP, dysferlin, vitellogenin, transcription, repair, patterning

“If there were no regeneration there could be no life. If everything regenerated there would be no death. All organisms exist between these two extremes. All things being equal, they tend toward the latter end of the spectrum, never quite achieving immortality because this would be incompatible with reproduction.”

Richard Goss, Principles of Regeneration 1969.

Introduction

Regeneration enables an organism to restore lost tissue and organ functions following damage or removal. This process first requires wound healing, which is then followed by cell fate changes, migration, cell proliferation, and differential signaling to compensate for the lost region(s) of the organism (Goss, 1969). The mechanisms underlying regeneration are predicted to be under strong selection, as they provide the organism with the capacity to return to its full reproductive and developmental potential after injury (Bely and Nyberg, 2010). Most organisms do not have an ability to regenerate significantly and a major question in biology is whether this phenomenon could be induced in an otherwise non-regenerative species. To answer this question, we require a deep understanding of the mechanisms underlying this phenomenon.

In both planarians and Hydra, a stem cell population in the adults is set aside for growth of adult tissue, as well as for replication and pluripotency of a regenerating individual. Planarians use neoblasts as their sole replicative cell type capable of replacing all other cells of the adult, even the germ line (Alvarado and Yamanaka, 2014). So too in Hydra: the stem cells of ectodermal and endodermal epithelium and the I-cells are the source for the replicative cells of the adult. One or another of their progeny contributes to all cell types of the adult, including the germ line (Technau and Steele, 2011; Tomczyk et al., 2015). These highly proliferative and pluripotent (or totipotent in the case of the planarian) stem cells are responsible for the vast regenerative capacity of these adults. It is not clear though whether this reliance on specialized stem cells devoted to tasks of replenishment and regeneration is a shared strategy amongst metazoans.

Sea stars (Echinodermata: Asteroidea) have been used extensively as a classic example for regeneration studies in invertebrates (Anderson, 1962; Goss, 1965; Mladenov et al., 1989). Adults may lose an arm, or multiple arms, but are capable of regenerating all lost tissues and appendages as long as they still have a portion of the central body disk. The regenerated tissues include the many cell types of the dermis and epidermis, the gut, nerves, and even the gonads and germ cells (Huet, 1974). Significant efforts are being made to understand this complete replacement of each arm in a sea star, but this regeneration process may take several months, depending on the species.

Interest in experimental testing of regeneration in echinoderms was reinvigorated when larval budding was observed in four of the five echinoderm classes: ophioroids (Balser, 1998), echinoids (Eaves and Palmer, 2003; Vaughn and Strathmann, 2008), asteroids (Rao et al., 1993) and holothuroids (Eaves and Palmer, 2003). In general, a significant percentage of larvae bud off clones from the parent larva, which serves to develop a new, fully functional lava. This cloning characteristic in echinoderm larvae led to experimentation in regeneration following bisection of sea star larvae that resulted in the observation of wound healing, and even complete regeneration of lost body parts. For example, the posterior halves would develop features of the anterior, including new coelomic pouches, foreguts, and mouth openings, and the anterior halves would develop posterior features, e.g. a new stomach, intestine and anal openings (Vickery and McClintock, 1998; Vickery et al., 2002). In an attempt to uncover underlying mechanisms of sea star larval regeneration, SRAP (sea star regeneration associated protease) emerged as a potential candidate gene from a differential cDNA library screen by Vickery and colleagues (Vickery et al., 2001b). This protease was suggested to be functionally involved in modifications of the extracellular matrix needed for wound healing and regeneration.

Here we explore the wound healing and regenerative capacity of larvae from the bat star Patiria miniata, and document general mechanisms of the regeneration phenomenon based on spatial and temporal gene expression patterns, transcription and translation activity and general morphological changes after bisection. Enormous genomic, transcriptomic, antibody, and experimental resources are available for this species, thus making it an excellent model to explore regeneration using a molecular and cellular approach.

Results

Morphological changes during regeneration

We performed a detailed morphological analysis of regeneration in bisected bipinnaria larvae in this species by documenting anterior and posterior halves for 96h post cutting (Fig. 1). Posterior fragments can regenerate the mouth within 96h (Fig. 1G,H) while anterior pieces require more time to regenerate the digestive tract (up to ~15 days; see also Figure 2, but this largely depends on the rearing conditions. Under high food conditions (>12 cells Rhodomonas lense per μl of culture; see, Materials and Methods), anterior parts can regenerate a functional digestive tract (new anal opening through the ectoderm) in less than 12 days (Fig. 1). We also observed several cell types migrate to the wound healing site, but these cells will require further identification for relevance to the regenerative process. One very obvious change over the first 96h were substantial changes in musculature. We provide a complete time series of muscle regeneration using phalloidin stain (Fig. 2). Larvae regenerate their musculature over a 7 day period (~168h). Immediately after bisection, the injury sites are visible as phalloidin stain shows slightly stronger signal in the areas of injury. Over time, muscle strands regenerate by creating web-like extensions at the site of injury (Fig 2A, 24h). In subsequent days muscle strands develop similar phenotypes to the control larvae. Note however that 7 days is not a sufficient time to see a complete regeneration of musculature. Together these processes (i.e., cell movement and muscle regeneration) may be critical for the wound healing and regeneration process. Observations presented here are based on >100 larvae and we found that the sequence of regeneration events is largely independent of cutting site and method.

Figure 1.

Figure 1

Open in a new tab

Documentation of regenerative process over the course of the first 96h after bisection. We bisected bipinnaria larvae (2 weeks old) and performed a detailed morphological analysis of anterior (A–F) and posterior (A′–F′) parts 2h, 24 and 96h post-cutting. Posterior parts clearly regenerate a gut morphologically within 96h while anterior parts require more time (see text for details). (G) uncut sibling larva. a: anus; acs: anterior cut site; cp: coelomic pouches; es: esophagus; m: mouth; pcs: posterior cut site; st: stomach. Scale bars A, A′, B, B′, C, C′ (100μm); D, D′, E, E′, F, F′ G (75μm).

Figure 2.

Figure 2

Open in a new tab

Muscular regeneration of anterior and posterior pieces after bisection of 2 week old larvae. Bisected larvae were stained using phalloidin 24, 48, 120 and 168h post bisection. We observed the generation of new muscle fibers post-bisection in the cut area. Blue: DRAQ-5 nuclear stain, Green: phalloidin.

Cell proliferation during regeneration

To determine if changes in cell replication are induced by bisection, sea star larvae were bisected 3 days post-fertilization, incubated with EdU and fixed 2h and 24h later. Following the Click-IT reaction for fluorescence labeling (red – Fig 3) and staining the nuclei with Hoechst (blue – Fig 3), these specimens were analyzed on the confocal microscope for cell proliferation (EdU incorporation) using uncut larvae as a reference. Cell proliferation was quantified as a ratio of positive cells [rPC: Normalized # cells (Edu/DNA)]: the ratio of number of cells labeled with Edu over the number of nuclei (Fig 3). Using time post-cut (2h, 24h), body part (full, anterior, posterior) and cut (no cut, cut) as factors in a three-way ANOVA we found that all three factors had a significant effect on cell proliferation (Time: F1,24=170.97; p<0.01; Cut: F1,19=6.53; p=0.01; Part: F2,9=20; p<0.01). We then analyzed whether cutting the larva had an effect on cell proliferation in anterior and posterior halves using a two-way ANOVA. We found that 2h post cutting cell proliferation was not different between cut and uncut larvae (F1,9=3.10; p=0.10) but we found a significant effect of body part on cell proliferation (F1,9=21.53; p<0.01). Specifically we found that cell proliferation was higher in anterior than in posterior parts. We also found a significant interaction between cutting and body part (F1,1,9=8.32; p=0.01), indicating cell proliferation patterns in anterior and posterior parts are different at 2h post-cut between cut and uncut larvae. Specifically, we found that proliferation increases in anterior parts compared to uncut controls, while it stays the same in posterior parts compared to controls. 24h post cutting we found that cutting significantly affected cell proliferation (F1,9=60.96; p<0.01) and cell proliferation in anterior and posterior parts were significantly different from each other (F1,9=15.87; p<0.01). Specifically, cutting reduced cell proliferation and cell proliferation was higher in anterior parts than in posterior parts. We also found a significant interaction between cutting and body part (F1,1,9=11.92; p<0.01), indicating cell proliferation patterns in anterior and posterior parts are different at 24h post-cut between cut and uncut larvae. Specifically, we found that cutting larvae reduced cell proliferation in both anterior and posterior parts.

Figure 3.

Figure 3

Open in a new tab

Cell proliferation in anterior and posterior pieces of 3-day-old larvae. A) Representative pictures of cut and uncut bipinnaria larvae, B) quantitative analysis of cell proliferation activity. Sea star larvae were cut in half and fixed 2h and 24h later, after a 75 minute incubation with EdU (red). The nuclei were labeled with Hoechst (blue). Uncut larvae were used as a reference.

General transcription and translation during regeneration

Cellular activity may be altered during regeneration and may not be uniformly represented along the wound healing sites. To test if transcription is affected during wound healing and regeneration, the bisected larvae were incubated with EU for 6h or 24h following the cut. The nuclei were labeled with Hoechst (Fig 4A and 4B) and overall transcriptional activity was measured as a ratio of fluorescence intensity: the ratio of fluorescence intensity obtained with EU over the fluorescence intensity obtained with Hoechst. Using time post-cut (6h, 24h), body part (full, anterior, posterior) and cut (no cut, cut) as factors in a three-way ANOVA we found that no factor had an effect on transcription (Time: F1,19=2.94; p=0.10; Cut: F1,15=0.18; p=0.67; Part: F2,7=1.01; p=0.38). We therefore did not perform any further analysis.

Figure 4.

Figure 4

Open in a new tab

Transcriptional (A,B), and translational activity (C,D) in anterior and posterior pieces. A) Representative images of transcriptional activity in cut and uncut bipinnaria larvae, 3 days of age, B) Quantification of transcriptional activity. Sea star larvae were cut in half and incubated with EU (red), for either 6h or 24h before being fixed. The nuclei were labeled with Hoechst (blue). Uncut larvae were used as a reference. C) Representative images of translational activity in cut and uncut bipinnaria larvae, D) Quantification of translational activity. Sea star larvae were cut in half and fixed 6h and 24h later, after a 30 minute incubation with HPG (green) to visualize protein synthesis in situ. The nuclei were labeled with Hoechst (blue). Uncut larvae were used as a reference.

To test if protein synthesis is altered during wound healing and regeneration, sea star larvae and bisected halves were similarly prepared and following a 30 minute incubation with HPG to visualize protein synthesis in situ, were fixed at 6h, and 24h following bisection (Fig 4C and 4D). The nuclei were labeled with Hoechst and uncut larvae were used as a control. The overall translational activity was measured as a ratio of fluorescence intensity: the ratio of fluorescence intensity obtained with HPG over the fluorescence intensity obtained with Hoechst. Using time post-cut (6h, 24h), body part (full, anterior, posterior) and cut (no cut, cut) as a factors in a three-way ANOVA we found that time and part had a significant effect on protein synthesis (Time: F1,24=7.09; p=0.01; Part: F2,9=25.34; p<0.01). Cutting did not affect protein synthesis (F1,19=2.26; p=0.14). We then analyzed whether cutting the larva had an effect on protein synthesis in anterior and posterior halves using a two-way ANOVA. We found that 6h post cutting protein synthesis was different between cut and uncut larvae (F1,9=30.27; p<0.01) and anterior and posterior parts (F1,9=23.07; p<0.01). Specifically, protein synthesis was reduced in cut larvae and lower in posterior parts than in anterior parts. We also found a significant interaction between cutting and body part (F1,1,9=6.46; p=0.02), indicating protein synthesis patterns in anterior and posterior parts are different at 6h post-cut between cut and uncut larvae. Specifically, we found that the decrease in protein synthesis from the control was more pronounced in posterior parts compared to anterior parts. 24h post cutting we found that cutting significantly affected protein synthesis (F1,9=26.32; p<0.01) and protein synthesis in anterior and posterior parts were significantly different from each other (F1,9=26.27; p<0.01). Specifically we found that cut larvae showed higher protein synthesis levels than uncut larvae and anterior parts showed higher protein synthesis patterns than posterior parts. We also found a significant interaction between cutting and body part (F1,1,9=7.13; p=0.02), indicating protein synthesis patterns in anterior and posterior parts are different at 24h post-cut between cut and uncut larvae. Specifically, we found that while protein synthesis increased in anterior parts compared to the control, it stayed the same in posterior parts.

Specific gene expression during regeneration

SRAP

The sequence of SRAP (sea star regeneration associated protease; (Vickery et al., 2001b)) was originally identified in a differential cDNA screen of mRNAs over-expressed in bisected larval halves, but its location in the animal and developmental dynamics of expression were not tested. To test the model that SRAP is involved in regeneration, we first localized its transcript accumulation in embryos and larvae and found that it is not present in embryos of P. miniata. Only in 4-day larvae and beyond was SRAP detectable (Fig 5). This expression was found localized to individualized cells within the epithelium of the gut, and mostly in the mid-gut region of the digestive system. We then tested its role in regeneration by quantitating its mRNA levels before and after bisection (Fig 6). Three-day-old larvae were bisected, cultured and each half was frequently tested for appearance of SRAP mRNA. We first quantified the level of SRAP mRNA during regeneration in P. miniata, using the same developmental milestones as were used to identify it in the first place in Luidia foliolata (Vickery et al., 2001a). We found no significant difference in SRAP levels in the posterior regenerates during the 6h incubation period (Fig 6; F1,5=0.02; p=0.89) while no SRAP expression was detected in anterior halves in this time frame. In these experiments the initial cut of the bisection at 3 days results in all of the SRAP partitioning to the posterior region, as concluded from bisections for in situ RNA hybridization, but no change in SRAP mRNA levels was seen in the window of regeneration tested here.

Figure 5.

Figure 5

Open in a new tab

SRAP expression in normal development of P. miniata. To determine the temporal expression of the SRAP transcript in Pm, an RNA probe was synthesized for in situ hybridization and a probe against the neomycin-resistance gene was used as a negative control (A). The expression was tested in immature (a) and mature (b) oocytes, blastula (c), mid (d) and late gastrula (e), 4 day larva (f), and 6 day larva (g). The strongest expression was detected in the stomach of the larvae. qPCR was used to measure the RNA levels of SRAP at the indicated developmental stages: immature oocytes, hatched blastula, mid and late gastrula, 3 day, 4 day and 7 day old larvae (B). All values were normalized against the 18S mRNA and represented as a fold-change relative the amount of RNA present in hatched blastula.

Figure 6.

Figure 6

Open in a new tab

Expression of Dysferlin, Nodal, SRAP, Vasa, Vitellogenin 1 and 2, in anterior and posterior pieces relative to uncut larvae. Expressions of Dysferlin, Vasa, Vtg1 and Vtg2 increase 6h post bisection while SRAP and Nodal are not. Error bars show 1 standard error from 3 independent biological replicate samples.

We then tested SRAP expression during regeneration over prolonged periods by in situ RNA hybridization. In the posterior halves, SRAP expression appeared on time in 4-day-old posterior gut regions much as seen in intact larvae (Fig 7). This expression was temporally and spatially comparable to the normal intact larvae. In the posterior halves, SRAP appeared in individualized cells of the gut epithelium as normally seen in whole larvae, even though the posterior halves undergo significant cellular and tissue rearrangement. More surprisingly, SRAP appeared in the anterior halves, as well. Even though the cut site of bisection is well anterior of the normal expression of SRAP in the mid-gut epithelium, SRAP appeared within the regenerating gut of anterior halves, and within the “equivalent” mid-region of the regenerates. SRAP expression in this newly regenerated region was equal to that seen in the intact larvae; that is, SRAP was found selectively in the anterior most region of the mid-gut of the 15 day and older regenerating larvae, and in individualized cells of the epithelium. Thus, SRAP expression in the anterior halves of bisected larvae identifies newly regenerated mid-gut tissue in the anterior halves of the bisection, a region of the intact larvae that would not normally serve as mid-gut or SRAP positive cells. This is the first molecular marker of re-specified cell fates within the regenerating anterior halves. This result provides a molecular marker of regenerating events in this animal, and shows that entire regions of the animal re-specify tissues in comparable spatial and temporal sequences.

Figure 7.

Figure 7

Open in a new tab

Uncut larvae, (A), anterior (B), and posterior (C) pieces monitored for SRAP expression post bisection. SRAP expression in the stomach is strongly correlated with stomach regeneration in both pieces

We then tested the putative function of SRAP, a secreted serine protease, during wound healing and regeneration by use of a specific protease inhibitor for serine proteases, soybean trypsin inhibitor (SBTI). SBTI was selected because its history of successful vital use in echinoderms e.g. (Haley and Wessel, 1999, 2004) and its inability to cross the plasma membrane and thereby access only secreted trypsin proteases. When regenerating anterior and posterior halves of a 3-day larvae were exposed to 100 μg•ml−1 SBTI, neither regions demonstrated altered regenerative progression, positively or negatively. Thus, based on the expression pattern of SRAP, its slow response to the regeneration phenotype especially in the anterior half, and the lack of effect on regeneration in targeted inhibition of its function, we conclude that SRAP is not directly involved in regeneration in this animal. Instead it may be involved in feeding and digestion, since its expression appears limited to a set of epithelial cells dispersed throughout the gut. We do not, however, see SRAP expression induced by feeding (data not shown). Thus, we conclude that SRAP in P.miniata is constitutively expressed in larvae following development of the digestive system. This result does not preclude the potential functionality of SRAP in regeneration or other activities in L. foliolata, the species of sea star for which is was initially identified as a regeneration-responsive gene product during larval development (Vickery et al., 2001b). Additional results suggest that SRAP expression may instead be induced by infection in posterior parts after bisection (data not shown), which might explain differences in the results seen here, and in the initial identification of SRAP in L. foliolata.

Alkaline phosphatase activity as a metric of gut regeneration

We identified and tested alkaline phosphatase (AP) activity during the regeneration process in P. miniata in order to monitor digestive activity of the gut as the larva regenerates. We found that alkaline phosphatase activity, much like in sea urchins (Livingston and Wilt, 1989; Lyons and Weaver, 1962), is not detectable in early embryos, but much like for SRAP, first appears in gastrulae restricted to the hind and mid-gut endoderm (Fig 8). Remarkably, although alkaline phosphatase activity is robust in the developing gut, this activity is immediately excluded from the posterior enterocoel (PE) upon its formation. The PE is believed to be the site of primordial germ cell formation in this animal and opposite from what is seen in vertebrates, this activity is excluded from the germ line in the sea star (Kuraishi and Osanai, 1994).

Figure 8.

Figure 8

Open in a new tab

Expression of Tissue Nonspecific Alkaline Phosphatase (TNAP), during the normal development of P. miniata (A). The TNAP activity was tested in egg (a), blastula (b), early gastrula (c), mid gastrula (d), late gastrula (e), 3 day (f), 8 day (g), and 20 day (h) old larvae. To test the regeneration of the gut, 3 day old larvae were cut in half, and cultured for 20 days (B). The expression of TNAP was tested at 20 days in the anterior and posterior pieces. Arrow points to the posterior enterocoel (PE).

Bisecting 3-day old larvae and testing for AP activity following culture demonstrated that the larval fragments were capable of re-specifying cell fates during regenerative phenomena. While the posterior halves containing the major gut tissues expressed robust activity after 20 days of culture, the anterior fragments, which started the recovery period with only a small portion of the foregut, regenerated a full gut with distinct fore-, mid-, and hindgut segments and with robust AP activity appropriately represented in the hind-, mid-gut sections. Although SRAP and alkaline phosphatase have regions of overlapping activities, they are readily distinguishable in both the intact larva and in the regenerate; SRAP accumulates in distinct, and individualized cells, whereas alkaline phosphatase accumulates broadly in all cells of the gut region, and in the induced regenerate. We conclude from these first two molecular markers that during regeneration new cell fate acquisition is rapid, broad, and as a consequence, likely utilizes multiple different developmental pathways.

Induction of other gene products during regeneration

We tested other candidate genes of interest to determine how broadly new gene expression was during regeneration of the bisected halves. Dysferlin is a calcium-binding protein shown previously to be important in wound healing of cells (e.g. (Cheng et al., 2015)), even in other members of this phylum (Covian-Nares et al., 2010) and in endocytosis of sea star (P. miniata) oocytes and embryos (Oulhen et al., 2014a), a feature perhaps important during cellular rearrangements in response to regeneration. Dysferlin is found throughout the larva, and in both the anterior and posterior regions of bisected larvae (Fig. 6; (Oulhen et al., 2014b). Bisection, however, had a significant effect on dysferlin mRNA expression 6h after cutting (F1,5=6.55; p=0.03) wherein both anterior and posterior halves increased dysferlin mRNA steady state levels. We also found a significant difference in dysferlin response between anterior and posterior parts (F1,5=15.60; p<0.01) although we see no significant interaction between time (0 vs. 6h) and part (anterior vs. posterior) (F1,1,5=0.02; p=0.89). We detected a significant difference in nodal expression (Fig. 6) between anterior and posterior parts (F1,5=11.82; p<0.01) but expression levels did not change over the 6h period (F1,5=0.08; p=0.79).

We found significant stimulation of Vasa mRNA accumulation in both the anterior and posterior halves (F1,5=117.20; p<0.01) over a 6h period. Vasa is an RNA helicase thought to be involved in broad translational regulation in echinoderms (Yajima and Wessel, 2015b). Vasa was initially found in the germ line of Drosophila (Schupbach and Wieschaus, 1986) but has since been seen in the germ line of all animals tested, and in somatic cells of many of those (Alie et al., 2011; Mochizuki et al., 2001; Pek and Kai, 2011; Pfister et al., 2008; Renault, 2012; Swartz et al., 2008; Yajima and Wessel, 2015a; Yajima and Wessel, 2011). It is also postulated to be involved in wound healing and regeneration: damaged arms of sea urchin larvae increase the accumulation of Vasa protein, even though the mRNA does not change (Yajima and Wessel, 2015b). This behavior is consistent with Vasa being highly regulated post-transcriptionally. in bisected sea star larvae, Vasa mRNA accumulated significantly during a 6hr window of regeneration (F1,5=51.80; p<0.01) and we detected a significant interaction between time and body part suggesting that the increase of expression over time (6h) is more pronounced in anterior parts (F1,1,5=5.34; p=0.05). Spatially, Vasa accumulated more intensively in areas already populated by Vasa at bisection, but the accumulation in anterior halves was more instructive. In cases where the bisection was directed more posteriorly, such that the anterior half included more of the coelomic pouches of the larva, Vasa accumulation increased during regeneration, but only in the pouches, where it is normally present. In cases, however, where the bisection was more anteriorly disposed, which minimized the amount of coelomic pouch tissue, then Vasa mRNA was induced both more robustly, and throughout the anterior half (Fig 9A).

Figure 9.

Figure 9

Open in a new tab

Expression of vasa (A) transcript in the anterior (c,d,e) and posterior (f) pieces was tested 6h after being cut, and compared to uncut larvae 3 days of age (b). Three expression profiles were obtained in the 24 anteriors that were visualized, the corresponding percentages of representative vasa expression are indicated in the right corner. If the percentage is not indicated, it means that the image represents 100% of the observed embryos. A probe against the neomycin resistant gene was used as a negative control (a). Expression of vitellogenin 1 and 2 (B) transcripts in the anterior (c,g) and posterior (d,h) pieces were tested 6h after being cut, and compared to uncut larvae (b,f). A probe against the neomycin resistant gene was used as a negative control (a,e).

We also tested temporal and spatial expression patterns of vitellogenin (vtg). This yolk protein of animals is present in P. miniata in two copies, vtg 1 and vtg 2. Upon bisection, both Vitellogenin genes are activated and the mRNAs of each transcript accumulate significantly after 6h (vtg1: F1,5=8.45; p=0.02; vtg2: F1,5=10.12; p<0.01) as detected both by quantitative PCR (Fig 6), and by in situ RNA hybridization (Fig 9). We also found higher expression of vtg2 in anterior than in posterior parts (F1,5=22.58; p<0.01), a difference that we observed qualitatively for vgt1 as well but was not statistically supported (F1,5=3.25, p=0.11). In the case of Vtg 2, induction of transcript accumulation recapitulates the mRNA accumulation in normal larvae; transcripts are concentrated in the coelomic pouches and individualized, overlying cells of the ectoderm.

Interestingly, immunoblots using antibodies against vasa, vtg1 and vtg2 indicate that the expressions of these 3 proteins are not affected during regeneration (Fig 10). Even though, the corresponding transcript levels increase in the early steps of regeneration (6h after the cut), their protein expressions appear unaffected during the first 24h after the cut.

Figure 10.

Figure 10

Open in a new tab

Immunoblot of Vasa and Vtg1 and 2. Three day old larvae were cut and fixed at time 0 (just after the cut), 6h or 24h after the cut. Samples were loaded on a gel for western blot. (A) Tubulin was used as a loading control. The protein bands were quantified using Image J (B,C,D) The protein expressions of vtg1, vtg2, and Vasa are not affected during regeneration.

Discussion

As non-chordate Deuterostomes, Echinoderms represent excellent model organisms for studying the evolution of developmental mechanisms. While sea stars and sea cucumbers have been studied for decades to better understand regeneration in adults, relatively little knowledge on underlying molecular mechanism of this process exists. Herein, is the first report of molecular markers in situ that are seen in regeneration sea star larval phenotypes, and which are now useful for analysis of the mechanism of regeneration and the accompanying cell fate changes.

With the discovery and documentation of larvae regeneration and cloning in several echinoderm taxa including sea stars, excellent histological and morphological analyses have been reported (Vickery and McClintock, 1998; Vickery et al., 2002). Our study complements this data by providing a detailed and quantitative molecular description of the regeneration process in P. miniata. Both anterior and posterior halves are capable of regenerating gut tissue and eventually form a functional and morphologically complex digestive system. The process involved considerable restructuring of muscular tissue creating a temporary digestive system for the larvae.

Broad transcriptional changes during regeneration

SRAP (sea star regeneration associated protease; (Vickery et al., 2001b)) was originally identified in a cDNA screen of mRNAs over-expressed in bisected larvae halves. The hypothesis was that SRAP, based on its predicted protease sequence, may be involved in cellular rearrangements, and modifications to the extracellular matrix needed for wound healing and regeneration. In contrast to these data from L. foliolata, we did not find evidence for up regulation of SRAP in P. miniata. However, SRAP expression in the anterior halves of bisected larvae identifies transformation of mid-gut tissue in the anterior halves of the bisection, a region of the intact larvae that would not normally serve as mid-gut or contain SRAP positive cells. This is the first identified molecular marker of re-specified cell fates within the regenerating anterior halves. This experiment demonstrates that regenerating events do indeed occur in the sea star P. miniata, and that entire regions of the animal re-specify tissues in a manner comparable to the uncut larvae.

Based on the response time for the regeneration phenotype, especially in the anterior half, and the targeted inhibition of its function, we conclude that SRAP is not directly involved in regeneration in this animal. Instead, it may be involved in feeding and digestion, since its expression appears limited to a set of epithelial cells dispersed throughout the gut. However, when we tested this hypothesis we did not see SRAP expression responsive to feeding either (data not shown). Thus, we conclude that SRAP in P.miniata is constitutively expressed in larvae following development of the digestive system likely used for digestion of food. This result does not preclude the potential functionality of SRAP in regeneration or other activities in L. foliolata, the species of sea star for which is was initially identified as a regeneration-responsive gene product during larval development (Vickery et al., 2001b). Furthermore, our preliminary data on SRAP up-regulation in response to infection may suggest a function in innate immunity, a function that may be shared with L. foliolata. Similarly, in planarians, the expression of a trypsin like serine protease, detected in the gut during normal development and during regeneration, increases after bacterial challenges, but remains unaffected after addition of food (Zhou et al., 2012).

Using a large transcriptomic database, sequence alignment, and phylogenetic analyses we find that SRAP and closely related serine proteases occur in two main groups of the gene tree (Fig 11). The first group contains echinoderm sisters of the genes identified by Vickery et al., (2001b) in L. foliolata (Genbank accession AAK15274) and the sister gene we sequenced from Patiria miniata (Reich et al., 2015). This echinoderm-only group forms a clade that includes genes from all five extant classes of echinoderms and is thus hypothesized to have recently evolved in the phylum.

Figure 11.

Figure 11

Open in a new tab

Phylogenetic tree for genes related to SRAP identified from L. foliolata (Vickery et al., 2001). The tree contains two groups 1) an echinoderm only group indicated by the purple rectangle that includes genes from all 5 extant classes of echinoderms. Another group of genes from Echinoderms that are sisters to genes from Chordates, Arthopods, Nematodes, and Cnidaria. Our phylogenetic results show that SRAP orthologs in echinoderms consist of genes that occur only in echinoderms and genes that are closely related to taxonomically distant organisms (e.g., Chordates, Arthropods, Nematodes and Cnidaria).

Similar to SRAP, alkaline phosphatase (AP) activity is also induced in the regenerating gut of the anterior halves, in cells that otherwise would not have this activity. It was rapidly cleared though from the cells of the posterior enterocoel (PE) cells. The PE is believed to be the site of primordial germ cell formation in P. miniata (Fresques et al., 2014; Inoue, 1992; Inoue and Shirai, 1991; Wessel et al., 2014) and opposite from what is seen in vertebrates, this activity is excluded from the germ line in the sea star. We do not know if the alkaline phosphatase protein, and/or its mRNA, is rapidly turned over in the PE, or if the PE contains some inhibitory activity for the enzyme, but the speed with which the alkaline phosphatase activity changes in the PE suggests a post-transcriptional mechanism. Therefore, even with these two molecular regeneration markers, diverse spatial regulation appears to occur.

Transcriptional activity after bisection

The overall transcriptional activity in the regenerate appears comparable to the intact larvae at the 6h time point. Whereas the expression of transcripts such as nodal is not affected during regeneration, several genes like SRAP, Vasa, Dysferlin, Vitellogenin 1 and 2, are induced to increase in disparate regions of the regenerate. Quantitatively, Dysferlin, SRAP and Vasa all show higher levels of expression in the posterior than in the anterior part. In contrast, vtg1, and 2 show higher levels in the anterior part. Whether these expression levels are in any way functionally linked to regeneration remains to be tested but it further emphasizes that each of these markers will serve as valuable reagents to probe the mechanism of cell-cell signaling responsible for these changes.

The experimentation presented here is on larval stages – that is, a stage of differentiated cells and tissues of diverse functionality and developmental history, yet is still developmentally not an adult. Based on gene expression levels our results suggest a distinct mechanism compared to what can be found in other regenerating organisms such as Hydra and planarians in which a pre-determined, stem cell population is largely responsible for the regenerative capacity of those animals. We make this conclusion based on multiple time points of cellular proliferation; we do not see focal points of proliferation that appear to add to existing structures but rather a broad, continuous proliferation and transformation of cellular activity that results in new tissue functions. It is important to note that a significant amount of development has occurred in the larvae of echinoderms at this stage and cells of various tissues are expressing unique gene profiles throughout the animal (Hinman et al., 2003; Hinman and Jarvela, 2014; McCauley et al., 2013), yet they are still able to transition into other functional elements following bisection. This includes the three-part digestive system and its associated glands, a functional nervous system that coordinates swimming and eating behaviors, and multiple ectodermal and mesodermal regions of distinct functionality. Subsequent development of this stage emphasizes the formation of the adult rudiment – that portion of the larvae that will become the adult during the processes of metamorphosis and settlement. Overall then in the dramatic regenerative capabilities of this animal, we find evidence for significant and broad cellular responses for cellular fate transitions to compensate for portions of the animal lost in bisection. Use of the larva for these studies permits more rapid response and analysis than in the adult making it a tractable system for regeneration studies. We believe that the dependence on broad cell transitions of the larvae for regeneration is distinct from the mechanisms used by planarians and Hydra, and may more closely reflect a vertebrate model of regeneration for future studies of gene identification, logistics of cellular transitions, and the intersection of mechanisms between wound healing and regeneration.

Conclusions

Overall, we find that bisection of sea star larva serves as an excellent and tractable model for studying regeneration. We report for the first time, several molecular markers of disparate types and expression patterns that provide a rapid, predictable, and productive model for studies of regeneration. Here, we have documented the process in a popular sea star for studies in development, evolution, and with large transcriptomic resources (echinobase.org; (Janies et al., 2016). We hypothesize that this larva regenerates by broad cellular transitions, apparently not by pre-specified stem cell populations used to uniquely replicate and replace lost tissues. In combination with the documented genes found to significantly change their expression patterns, we believe this animal will serve as an important model for studying the mechanistic underpinnings of regeneration in a deuterostome.

Experimental procedures

Culture and Bisection of larvae

Patiria miniata were collected from the Southern coast of California, USA from either Pete Halmay (PeterHalmay@gmail.com) or Josh Ross (info@scbiomarine.com). Fertilization and embryo/larvae culture and feeding was performed as described at 16°C (Wessel et al., 2010). Larvae were fed R. lense at libitum (i.e., >12 cells•μl−1). At specified times, samples from the culture were placed in a watch glass and individuals were bisected manually with a #15 sterile scalpel. Control (uncut) larvae and the anterior and posterior halves were collected by mouth pipetting and transferred to individual dishes (30 mm Petri dishes) containing the same type of specimens.

In situ RNA hybridization

Control larvae and regenerate halves were fixed and hybridized essentially as described (Arenas-Mena et al., 2000). Briefly, samples were resuspended in Fix Solution II (5% PFA, 162.5 mM NaCl, 32.5 mM MOPS pH 7.0, 32.5% filtered sea water) and incubated overnight at 4° C. Samples were then washed five times with MOPS Buffer (0.1 M MOPS pH 7.0, 0.5 M NaCl, 0.1% Tween 20) and stored at −20° C in 70% ethanol until needed for hybridization. Larvae were then rehydrated by washing 3 times with MOPS Buffer and pre-hybridized for 3 hours at 50° C in Hybridization Buffer (70% formamide, 0.1 M MOPS pH 7.0, 0.5 M NaCl, 0.1% Tween 20, 1 mg•ml−1 BSA). Samples were hybridized with 0.2 ng•ul−1 of DIG labeled probe for 1 week at 50° C. The probe was washed out with 5 MOPS Buffer washes, then a 3 hour incubation at 50° C in Hybridization Buffer, and 3 more MOPS Buffer washes before the blocking step at room temperature for 20 minutes in Block Solution 1 (0.1 M MOPS pH7.0, 0.5 M NaCl, 10 mg•ml−1 BSA, 0.1% Tween 20). Samples were then blocked at 37° C for 30 minutes in Block Solution 2 (Block Solution 1 containing 10% Sheep serum) and then incubated with antibody overnight at room temperature in Block Solution 2 (Fab anti-digoxygenin conjugated to alkaline phosphatase; 1:1500, Roche Diagnostics). Samples were then washed and stained as described for 6–24 hours, and the reaction was stopped with 5 mM EDTA in MOPS Buffer. Samples were stored up to 1 day at 4° C and imaged on a Zeiss Axiovert 200M Microscope with an AxioCam MRc5 color camera. In all cases control samples were also incubated with the same concentration of Neomycin probe as a negative control. Probes were made using the following primer sets: Pm vasa (Fresques et al., 2014), Pm SRAP (F: TATACGCCGACTGTGGTGTG and R: TCATCGACGGTGGTTTCCTG), Pm vitellogenin1 (F: CCACCGATCCGTACTTCGAG and R: CTCCATCGTCAGGTAGTCGC) and Pm vitellogenin 2 (F: ACAGTATCCATGACGACCGC and R: CCCCTCCAGGTGACTGTAGA). The sequences for vtg transcripts can be found within GenBank: vtg1 (KU569217), vtg2 (KU569218).

Testing cell proliferation, transcription, and protein synthesis

The Click-iT EdU Imaging Kit (C10340) was used to label cell proliferation (Life technologies, Carlsbad, CA). The modified thymidine analogue EdU is efficiently incorporated into newly synthesized DNA and fluorescently labeled. Briefly, 3-day-old larvae were cut and soaked in 10 μM EdU for 75 minute incubation at the indicated time point. The nuclei were labeled with Hoechst (blue). Uncut larvae were used as a reference. Transcriptional activity was visualized using the Click-it EU kit (C10330), (Life Technologies, Carlsbad, CA). Briefly, 3-day-old larvae were cut, and incubated for either 6h or 24h with 0.5mM EU. The nascent transcripts were then labeled according to the manufacturer’s instructions. At the end of the click it reaction, the larvae were washed overnight in PBS at 4°C before being imaged. The nuclei were labeled with Hoechst (blue). Uncut larvae were used as a reference. Protein synthesis was visualized using the Click-it protein synthesis assay kit (Life Technologies, Carlsbad, CA) with HPG, L-homopropargylglycine (C10428). Briefly, the larvae were incubated for 30 minutes with HPG used at 1:2000, and fixed with 4% paraformaldehyde in seawater. The nascent proteins were then labeled according to the manufacturer’s Instructions. At the end of the click it reaction, the larvae were washed overnight in PBS at 4°C before being imaged. The nuclei were labeled with Hoechst (blue). Uncut larvae were used as a reference. For each staining (Edu, EU and HPG), negative controls labelled with Hoechst only were used as references to define the best laser intensity required to eliminate possible background and autofluorescence. Each larvae, cut or uncut, was entirely imaged by Z stacks using confocal microscopy (Zeiss). The images presented in Figures 3 and 4 represent the Z projection obtain for each larvae. For Edu, the number of nuclei was used to take into account the possible variations of larva thickness. The number of Edu labeled cells, and the number of nuclei, were analyzed using image J (Otsu threshold). For both EU and HPG, the overall fluorescence intensity was used as a measurement (Metamorph) and normalized to the overall fluorescence intensity obtained with Hoechst. We analyzed specific differences between time points and parts after bisection using ANOVA with post-hoc comparison. Note that for time, Bonferroni correction was performed to adjust for multiple comparisons.

Analysis of musculature development during wound healing and regeneration

Uncut and cut bipinnaria larvae were fixed at various times for 20 minutes in 4% paraformaldehyde and stained in a 0.2μM solution of Alexa Fluor® 488 Phalloidin (Thermo Fisher) in PBST (1x PBS with 0.3% Triton X) for 30 minutes. After washing 2–3 times with PBS specimens were mounted on slides in 90% glycerol with 10g/L DABCO (1,4-Diazabicyclo[2.2.2]octane) as an anti-fading agent and visualized on a Nikon Ti fluorescent microscope.

qRT-PCR

Three day old larvae were bisected, RNA was extracted from 50 uncut control larvae or 50 halves collected at the indicated times, using the RNeasy Micro Kit (Qiagen; Valencia, CA). cDNA was prepared using the Maxima First Strand cDNA synthesis kit for RT-QPCR (ThermoFisher Scientific; Waltham, MA). QPCR was performed on the 7300 Real-Time PCR system (Applied Biosystems; Foster City, CA) with the SYBR Green PCR Master Mix Kit (Applied Biosystems; Foster City, CA). Pm Dysferlin primer set is described in (Oulhen et al., 2014a). The following primers were used to amplify Pm Vasa (F: TGGCTGATGCTCAACAAGAC and R: AAAGTTTCCGCCTCCGTAAT), Pm SRAP (F: AAAGACTCTTGCCAGGGTGA and R: TTGGCAACGATGTTGTTGAT), Pm Vtg1 (F:GCGACTACCTGACGATGGAG and R: GGTTGGTGAAGGTCTGCTCA), Pm Vtg2 (F: CCCCAAGCGTTTCATCCTCT and R: CACGGACTTGTCGTTCTCCA). Experiments were run in triplicate and the data were normalized to 18S RNA levels (F: TTGGAGTGTTCAAAGCAGGC and R: TCGCCATTCTCACATTCGTA). Relative expression levels (FC) were calculated using delta Ct method (Livak and Schmittgen, 2001; Schmittgen et al., 2000; Winer et al., 1999) and FC levels from at least three independent replicates were analyzed using 2 factor Analysis of Variance (ANOVA) commands in SPSS (v23). Genes were analyzed separately with time post bisection and body part as fixed factors. Statistical significance was assessed for a 5% cut-off.

Sequence analysis and phylogenetic tree construction

As a means to determine whether SRAP orthologs were present throughout Echinodermata and many non-echinoderm model systems, amino acid sequence data from Vickery et al. (2001) (L. foliolata), Reich et al. (2015) (P. miniata), GenBank (all non-echinoderm model systems), and EchinoDB (http://echinodb.uncc.edu; for all other echinoderms; (Janies et al., 2016)) were combined. An alignment in MAFFT v7.215 (Katoh and Standley, 2013) using default values and tree search in (Stamatakis, 2014) v8.1.16 using 100 replicates under a PROTCATJTTF model of substitution of over 530 sequences was conducted. From the resulting phylogenetic tree, a sub-clade of sequenced related to those of interest was identified. After duplicative sequences from the EchinoDB were removed, they were combined with that of L. foliolata (Vickery et al., 2001a), P. miniata (Reich et al., 2015), and the model systems, totaling 33 sequences. The 33 sequences from clade of interest were realigned in MAFFT, resulting in an alignment of 301 amino acid characters. Following this, a new tree search was conducted under the same conditions. The resulting tree was rooted on Hydra vulgaris (GenBank: XP_002162561.1), and a taxonomic character was traced in Mesquite (Version 2.75, build 564; (Maddison and Maddison, 2011)), resulting in a tree with branches colored to indicate major taxonomic groups containing SRAP orthologs.

Western blot

Three day old larvae were bisected, and lysed in loading buffer at times 0h, 6h or 24h following bisection. Western blot analysis was performed following electrophoretic transfer of proteins from SDS-PAGE onto 0.22μm nitrocellulose membranes (Towbin et al., 1979). Membranes were incubated with antibodies directed against Pm vasa (1/4000), in 20mM Tris-HCl (pH7.6), 2% BSA, and 0.1% Tween-20, vtg1 (1/1000), vtg2 (1/1000), or tubulin (1/1000; Sigma) in Blotto; overnight at 4°C. The antigen-antibody complex was measured by chemiluminescence using horseradish peroxidase-coupled secondary antibodies according to the manufacturer’s instruction (ECL; GE Healthcare Biosciences, Pittsburgh, PA, USA). This experiment was performed twice with different parents, and the expressions of the proteins were quantified with Image J. Vasa polyclonal antibody was used as described (Juliano and Wessel, 2009). Rabbit polyclonal antibody was constructed against the peptide sequence INEPTEDMLDNILRC of Vitellogenin 2 from P. miniata and against the peptide sequence CEKVNPYEVTPEDPR of Vitellogenin 1 from P. miniata.

Highlights.

  1. Bisected sea star larvae regenerate normal larval tissues and functions in a rapid and predictable fashion.

  2. Broad cellular replication accompanies regeneration in bisected larvae

  3. Several genes were induced for over-expression in bisected larval fragments, including vasa, dysferlin, and vitellogenin

Acknowledgments

The authors thanks members of PRIMO for invigorating discussions, to Dr. Veronica Hinman for sharing pre-published data and for her insightful suggestions, and to the funding agencies for support (TRAIN 5T36GM101995 to Andrew Campbell and TO; an ASCB VP grant 5T36GM008622, to TO; NIH RO1 HD28152 to GMW; and a NSERC Discovery Grant 400230 to AH).

References

  1. Alie A, Leclere L, Jager M, Dayraud C, Chang P, Le Guyader H, Queinnec E, Manuel M. Somatic stem cells express Piwi and Vasa genes in an adult ctenophore: ancient association of “germline genes” with stemness. Dev Biol. 2011;350:183–197. doi: 10.1016/j.ydbio.2010.10.019. [DOI] [PubMed] [Google Scholar]
  2. Alvarado AS, Yamanaka S. Rethinking Differentiation: Stem Cells, Regeneration, and Plasticity. Cell. 2014;157:110–119. doi: 10.1016/j.cell.2014.02.041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Anderson JM. Studies on visceral regeneration in sea stars 1. Regeneration of pyloric caeca in Henricia leviuscula (Stimpson) Biological Bulletin. 1962;122:321-&. [Google Scholar]
  4. Arenas-Mena C, Cameron AR, Davidson EH. Spatial expression of Hox cluster genes in the ontogeny of a sea urchin. Development. 2000;127:4631–4643. doi: 10.1242/dev.127.21.4631. [DOI] [PubMed] [Google Scholar]
  5. Balser EJ. Cloning by ophiuroid echinoderm larvae. Biological Bulletin. 1998;194:187–193. doi: 10.2307/1543049. [DOI] [PubMed] [Google Scholar]
  6. Bely AE, Nyberg KG. Evolution of animal regeneration: re-emergence of a field. Trends Ecol Evol. 2010;25:161–170. doi: 10.1016/j.tree.2009.08.005. [DOI] [PubMed] [Google Scholar]
  7. Cheng XP, Zhang XL, Yu L, Xu HX. Calcium signaling in membrane repair. Seminars in cell & developmental biology. 2015;45:24–31. doi: 10.1016/j.semcdb.2015.10.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Covian-Nares JF, Koushik SV, Puhl HL, 3rd, Vogel SS. Membrane wounding triggers ATP release and dysferlin-mediated intercellular calcium signaling. J Cell Sci. 2010;123:1884–1893. doi: 10.1242/jcs.066084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Eaves AA, Palmer AR. Reproduction: widespread cloning in echinoderm larvae. Nature. 2003;425:146. doi: 10.1038/425146a. [DOI] [PubMed] [Google Scholar]
  10. Fresques T, Zazueta-Novoa V, Reich A, Wessel GM. Selective accumulation of germ-line associated gene products in early development of the sea star and distinct differences from germ-line development in the sea urchin. Developmental dynamics : an official publication of the American Association of Anatomists. 2014;243:568–587. doi: 10.1002/dvdy.24038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Goss RJ. Regeneration and Wound Healing Quarterly Review of Biology. 1965;40:389-&. doi: 10.1086/404538. [DOI] [PubMed] [Google Scholar]
  12. Haley SA, Wessel GM. The cortical granule serine protease CGSP1 of the sea urchin, Strongylocentrotus purpuratus, is autocatalytic and contains a low-density lipoprotein receptor-like domain. Developmental biology. 1999;211:1–10. doi: 10.1006/dbio.1999.9299. [DOI] [PubMed] [Google Scholar]
  13. Haley SA, Wessel GM. Regulated proteolysis by cortical granule serine protease 1 at fertilization. Molecular biology of the cell. 2004;15:2084–2092. doi: 10.1091/mbc.E03-11-0843. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hinman V, Nguyen A, Cameron R, Davidson E. Developmental gene regulatory network architecture across 500 million years of echinoderm evolution. PNAS USA. 2003;100:13356–13361. doi: 10.1073/pnas.2235868100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hinman VF, Jarvela AMC. Developmental gene regulatory network evolution: Insights from comparative studies in echinoderms. Genesis. 2014;52:193–207. doi: 10.1002/dvg.22757. [DOI] [PubMed] [Google Scholar]
  16. Huet M. Germinal line in Echinodermata - Origin and develoment of germ inal tissue in course of gonadal regeneration in sea star Asterina gibbosa (Penn) Journal of embryology and experimental morphology. 1974;31:787–806. [PubMed] [Google Scholar]
  17. Inoue C, Kiyomoto M, Shirai H. Germ cell differentiation in starfish: The posterior enterocoel as the origin of germ cells in Asterina pectinifera. Development Growth & Differentiation. 1992;34:413–418. doi: 10.1111/j.1440-169X.1992.00413.x. [DOI] [PubMed] [Google Scholar]
  18. Inoue C, Shirai H. Origin of germ cells and early differentiation of gonads in the starfish, Asterina pectinifera. Development Growth and Differentiation. 1991;33:217–226. doi: 10.1111/j.1440-169X.1991.00217.x. [DOI] [PubMed] [Google Scholar]
  19. Janies DA, Witter Z, Linchangco GV, Foltz DW, Miller AK, Kerr AM, Jay J, Reid RW, Wray GA. EchinoDB, an application for comparative transcriptomics of deeply-sampled clades of echinoderms. BMC Bioinformatics. 2016 doi: 10.1186/s12859-016-0883-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Juliano CE, Wessel GM. An evolutionary transition of Vasa regulation in echinoderms. Evol Dev. 2009;11:560–573. doi: 10.1111/j.1525-142X.2009.00362.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Katoh K, Standley DM. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Molecular Biology and Evolution. 2013;30:772–780. doi: 10.1093/molbev/mst010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kuraishi R, Osanai K. Contribution of maternal factors and cellular interaction to determination of archenteron in the starfish embryo. Development. 1994;120:2619–2628. [Google Scholar]
  23. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  24. Livingston BT, Wilt FH. Lithium evokes expression of vegetal-specific molecules in the animal blastomeres of sea-urchin embryos. Proceedings of the National Academy of Sciences of the United States of America. 1989;86:3669–3673. doi: 10.1073/pnas.86.10.3669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lyons RB, Weaver DD. Quantitative and histochemical analysis of alkaline phosphatase in adult tissues and larvae of the sea urchin, Strongylocentrotus purpuratus. American Zoologist. 1962;2:536–537. [Google Scholar]
  26. Maddison WP, Maddison DR. Mesquite: a modular system for evolutionary analysis. 2011 Version 2.75, build 564, http://mesquiteproject.org.
  27. McCauley BS, Akyar E, Filliger L, Hinman VF. Expression of wnt and frizzled genes during early sea star development. Gene Expr Patterns. 2013;13:437–444. doi: 10.1016/j.gep.2013.07.007. [DOI] [PubMed] [Google Scholar]
  28. Mladenov P, Bisgrove B, Asotra S, Burke R. Mechanisms of arm tip regeneration in the sea star Leptasterias hexactis. Roux’s Arch Dev Biol. 1989;198:19–28. doi: 10.1007/BF00376366. [DOI] [PubMed] [Google Scholar]
  29. Mochizuki K, Nishimiya-Fujisawa C, Fujisawa T. Universal occurrence of the vasa-related genes among metazoans and their germline expression in Hydra. Dev Genes Evol. 2001;211:299–308. doi: 10.1007/s004270100156. [DOI] [PubMed] [Google Scholar]
  30. Oulhen N, Onorato TM, Ramos I, Wessel GM. Dysferlin is essential for endocytosis in the sea star oocyte. Developmental biology. 2014a;388:94–102. doi: 10.1016/j.ydbio.2013.12.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Oulhen N, Onorato TM, Ramos I, Wessel GM. Dysferlin is essential for endocytosis in the sea star oocyte. Developmental biology. 2014b;388:94–102. doi: 10.1016/j.ydbio.2013.12.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Pek JW, Kai T. A role for vasa in regulating mitotic chromosome condensation in Drosophila. Curr Biol. 2011;21:39–44. doi: 10.1016/j.cub.2010.11.051. [DOI] [PubMed] [Google Scholar]
  33. Pfister D, De Mulder K, Hartenstein V, Kuales G, Borgonie G, Marx F, Morris J, Ladurner P. Flatworm stem cells and the germ line: developmental and evolutionary implications of macvasa expression in Macrostomum lignano. Dev Biol. 2008;319:146–159. doi: 10.1016/j.ydbio.2008.02.045. [DOI] [PubMed] [Google Scholar]
  34. Rao PS, Rao KH, Shyamasundari K. A rare condition of budding in bipinaria larva (Asteroidea) Current Science. 1993;65:792–793. [Google Scholar]
  35. Reich A, Dunn C, Akasaka K, Wessel G. Phylogenomic Analyses of Echinodermata Support the Sister Groups of Asterozoa and Echinozoa. Plos One. 2015:10. doi: 10.1371/journal.pone.0119627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Renault AD. vasa is expressed in somatic cells of the embryonic gonad in a sex-specific manner in Drosophila melanogaster. Biol Open. 2012;1:1043–1048. doi: 10.1242/bio.20121909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Schmittgen TD, Zakrajsek BA, Mills AG, Gorn V, Singer MJ, Reed MW. Quantitative reverse transcription-polymerase chain reaction to study mRNA decay: Comparison of endpoint and real-time methods. Analytical Biochemistry. 2000;285:194–204. doi: 10.1006/abio.2000.4753. [DOI] [PubMed] [Google Scholar]
  38. Schupbach T, Wieschaus E. Germline autonomy of maternal-effect mutations altering the embryonic body pattern of Drosophila. Dev Biol. 1986;113:443–448. doi: 10.1016/0012-1606(86)90179-x. [DOI] [PubMed] [Google Scholar]
  39. Stamatakis A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 2014;30:1312–1313. doi: 10.1093/bioinformatics/btu033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Swartz SZ, Chan XY, Lambert JD. Localization of Vasa mRNA during early cleavage of the snail Ilyanassa. Dev Genes Evol. 2008;218:107–113. doi: 10.1007/s00427-008-0203-6. [DOI] [PubMed] [Google Scholar]
  41. Technau U, Steele RE. Evolutionary crossroads in developmental biology: Cnidaria. Development. 2011;138:1447–1458. doi: 10.1242/dev.048959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Tomczyk S, Fischer K, Austad S, Galliot B. Hydra, a powerful model for aging studies. Invertebr Reprod Dev. 2015;59:11–16. doi: 10.1080/07924259.2014.927805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proceedings of the National Academy of Sciences of the United States of America. 1979;76:4350–4354. doi: 10.1073/pnas.76.9.4350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Vaughn D, Strathmann RR. Predators induce cloning in echinoderm larvae. Science. 2008;319:1503. doi: 10.1126/science.1151995. [DOI] [PubMed] [Google Scholar]
  45. Vickery M, McClintock J. Regeneration in metazoan larvae. Nature. 1998;394:140. [Google Scholar]
  46. Vickery M, Vickery M, McClintock J, Amsler C. Utilization of a novel deuterostome model for the study of regeneration genetics: molecular cloning of genes that are differentially expressed during early stages of larval sea star regeneration. Gene. 2001a;262:73–80. doi: 10.1016/s0378-1119(00)00554-0. [DOI] [PubMed] [Google Scholar]
  47. Vickery MC, Vickery MS, McClintock JB, Amsler CD. Utilization of a novel deuterostome model for the study of regeneration genetics: molecular cloning of genes that are differentially expressed during early stages of larval sea star regeneration. Gene. 2001b;262:73–80. doi: 10.1016/s0378-1119(00)00554-0. [DOI] [PubMed] [Google Scholar]
  48. Vickery MS, Vickery MCL, McClintock JB. Morphogenesis and organogenesis in the regenerating planktotrophic larvae of asteroids and echinoids. Biological Bulletin. 2002;203:121–133. doi: 10.2307/1543381. [DOI] [PubMed] [Google Scholar]
  49. Wessel GM, Fresques T, Kiyomoto M, Yajima M, Zazueta V. Origin and development of the germ line in sea stars. Genesis. 2014;52:367–377. doi: 10.1002/dvg.22772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Wessel GM, Reich AM, Klatsky PC. Use of sea stars to study basic reproductive processes. Systems biology in reproductive medicine. 2010;56:236–245. doi: 10.3109/19396361003674879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Winer J, Jung CKS, Shackel I, Williams PM. Development and validation of real-time quantitative reverse transcriptase-polymerase chain reaction for monitoring gene expression in cardiac myocytes in vitro. Analytical Biochemistry. 1999;270:41–49. doi: 10.1006/abio.1999.4085. [DOI] [PubMed] [Google Scholar]
  52. Yajima M, Wessel G. Broad functions for the “germ-line factor” vasa. Mol Reprod Dev. 2015a;82:405–405. [Google Scholar]
  53. Yajima M, Wessel GM. The DEAD-box RNA helicase Vasa functions in embryonic mitotic progression in the sea urchin. Development. 2011;138:2217–2222. doi: 10.1242/dev.065052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Yajima M, Wessel GM. Essential elements for translation: the germline factor Vasa functions broadly in somatic cells. Development. 2015b;142:1960–1970. doi: 10.1242/dev.118448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Zhou L, Wu S, Liu D, Xu B, Zhang X, Zhao B. Characterization and expression analysis of a trypsin-like serine protease from planarian Dugesia japonica. Mol Biol Rep. 2012;39:7041–7047. doi: 10.1007/s11033-012-1535-x. [DOI] [PubMed] [Google Scholar]

RESOURCES