The CD4-1-R primer sequence is listed incorrectly in S2 Table. The correct primer sequence is: 5'CTGGTCGGTCTTAAATGAAACT3'. Please see the correct S2 Table here.
Supporting Information
(DOCX)
Reference
- 1.Yoon S, Mitra S, Wyse C, Alnabulsi A, Zou J, Weerdenburg EM, et al. (2015) First Demonstration of Antigen Induced Cytokine Expression by CD4-1+ Lymphocytes in a Poikilotherm: Studies in Zebrafish (Danio rerio). PLoS ONE 10(6): e0126378 doi: 10.1371/journal.pone.0126378 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(DOCX)