Skip to main content
PLOS One logoLink to PLOS One
. 2016 Dec 21;11(12):e0169149. doi: 10.1371/journal.pone.0169149

Correction: First Demonstration of Antigen Induced Cytokine Expression by CD4-1+ Lymphocytes in a Poikilotherm: Studies in Zebrafish (Danio rerio)

Sohye Yoon, Suman Mitra, Cathy Wyse, Ayham Alnabulsi, Jun Zou, Eveline M Weerdenburg, Astrid M van der Sar, Difei Wang, Christopher J Secombes, Steve Bird
PMCID: PMC5176319  PMID: 28002434

The CD4-1-R primer sequence is listed incorrectly in S2 Table. The correct primer sequence is: 5'CTGGTCGGTCTTAAATGAAACT3'. Please see the correct S2 Table here.

Supporting Information

S2 Table. Primers used in real time PCR for gene expression in zebrafish.

(DOCX)

Reference

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S2 Table. Primers used in real time PCR for gene expression in zebrafish.

(DOCX)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES