ABSTRACT
Adult brain tumors establish an immunosuppressive tumor microenvironment as a modality of immune escape, with several immunotherapies designed to overcome this barrier. However, the relationship between tumor cells and immune cells in pediatric brain tumor patients is not as well-defined. In this study, we sought to determine whether the model of immune escape observed in adult brain tumors is reflected in patients with pediatric brain tumors by evaluating NKG2D ligand expression on tissue microarrays created from patients with a variety of childhood brain tumor diagnoses, and infiltration of Natural Killer and myeloid cells. We noted a disparity between mRNA and protein expression for the 8 known NKG2D ligands. Surprisingly, high-grade gliomas did not have increased NKG2D ligand expression compared to normal adjacent brain tissue, nor did they have significant myeloid or NK cell infiltration. These data suggest that pediatric brain tumors have reduced NK cell-mediated immune surveillance, and a less immunosuppressive tumor microenvironment as compared to their adult counterparts. These data indicate that therapies aimed to improve NK cell trafficking and functions in pediatric brain tumors may have a greater impact on anti-tumor immune responses and patient survival, with fewer obstacles to overcome.
KEYWORDS: Immune privilege, immune surveillance, immunosuppressive, NKG2D ligands, NK cells
Abbreviations
- AT/RT
atypical teratoid/rhaboid tumor
- CNS
central nervous system
- FBS
fetal bovine serum
- GBM
glioblastoma
- HGG
high-grade glioma
- IHC
immunohistochemistry
- LDH5
lactate dehydrogenase isoform 5
- LGG
low-grade glioma
- MIC
MHC class I chain
- MIC A
MIC-related gene A
- MIC B
MIC-related gene B
- NK
Natural Killer cell
- PBL
peripheral blood leukocyte
- PNET
primitive neuroectodermal tumor
- RBS
red blood cell
- TMA
tissue microarray
- ULBP
UL-16 binding proteins
- WHO
World Health Organization
Introduction
Tumors of the central nervous system (CNS) account for one fifth of childhood cancers, and are the most lethal solid tumors in children.1,2 The most frequently occurring tumors are astrocytoma, medulloblastoma, and ependymoma, which collectively account for about 60% of all pediatric brain tumors3, half of which are rapidly dividing high-grade tumors. High-grade pediatric tumors also include rarer or divergent diagnoses, such as primitive neuroectodermal tumor (PNET, WHO grade IV) and atypical teratoid/rhaboid tumor (AT/RT, WHO grade IV), accounting for <5% and 1% of all pediatric CNS tumors, respectively.4,5 Despite the aggressive nature of high-grade pediatric brain tumors, many of these cancer types respond well to treatment.6 Following standard of care therapy of tumor resection, chemotherapy, and radiation therapy, 70-80% of children diagnosed with average-risk medulloblastoma are disease-free 5 y after initial diagnosis.7,8 The most common form of low-grade glioma (LGG), pilocytic astrocytoma, has a cure rate of 90% following surgical resection.9 However, therapies that target rapidly dividing cells have a significant impact on developing organ systems in pediatric patients. In addition to damaging healthy tissues, the most successful treatment regimens are also associated with lasting side effects in 2-thirds of surviving patients, including neurocognitive damage, hearing loss, infertility, endocrinopathies, and a predisposition to secondary malignancies.10,11 Therefore, the development of novel therapies with fewer negative side effects would be of considerable benefit to pediatric brain tumor patients. Highly specific and minimally invasive treatment regimens may also improve outcomes of patients with treatment-resistant, multifocal, or metastatic disease.
Studies in both mice and humans demonstrate the importance of an intact immune system in preventing tumor growth.12-15 This balance between immune surveillance and tumor progression is known as immunoediting and consists of 3 phases: elimination, equilibrium, and escape.16,17 During the elimination phase, innate and adaptive immune cells recognize aberrant surface protein expression on transformed cells and specifically eliminate them.16,17 In adult patients with functioning immune systems, the elimination phase can last for decades and prevent the growth of a clinically significant tumor burden, making age the single greatest risk factor for cancer. However, it has been proposed that some tumor cells may evolve to avoid elimination, existing in equilibrium with the host immune system.16,17 During this phase, small numbers of tumor cells may completely escape immune surveillance and initiate the creation of a suppressive tumor microenvironment.18 This microenvironment is the product of changes in the expression of proteins that result in reduced immune cell activation, as well as the recruitment of cells that suppress immune cell functions,19-21 allowing establishment of a clinically significant tumor burden.
Natural Killer (NK) cells are cytotoxic effector cells of the innate immune system that play a significant role in the elimination of transformed cells. Tumor-mediated impairment of NK cell function may be critical to the control of tumor growth, as NK cell function correlates with survival in patients with solid tumors.22-24 Patients deficient in functional NK cells prematurely and rapidly progress through the stages of tumor development.25,26 Activation of NK cells can be induced through ligation of activating surface receptors, such as NKG2D.27-29 Cells undergoing stress, particularly viral infection or transformation, can express one or several of the ligands for NKG2D, which include MHC class I chain (MIC) related genes A and B (MIC A and MIC B) and the UL-16 binding proteins (ULBP) 1-6.30-32 Interaction of NKG2D with any one of these ligands is sufficient for NK cell activation, resulting in the secretion of pro-inflammatory cytokines, and the directed release of granules containing perforin and granzyme for cytolysis of NKG2D ligand-expressing cells.33,34
Mechanisms of immune escape are common to the most aggressive adult brain tumors, and impair tumor cell lysis by cells of both the innate and adaptive immune systems, particularly affecting cells responsible for killing tumor cells, such as NK cells. Successful immune escape of tumor cells in adult patients include the production of soluble factors by tumor cells, such as lactate dehydrogenase isoform 5 (LDH5), and TGFβ, that prevent NK cell functions mediated by the activating receptor NKG2D.35-41 Immune suppression by the tumor microenvironment is associated with poor survival and increased resistance to treatment,42,43 indicating that restoration of a functional immune system may improve adult patient outcomes. The mechanisms that govern immune surveillance and suppression in pediatric brain tumor patients, however, are poorly defined.
In this study, we sought to determine whether the model of immune escape observed in adult brain tumors is reflected in patients with pediatric brain tumors by interrogating pediatric patient-derived brain tumor tissue microarrays for NKG2D ligand expression and immune cell infiltration. In contrast to what is observed in adult brain tumor patients, NKG2D ligand expression in high-grade glioma (HGG) did not significantly differ from normal adjacent tissue isolated from brain tumor patients. Interestingly, none of the tumor types evaluated had extensive NK cell or myeloid cell infiltration as compared to normal adjacent tissue. Our data suggest that the tumor microenvironment in pediatric brain tumor patients is both less complex and less immunosuppressive than that of adult patients. Our future studies will evaluate whether increasing NK cell infiltration of pediatric brain tumor microenvironment impacts either tumor growth or NK cell functions.
Results
Expression of NKG2D ligand transcripts on frozen pediatric brain tumor samples
Pediatric LGG and HGG cases collectively account for roughly 40% of all childhood CNS tumors.1,2 In adult patients with gliomas, tumor grade is associated with increased NKG2D ligand expression,44,45 increased immune cell infiltration into the tumor,46,47 and the accumulation of redundant mechanisms of immune suppression.48-50 To determine the possible correlation between the grade of pediatric gliomas and expression of NKG2D ligands, we evaluated 5 LGG and 5 HGG human pediatric frozen tumor tissue samples for mRNA expression of NKG2D ligands (Fig. 1), and found transcriptional expression of all 8 NKG2D ligands in all samples analyzed. Similar to adult glioblastoma (GBM) frozen tumor samples,25 we found HGG samples to have an average 2.86-fold increase in ULBP-1 (Fig. 1A) and an average 1.71-fold increase in MIC B (Fig. 1H) transcripts as compared to LGG. Additionally, transcript expression of ULBP-2 was significantly increased in HGG relative to LGG tumor samples (average 5.60-fold increase) (Fig. 1B). In contrast, ULBP-4 transcript levels were significantly higher in LGG samples as compared to HGG (average 1.32-fold increase) (Fig. 1D). These data initially suggest a positive correlation between pediatric brain tumor grade and NKG2D ligand mRNA expression.
Figure 1.
NKG2D ligand transcript expression in pediatric low-grade and high-grade glioma samples. Frozen low-grade and high-grade pediatric tumor samples were analyzed for NKG2D ligand transcript expression (A-H). Tumor tissue samples were homogenized with mortar and pestle. mRNA was extracted from cell pellets using RNeasy Mini Kit (Miltenyi). RT-PCR was performed for cDNA synthesis, and qPCR was performed on cDNA samples 3 times in triplicate. Shown as mean +/− SD. Statistical analysis via unpaired t-test, * = p < 0.05.
Expression of NKG2D ligands on pediatric brain tumor TMA
Our data regarding the expression of NKG2D ligand mRNA is limited as it is based off of a small number of LGG and HGG patient samples (Fig. 1). Therefore, to evaluate NKG2D ligand protein expression in a larger patient cohort, we created 5 pediatric tissue microarrays (TMA) with the most common pediatric brain tumor diagnoses: ependymoma (TMA1); medulloblastoma (TMA2); HGG (WHO grade III and IV) (TMA3); AT/RT and PNET (TMA4); and LGG (WHO grade I) (TMA5) (see Figs. S1 and S2 for representative H&E staining; clinical sample details in Tables 2-6). In addition to addressing differences between transcript and protein expression in patient samples, TMA analysis of pediatric tumor tissue can reveal if NKG2D ligands are localized at the cell membrane, where they may interact with NKG2D expressed on immune cells, or in the extracellular space, suggesting ligand shedding or secretion. This information could expose similarities with adult brain tumors, which have been shown to impair NK cell activation through the downregulation of NKG2D by providing either a constitutive and desensitizing signal, or shedding NKG2D ligands into the tumor microenvironment.51-53
Table 2.
List of IHC antibodies used in this study.
| Antibody | Company | Number | Staining mode | Pre-treatment | Dilution | Incubation time | Incubation temp | Other conditions |
|---|---|---|---|---|---|---|---|---|
| NCR1 | Abcam | Ab14823 | Ventana | CC1 | 1:200 | 32 min | 37°C | A/B block |
| CD163 | Leica | NCL-L-CD163 | Ventana | CC1 | 1:200 | 32 min | 37°C | |
| MICA/B | Abcam | Ab54413 | Ventana | CC1 | 1:50 | 64 min | 37°C | |
| ULBP-1 | Atlas | HPA007547 | Ventana | CC1 | 1:100 | 32 min | 37°C | |
| ULBP-2/5/6 | R&D | AF1298 | hand stain | 1X citrate, 25 min | 1:50 | Overnight | Room temp | |
| ULBP-3 | Biorbyt | orb5602 | Ventana | CC1 | 1:200 | 32 min | 37°C | |
| ULBP-4 | R&D | MAB6285 | Ventana | CC1 | 1:1000 | 32 min | 37°C | A/B block |
| LDHA | ProteinTech | 19987-1-AP | Ventana | CC1 | 1:2000 | 32 min | 37°C | A/B block |
Table 3.
Ependymoma pediatric TMA.
| Patient | Cores per TMA | Diagnosis | Specific Diagnosis | WHO Grade |
|---|---|---|---|---|
| 1 | 2 | Ependymoma | Ependymoma | II |
| 2 | 2 | Control | Control | N/A |
| 3 | 2 | Ependymoma | Ependymoma | II |
| 4 | 2 | Ependymoma | Ependymoma | III |
| 5 | 2 | Ependymoma | Ependymoma | II |
| 6 | 2 | Ependymoma | Ependymoma | II |
| 7 | 2 | Ependymoma | Ependymoma | II |
| 8 | 2 | Ependymoma | Ependymoma with vascular proliferation and high Ki-67 | II |
| 9 | 2 | Ependymoma | Myxopapillary ependymoma | I |
| 10 | 2 | Ependymoma | Ependymoma | II |
| 11 | 2 | Ependymoma | Ependymoma | II |
| 12 | 2 | Ependymoma | Ependymoma | II |
| 13 | 2 | Ependymoma | Anaplastic ependymoma | III |
| 14 | 2 | Ependymoma | Anaplastic ependymoma | III |
| 15 | 2 | Ependymoma | Ependymoma | II |
| 16 | 2 | Ependymoma | Anaplastic ependymoma | III |
| 17 | 2 | Ependymoma | Ependymoma | II |
| 18 | 2 | Ependymoma | Ependymoma | II |
| 19 | 2 | Ependymoma | Ependymoma | II |
| 20 | 2 | Ependymoma | Ependymoma | II |
| 21 | 2 | Ependymoma | Ependymoma with vascular proliferation | II-III |
| 22 | 2 | Ependymoma | Ependymoma | II-III |
| 23 | 2 | Ependymoma | Ependymoma | II |
| 24 | 2 | Ependymoma | Ependymoma | II |
| 25 | 2 | Ependymoma | Ependymoma | II |
Table 4.
Medulloblastoma pediatric TMA.
| Patient |
Cores per TMA |
Diagnosis |
Specific Diagnosis |
WHO Grade |
| 1 | 3 | Medulloblastoma | Desmoplastic medulloblastoma | IV |
| 1 | 1 | Control | Control | N/A |
| 2 | 4 | Medulloblastoma | Medulloblastoma, desmoplastic/nodular type | IV |
| 3 | 4 | Medulloblastoma | Medulloblastoma, large cell, anaplastic | IV |
| 4 | 3 | Medulloblastoma | Medulloblastoma | IV |
| 4 | 1 | Control | Control | N/A |
| 5 | 4 | Medulloblastoma | Large cell medulloblastoma | IV |
| 6 | 2 | Medulloblastoma | Medulloblastoma | IV |
| 7 | 2 | Medulloblastoma | Medulloblastoma, desmoplastic/nodular type | IV |
| 8 | 2 | Medulloblastoma | Anaplastic medulloblastoma | IV |
| 9 | 4 | Medulloblastoma | Medulloblastoma with extensive nodularity and anaplasia | IV |
| 10 | 4 | Medulloblastoma | Medulloblastoma, desmoplastic/nodular type | IV |
| 11 | 2 | Medulloblastoma | Medulloblastoma | IV |
| 12 | 2 | Medulloblastoma | Large cell medulloblastoma | IV |
| 13 | 2 | Medulloblastoma | Medulloblastoma | IV |
| 14 | 2 | Medulloblastoma | Desmoplastic medulloblastoma | IV |
| 15 | 2 | Medulloblastoma | Medulloblastoma | IV |
| 16 | 2 | Medulloblastoma | Medulloblastoma | IV |
| 17 | 2 | Medulloblastoma | Medulloblastoma | IV |
| 18 | 2 | Medulloblastoma | Medulloblastoma | IV |
| 19 | 2 | Medulloblastoma | Medulloblastoma | IV |
| 20 | 2 | Medulloblastoma | Medulloblastoma | IV |
| 21 | 2 | Medulloblastoma | Medulloblastoma | IV |
| 22 | 2 | Medulloblastoma | Medulloblastoma with myogenic differentiation | IV |
| 23 | 2 | Medulloblastoma | Anaplastic medulloblastoma | IV |
| 24 | 2 | Medulloblastoma | Medulloblastoma, large cell/anaplastic variant | IV |
| 25 | 2 | Medulloblastoma | Desmoplastic medulloblastoma | IV |
| 26 | 2 | Medulloblastoma | Medulloblastoma | IV |
| 27 | 2 | Medulloblastoma | Medulloblastoma, desmoplastic/nodular type | IV |
| 28 | 2 | Medulloblastoma | Medulloblastoma | IV |
Table 5.
High grade glioma pediatric TMA.
| Patient | Cores per TMA | Diagnosis | Specific Diagnosis | WHO Grade |
|---|---|---|---|---|
| 1 | 2 | Glioblastoma multiforme | Glioblastoma multiforme | IV |
| 2 | 2 | Glioblastoma multiforme | Glioblastoma multiforme | IV |
| 3 | 2 | Glioblastoma multiforme | Glioblastoma multiforme | IV |
| 4 | 2 | Glioblastoma multiforme | Glioblastoma multiforme | IV |
| 5 | 3 | Anaplastic astrocytoma | Anaplastic astrocytoma | III |
| 6 | 2 | Glioblastoma multiforme | Glioblastoma multiforme | IV |
| 7 | 2 | Glioblastoma multiforme | Glioblastoma multiforme | IV |
| 8 | 2 | Anaplastic astrocytoma | Anaplastic astrocytoma | III |
| 9 | 2 | Anaplastic astrocytoma | Anaplastic astrocytoma with desmoplastic features | III |
| 10 | 2 | Anaplastic astrocytoma | Anaplastic astrocytoma with desmoplastic features | III |
| 11 | 2 | Glioblastoma multiforme | Astrocytoma (glioblastoma multiforme) | IV |
| 12 | 2 | Glioblastoma multiforme | Glioblastoma multiforme | IV |
| 13 | 2 | Anaplastic astrocytoma | Anaplastic astrocytoma | III |
| 14 | 2 | Anaplastic astrocytoma | Ganglioma with focal transformation to anaplastic astrocytoma | III |
| 15 | 2 | Glioblastoma multiforme | Glioblastoma multiforme | IV |
| 16 | 2 | Glioblastoma multiforme | Glioblastoma multiforme | IV |
| 17 | 2 | Glioblastoma multiforme | Glioblastoma multiforme | IV |
| 18 | 2 | Anaplastic astrocytoma | Anaplastic astrocytoma | III |
| 19 | 2 | Glioblastoma multiforme | Glioblastoma multiforme | IV |
| 20 | 2 | Anaplastic astrocytoma | Anaplastic astrocytoma | III |
| 21 | 2 | Anaplastic astrocytoma | Anaplastic astrocytoma | III |
| 22 | 2 | Glioblastoma multiforme | Glioblastoma multiforme with mixed astrocytic and oligodendroglial features | IV |
| 23 | 2 | Glioblastoma multiforme | Glioblastoma multiforme | IV |
| 24 | 2 | Glioblastoma multiforme | Morphological glioblastoma multiforme | IV |
| 25 | 2 | Anaplastic astrocytoma | Anaplastic astrocytoma | III |
| 26 | 4 | Glioblastoma multiforme | Glioblastoma multiforme | IV |
| 27 | 2 | Anaplastic astrocytoma | Anaplastic astrocytoma | III |
Table 6.
AT/RT and PNET pediatric TMA.
| Patient | Cores per TMA | Diagnosis | Specific Diagnosis | WHO Grade |
|---|---|---|---|---|
| 1 | 2 | PNET | Primitive neuroectodermal tumor | IV |
| 2 | 2 | PNET | Malignant neoplasm with PNET-like features | IV |
| 3 | 2 | PNET | Primitive neuroectodermal tumor | IV |
| 4 | 4 | PNET | Primitive neuroectodermal tumor | IV |
| 5 | 2 | PNET | Supratentorial primitive neuroectodermal differentiation | IV |
| 6 | 1 | PNET | High grade anaplastic tumor | IV |
| 7 | 3 | PNET | High grade anaplastic tumor | IV |
| 8 | 2 | PNET | Primitive neuroectodermal tumor with dyshistogenic brain | IV |
| 9 | 1 | PNET | Primitive neuroectodermal tumor | IV |
| 10 | 1 | PNET | Primitive neuroectodermal tumor | IV |
| 11 | 2 | PNET | Primitive neuroectodermal tumor | IV |
| 12 | 2 | PNET | High grade primitive tumor | IV |
| 13 | 2 | PNET | Primitive neuroectodermal tumor with divergent differentiation | IV |
| 14 | 4 | ATRT | Malignant rhabdoid tumor | IV |
| 15 | 2 | ATRT | Atypical teratoid/rhabdoid tumor | IV |
| 16 | 2 | ATRT | Atypical teratoid/rhabdoid tumor | IV |
| 17 | 2 | ATRT | Residual atypical teratoid/rhabdoid tumor | IV |
| 18 | 2 | ATRT | Recurrent/residual atypical teratoid/rhabdoid tumor | IV |
| 19 | 0 | ATRT | Residual atypical teratoid/rhabdoid tumor | IV |
| 19 | 2 | Control | Control | N/A |
| 20 | 2 | ATRT | Residual atypical teratoid/rhabdoid tumor | IV |
| 21 | 2 | ATRT | Atypical teratoid/rhabdoid tumor | IV |
| 22 | 3 | ATRT | Atypical teratoid/rhabdoid tumor | IV |
| 23 | 2 | ATRT | High grade tumor with malignant rhabdoid phenotype | IV |
| 24 | 3 | ATRT | Atypical teratoid/rhabdoid tumor | IV |
| 24 | 1 | Control | Control | N/A |
| 25 | 1 | ATRT | Rhabdoid tumor | IV |
| 25 | 3 | Control | Control | N/A |
| 26 | 2 | ATRT | Atypical teratoid/rhabdoid tumor | IV |
| 27 | 2 | ATRT | High grade malignant neoplasm | IV |
To determine the expression of soluble and membrane-associated expression of NKG2D ligands, TMAs were stained for expression of NKG2D ligands and analyzed using immunohistochemical (IHC) staining (Table 7; see Fig. S3 for representative staining). Quantification of the resulting images revealed LGG tissue expressed 2.54-fold more soluble, and 10.09-fold more membrane-associated ULBP-2/5/6 as compared to normal adjacent brain tissue control samples (Fig. 2A). Similarly, we found LGG to express 1.22-fold more soluble and 2.24-fold more membrane-associated ULBP-4 compared to control samples (Fig. 2B). Increased expression of NKG2D ligands by LGG tumors suggests that this grade may be the most likely to engage NKG2D and be the most visible to a patient's immune system, which is consistent with a good prognosis, resulting in over 90% 10-year survival for those patients following surgical resection of tumors.9
Table 7.
Low grade glioma pediatric TMA.
| Patient | Cores per TMA | Diagnosis | Specific Diagnosis | WHO Grade |
|---|---|---|---|---|
| 1 | 2 | Low grade glial | Glioma | I |
| 2 | 4 | Low grade glial | Glioma | I |
| 3 | 4 | Low grade glial | Glioma | I |
| 4 | 2 | Low grade glial | Glioma | I |
| 5 | 2 | Low grade glial | Glioma | I |
| 6 | 2 | Low grade glial | Glioma | I |
| 7 | 2 | Low grade glial | Glioma | I |
| 8 | 2 | Low grade glial | Glioma | I |
| 9 | 2 | Low grade glial | Glioma | I |
| 10 | 2 | Low grade glial | Glioma | I |
| 11 | 4 | Low grade glial | Glioma | I |
| 12 | 2 | Low grade glial | Glioma | I |
| 13 | 2 | Low grade glial | Glioma | I |
| 14 | 4 | Low grade glial | Glioma | I |
| 15 | 2 | Low grade glial | Glioma | I |
| 16 | 2 | Low grade glial | Glioma | I |
| 17 | 2 | Low grade glial | Glioma | I |
| 18 | 2 | Low grade glial | Glioma | I |
| 19 | 2 | Low grade glial | Glioma | I |
| 20 | 2 | Low grade glial | Glioma | I |
| 21 | 2 | Low grade glial | Glioma | I |
| 22 | 2 | Low grade glial | Glioma | I |
| 23 | 2 | Low grade glial | Glioma | I |
| 24 | 2 | Low grade glial | Glioma | I |
| 25 | 2 | Low grade glial | Glioma | I |
| 26 | 2 | Low grade glial | Glioma | I |
| 27 | 2 | Low grade glial | Glioma | I |
Figure 2.

Quantification of pediatric TMA IHC NKG2D ligand analysis. TMAs from 5 types of pediatric brain tumors were constructed and verified for validity by pathologist-reviewed H&E staining. TMAs were then stained for expression of the 8 NKG2D ligands (ULBP 1-6, MIC A, MIC B), and analyzed via immunohistochemistry (IHC). Each tissue core was captured by Nuance camera at 10X and analyzed using inForm software (Perkin Elmer). Control sample is normal adjacent brain tissue. (A) Mean OD of positive area and percent cells positive for ULBP-2/5/6. (B) Mean OD of positive area and percent cells positive for ULBP-4. Shown as mean +/− SD. Data was analyzed for statistical significance using One-way ANOVA in conjunction with Dunnet's post-test. * = p < 0.05; ** = p < 0.01; *** = p < 0.001.
Interestingly, medulloblastoma (12.22 +/− 20.07%), and AT/RT and PNET (7.63 +/− 12.60%) high grade tumors expressed significantly less membrane-associated ULBP-4 compared to control tissue (37.01 +/− 27.28%) (Fig. 2B). In contrast to frozen patient sample transcript analysis, TMA analysis of ULBP-1, ULBP-3, and MIC A/B protein expression did not yield significant differences between any tumor type and control tissue (see Fig. S4 for transcript analysis). This is not likely due to antibody insensitivity, as specific staining in some samples from each TMA was readily detectable for other antibodies (Fig. 2; see Fig. S4 for transcript analysis).
Collectively, these data suggest that LGG are the most likely to bind NKG2D on tumor-infiltrating NK cells as compared to other diagnoses investigated, which express lower amounts of NKG2D ligand proteins. Given the disparities between mRNA expression (Fig. 1) and protein expression (Fig. 2) in patient samples with various brain tumor diagnoses, future studies will determine molecular mechanisms that prevent robust NKG2D ligand expression. We hypothesize that higher-graded pediatric brain tumors have intrinsic mechanisms to evade NK cell detection by preventing NKG2D ligand protein expression, allowing tumor growth to be invisible to the immune system. Importantly, these features would allow tumors to grow unchecked without the need to establish the immunosuppressive cellular compartment of the tumor microenvironment that is so well studied in adult brain tumor patients.
Characterizing immune cell infiltration of pediatric brain tumor samples
It has recently been demonstrated that the central nervous system, once believed to be immune privileged, regularly interacts with the immune system through a distinct lymphatic structure.54 Demonstration of lymphatic system in the CNS clarified the mechanism described in many earlier studies showing rapid recruitment of immune cells during brain injury and infection.55-57 To determine whether pediatric brain tumors recruit immune cells for either surveillance or to promote an immunosuppressive tumor microenvironment, we investigated the infiltration of NK and myeloid cells. Interestingly, we found no significant NK cell or myeloid cell infiltration in any tumor tissue type as compared to control tissue (Fig. 3). In contrast to studies of adult brain tumor patients, these data suggest that pediatric brain tumors do not result in an infiltration of NK cells; indeed, it appears that tumor diagnosis, grade, and prognosis are independent of both suppressive myeloid cell recruitment and of impaired infiltrating NK cell immune surveillance.
Figure 3.

Quantitative analysis of infiltrating immune cells in pediatric TMAs by IHC. TMAs from 5 types of pediatric brain tumors were constructed and verified for validity by pathologist-reviewed H&E staining. TMAs were stained for the presence of immune infiltrating cells using antibodies directed against NCR1 (NK cells) and CD163 (myeloid cells), and then analyzed via IHC. Each tissue core was captured by Nuance camera at 10X and analyzed using inForm software (Perkin Elmer). Control samples are normal adjacent brain tissue. (A) Percent cells positive for NCR1 (NK cells). (B) Percent cells positive for CD163 (myeloid cells). Shown as mean +/− SD. Data was analyzed for statistical significance using One-way ANOVA in conjunction with Dunnet's post-test. * = p < 0.05; ** = p < 0.01; *** = p < 0.001.
To better understand the immune cells that infiltrate pediatric brain tumors, we characterized the phenotype of circulating and tumor-infiltrating immune cells isolated from freshly resected tumor tissue and matched blood of pediatric brain tumor patients using flow cytometry (see Fig. S5 for gating strategy). Following segregation of live immune cells from tumor cells by way of CD45 expression in concert with a Live/Dead dye, immune cells were delineated into myeloid cells, NK cells, and T cells using antibodies directed against CD14 and CD3 (see Fig. S5 for gating strategy). In a separate panel, myeloid cells were evaluated with antibodies directed against CD14 and CD33 (CD14+CD33+), and subclassified using antibodies directed against CD11b (an integrin commonly expressed on monocytes and macrophages) and HLA-DR (MHC class II surface receptor).58 (see Fig. S5 for gating strategy) Finally, we used the neural adhesion marker CD56, the carbohydrate epitope CD57, and the activating receptor NKG2D to characterize NK cell phenotypes (CD14-CD3-).59,60 (see Fig. S5 for gating strategy).
Analysis of circulating immune cells suggests that there may be significant differences not only between pediatric patients with low and high-grade brain tumors, specifically with ganglioglioma and anaplastic medulloblastoma, but also between pediatric and adult patients with the highest grade malignancies (Fig. 4). Although circulating NK cells in all patients were mostly CD56lo, a hallmark of increased cytotoxic capacity,61 the patient with Grade I ganglioglioma had a larger CD56hi population, which produces pro-inflammatory cytokines,62 as compared to both pediatric and adult Grade IV tumor patients (Fig. 4D). Also noteworthy is the decrease in CD11b and HLA-DR expression on myeloid cells found in the pediatric patient with Grade IV anaplastic medulloblastoma (Fig. 4F).
Figure 4.

Phenotypic comparison of peripheral blood lymphocytes between pediatric and adult patients. The phenotype of circulating lymphocytes from pediatric ganglioglioma (WHO grade I), pediatric anaplastic medulloblastoma (WHO grade IV), and adult glioblastoma (WHO grade IV) patients was assessed by flow cytometry. Representative plots showing (A) Percent CD45+ lymphocytes; (B) Delineation of myeloid cells, NK cells, and T cells using antibodies directed against CD14 and CD3; (C) Subgrouping of NK cells using antibodies directed against CD57 and NKG2D; (D) Subgrouping of NK cells using antibodies directed against CD56 and NKG2D; (E) Delineation of myeloid cells using antibodies directed against CD14 and CD33; and (F) Subgrouping of myeloid cells from CD14+CD33+ population using antibodies directed against CD11b and HLA-DR. Percent of population is listed for each gate.
When evaluating tumor-infiltrating leukocytes from these same patients, very few CD45+ cells were found to infiltrate anaplastic medulloblastoma tissue, whereas a substantial CD45+ population was found in low-grade ganglioglioma tissue (Fig. 5A). Analysis of ganglioglioma CD45+ cells showed the majority to be myeloid cells (96%), with small percentages of NK cells (2.12%) and T cells (1.26%) (Fig. 5B). Further delineation of these myeloid cells revealed that nearly all were CD11b+HLA-DR+ (97.6%, Fig. 5F). Despite expression of CD56 and CD57, NK cells were nearly devoid of NKG2D expression (4.13% and 10.9%, respectively) (Fig. 5C and D), suggesting that NK cells infiltrating pediatric tumors may not respond to NKG2D ligand protein expression. This is especially noteworthy when taken with the expectation that nearly 100% of circulating NK cells express NKG2D63, and the loss of NKG2D receptor expression in mouse models of cancer predisposes those animals to a variety of spontaneously arising tumors.64
Figure 5.

Phenotypic comparison of tumor-infiltrating lymphocytes between pediatric and adult patients. The phenotype of tumor-infiltrating lymphocytes from pediatric ganglioglioma (WHO grade I), pediatric anaplastic medulloblastoma (WHO grade IV), and adult glioblastoma (WHO grade IV) patients was assessed by flow cytometry. Representative plots showing (A) Percent CD45+ lymphocytes; (B) Delineation of myeloid cells, NK cells, and T cells using antibodies directed against CD14 and CD3; (C) Subgrouping of NK cells using antibodies directed against CD57 and NKG2D; (D) Subgrouping of NK cells using antibodies directed against CD56 and NKG2D; (E) Delineation of myeloid cells using antibodies directed against CD14 and CD33; and (F) Subgrouping of myeloid cells from CD14+CD33+ population using antibodies directed against CD11b and HLA-DR. Percent of population is listed for each gate.
These findings for pediatric WHO grade I tissue are in contrast to what we observe in adult glioblastoma WHO grade IV tissue (Fig. 5). Specifically, in adult GBM we find a small population of infiltrating CD45+ leukocytes (3.91%) (Fig. 5A), of which a large percentage of myeloid cells are CD11b+HLA-DR+ (72%) (Fig. 5F). NK cells present in adult glioblastoma tissue express low levels of NKG2D in both CD57+ and CD56+ subsets (33.4% and 28.2%, respectively) (Fig. 5C and D), which has been shown to significantly increase following surgical resection.25 While it is recognized that additional patient samples must be evaluated, these data not only highlight the differences in immune response to pediatric and adult brain tumors, but may also provide insight into experimental therapies aiming to promote immune cell activation in pediatric patients.
Collectively, these data reveal a complex regulation of NKG2D ligands by pediatric brain tumors. The lack of increased NKG2D ligand expression and minimal infiltration of NK cells in high-grade tumors, and a notable absence of NKG2D expression on NK cells infiltrating even low-grade gliomas suggest that NK cells may be an ideal population to evaluate for immune-based therapies for these patients. This is in contrast to the selective outgrowth of NKG2D ligand-deficient cells following NK cell infiltration and surveillance observed in adult brain tumors.65 Future experiments will determine the regulation of protein expression in these tumors, properties that govern which NKG2D ligands are expressed, and the impact of improving NK cell infiltration into tumors as a method to support traditional therapies. By improving NK cell functions and infiltration in aggressive pediatric brain tumors, we hypothesize that we can improve immune cell recognition of tumor cells, and improve the outcomes of patients undergoing standard of care therapies.
Discussion
Despite fundamental differences between adult and pediatric brain tumors,66-68 children often receive the same treatment modality as adults, which most frequently includes maximal surgical resection, radiation, steroids to reduce inflammation, and chemotherapy.69 One reason for this is the assumption that pediatric brain tumors establish a microenvironment that supports tumor immune escape. Our group has demonstrated that peripheral and tumor-infiltrating NK cells from adult glioblastoma (GBM, WHO grade IV) patients have decreased expression of NKG2D, and impaired cytotoxicity, compared to benign meningioma samples, despite the expression of NKG2D ligands on tumor cells.25 In these patients, tumor resection restores NKG2D expression on CD8 T cells and NK cells, as well as NKG2D-mediated tumor cell lysis.25 Subsequently, we and others demonstrated that in addition to glioblastoma tumor cells, myeloid cells recruited to the tumor microenvironment express NKG2D ligands in response to extracellular LDH5, resulting in decreased NK cell antitumor immunity through the depletion of perforin and granzyme, which are required for effective tumor cell lysis.45,70 Together, these studies indicate that reversal of NK cell suppression may improve anti-tumor immunity and reduce tumor burden. Recent clinical trials for patients with brain tumors indicate that activation of the immune system may provide some clinical benefit, although the mechanisms for this are poorly understood.71
Until recently, the CNS was classified as immune privileged, as a necessity to strictly regulate the infiltration and local activation of immune cells that may cause irreparable damage in response to immunological insults.72 However, in a striking study, Louveau and colleagues recently demonstrated novel lymphatic structures in the CNS.54 Their data show that circulating immune cells penetrate the blood brain barrier to perform routine immune surveillance of healthy tissue.54 This immune surveillance by circulating immune cells, particularly NK cells, can eliminate transformed cells as they arise, delaying the establishment of a tumor burden and the associated immunosuppressive tumor microenvironment.73,74 This study suggests that routine surveillance would prevent tumor growth in the absence of a suppressive tumor microenvironment, although this lymphatic structure has not yet been evaluated in the developing CNS of children.
Although we have shown both increased infiltration of NK cells and myeloid cells into the tumors of adult glioblastoma patients compared to control tissue,25 we found no significant difference in the frequency of NK cells or myeloid cells in the pediatric tumors that we evaluated. Other groups have also shown that there is no statistical difference in myeloid cells in pediatric glioblastoma and medulloblastoma brain tumors compared to non-tumor controls.75 Together, these data suggest that even aggressive pediatric brain tumors may not recruit suppressive immune cells. If the brain tumor microenvironment in pediatric patients is not as actively immunosuppressive as their adult counterparts, immune-based therapies for pediatric brain tumor patients may have fewer obstacles to overcome in order to successful eliminate tumors. Additional evaluation of unfixed patient tumor samples with a variety of diagnoses will determine whether persistence of malignant pediatric brain tumors is the result of poor trafficking of immune cells to the tumor site, and thus lack of immune surveillance.
Developers of immune-based therapies for pediatric brain tumor patients must also consider the immunosuppressive effects of standard of care therapies, including corticosteroids, radiation, and chemotherapy. Data are presented in this study with the caveat that a majority of the patients evaluated were on concomitant therapy that may impact immune cell populations. Therefore, immune based-therapies will ideally be administered in the absence of immunosuppressive treatments.
Interestingly, examination of pediatric glioma samples shows that transcriptional expression of NKG2D ligands only partially predicts protein abundance, suggesting intrinsic molecular mechanisms of the tumor cell that reduce NKG2D ligand expression, and therefore visibility to infiltrating NK cells. Previous studies demonstrate that highly expressed genes in cancer cells can have shorter 3’UTRs or fewer miRNA-binding sites, resulting in increased protein expression.76 Conversely, reduced protein expression may be the result of targeting of NKG2D ligand proteins for rapid degradation or restricted mRNA translation.76 Our future studies will confirm NKG2D ligand protein analysis in a larger cohort of patients and dissect the molecular mechanisms that reduce NKG2D mediated recognition of pediatric brain tumor cells.
Our findings support a model of immune privilege of the CNS in pediatric cancer patients that restricts immune cell infiltration in patients with high-grade malignancies, as opposed to a compromised blood brain barrier in adult patients that supports the creation of a suppressive tumor microenvironment. Future studies will dissect the mechanisms of immune cell infiltration into pediatric brain tumors, and the molecular mechanisms that govern tumor cell crosstalk with the developing immune system in pediatric patients. These studies will ultimately identify the most effective uses of patient immune cells for the treatment of brain tumors in children.
Materials and Methods
Acquisition and processing of human brain tissue and matched blood
Human tumor tissue and blood was acquired in accordance with guidelines set forth by Seattle Children's Research Institute Institutional Review Board (IRB #14412, approved 6/30/15). Tumor tissue was removed from the patient under sterile conditions in the operating room and placed on a saline-moistened Telfa pad in a sterile specimen cup that contained 40mL RPMI supplemented with 10% FBS. All tissues remained on ice until processed with < 2 hour ischemic time. Tissues were dissociated and tumor-infiltrating lymphocytes (TIL) were extracted using the Miltenyi Biotec Brain Tumor Dissociation Kit (P) according to the manufacturer's protocol (Miltenyi Biotec). The resulting cell pellet was resuspended in PBS, and aliquoted into a 96 well plate for phenotype analysis by flow cytometry.
Patient blood was obtained during surgery. Specifically, 3-6 mL of whole peripheral blood was drawn into BD Vacutainer Sodium Citrate Tubes or BD Vacutainer K2EDTA Tubes (Becton Dickinson, BD) through an intravenous line. Tubes were centrifuged at 750 xg for 5 minutes at room temperature; plasma was then removed and frozen at −80°C. The remaining blood product was placed in 1X Red Blood Cell (RBC) Lysis Buffer (eBioscience) (10 ml RBC Lysis Buffer per 1 ml blood product) for 10 minutes at room temperature. RBC lysis reaction was stopped with 20 ml 1x Phosphate Buffered Saline (PBS) and centrifuged at 750 xg for 5 minutes. The supernatant was removed and remaining peripheral blood leukocyte (PBL) pellet was resuspended in PBS, and aliquoted into a 96 well plate for phenotype analysis by flow cytometry.
RNA extraction and reverse transcriptase quantitative PCR
mRNA was extracted from frozen tissue (5 low-grade glioma, 5 high-grade glioma) using the RNeasy Mini Kit (Qiagen). Less than 30mg of sample was cut from the tumor over dry ice, and was kept frozen until homogenized using a mortar and pestle. cDNA was synthesized from total mRNA by oligo dT priming and SuperScript III reverse transcriptase (Life Technologies). PCR amplification was performed with Power SYBR Green PCR Master Mix (Life Technologies). Quantitative polymerase chain reactions were performed in triplicate on 3 separate days. Cq values were normalized to β-actin transcript expression and presented as relative expression units x 10,000. Data were collected and analyzed using the CFX96 Real Time System (BioRad Laboratories). Validated primers used are listed in Table 1.
Table 1.
Primers used in this study.
| Gene | Forward primer | Reverse primer |
|---|---|---|
| β Actin | GCCGACAGGATGCAGAAGGAG | AAGCATTTGCGGTGGACGATG |
| MIC A | ACAATGCCCCAGTCCTCCAGA | ATTTTAGATATCGCCGTAGTTCCT |
| MIC B | TGAGCCCCACAGTCTTCGTTA | CCTGCGTTTCTGCCTGTCATA |
| ULBP-1 | TGCAGGCCAGGATGTCTTGT | CATCCCTGTTCTTCTCCCACTTC |
| ULBP-2 | CCGCTACCAAGATCCTTCTGT | CGTGGTCCAGGTCTGAACTT |
| ULBP-3 | CTCGCGATTCTTCCGTACCT | TCTGGACCTCACACCACTGT |
| ULBP-4 | AGGGAATTCTTAGGGCACTGG | ATCGAGGACCACAGGTGAACA |
| ULBP-5 | TGTCCCCTGCGATCCAACTC | ATCCACCTGGCCTTGAACC |
| ULBP-6 | ATTTCATCTTCCAGGATCCACC | GGTCTGAACTTAGGGATGACGG |
Tissue microarrays
Tissue microarrays (TMA) were constructed from formalin-fixed paraffin-embedded brain tumors (11 primitive neuroectodermal tumors, 13 atypical teratoid/rhabdoid tumors, 27 medulloblastomas, 25 ependymomas, 25 high-grade gliomas, 25 low-grade gliomas) using 1.5 mm cores (Arraymold Kit B, Thermo Fisher Scientific). Two to 4 separate samples of tumor were included from each case and resulting quantification was averaged; uninvolved brain was included if available. Hematoxylin and eosin–stained sections from all tissue blocks were reviewed by a pathologist to confirm the reported histologic subtype and to define representative tumor areas to be included in the array.
Immunohistochemistry
Samples were stained according to the protocols listed in Table 2. A single image of each core of each TMA was captured using a Nikon Eclipse Ci (10x, 0.45NA) with a Nuance Multispectral Imaging System (Perkin Elmer) every 20nm from 420-720nm. Multispectral images were analyzed using InForm software (version 2.0.584, Perkin Elmer). Spectra for hematoxylin and 3,3’ Diaminobenzidine (DAB) were selected from positive control tissue (spleen). Configuration tools utilized were “Trainable tissue segmentation” and “Object segmentation." Trainable tissue segmentation was used to exclude white space in the field of view, and thus was excluded from analysis and percent area calculation. The trainable tissue segmenter used a large pattern scale with extra fine segmentation resolution, and successful training of the tool was >99%. Object segmentation parameters were set to identify objects in the tissue category using an object-based approach, which included a fixed scale optical density (OD) on DAB component (minimum = 0.110) and a minimum size of the object at 1 pixel with no maximum size. No cleanup metrics or edge rules were utilized in analyses.
Percent positive cells/field was calculated based on DAB positivity threshold set from positive control tissue, and hematoxylin staining. InForm software identified cell nuclei based on hematoxylin spectra, then calculated the number of cells above the DAB positivity threshold. Mean OD was calculated from only the area above the DAB positivity threshold set from positive control tissue. Negative tissue area was not averaged into the mean OD for the sample.
Phenotypic analysis of human tumor-infiltrating immune cells
Cells isolated from human brain tumor tissue and matched blood were surface stained with antibodies directed against CD45, CD3, CD33, CD56, CD57, CD11b, CD14, and NKG2D (all from BioLegend). LIVE/DEAD fixable dye (Thermo Fisher Scientific) was included to ensure analysis was only on viable cells. Myeloid cells were designated as CD45+CD14+CD3-, but were further delineated from a CD45+CD14+CD33+ population by CD11b and HLA-DR expression. NK cells were designated as CD45+CD14-CD3-, and further delineated by CD56, CD57, and NKG2D expression. Cells were fixed with 2% paraformaldehyde, and analyzed using the LSRFortessa (Becton Dickinson) and FlowJo software (Treestar).
Statistical analysis
Immunohistochemical stains were analyzed using a post hoc one-way ANOVA, after which each TMA was compared to the control samples only with a Dunnett's multiple comparison test. Transcript expression of NKG2D ligands in both pediatric cell lines and pediatric frozen tissue samples was analyzed via unpaired t-test. Statistical analyses were completed using Prism software (GraphPad Software).
Supplementary Material
Disclosure of potential conflicts of interest
No potential conflicts of interest were disclosed.
Funding
The authors would like to acknowledge the American Brain Tumor Association Discovery Grant and the Pediatric Brain Tumor Research Fund for funding this research.
References
- 1. Linabery AM, Ross JA. Trends in childhood cancer incidence in the U.S. (1992–2004). Cancer 2008; 112: 416-32; PMID:18074355; http://dx.doi.org/10.1002/cncr.23169 [DOI] [PubMed] [Google Scholar]
- 2. Ostrom QT, de Blank PM, Kruchko C, Petersen CM, Liao P, Finlay JL, Stearns DS, Wolff JE, Wolinsky Y, Letterio JJ, et al. Alex's lemonade stand foundation infant and childhood primary brain and central nervous system tumors diagnosed in the united states in 2007-2011. Neuro Oncol 2015; 16(Suppl 10):x1-x36; PMID:2554 2864,; http://dx.doi.org/10. 1093/neuonc/nou327 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Lau CT, Wan-Yee Epidemiology of central nervous system tumors in children. In: Poplack D, ed.: UpToDate, 2016. [Google Scholar]
- 4. Smoll NR, Drummond KJ. The incidence of medulloblastomas and primitive neurectodermal tumours in adults and children. J Clin Neurosci 2012; 19:1541-4; PMID:22981874; http://dx.doi.org/10.1016/j.jocn.2012.04.009 [DOI] [PubMed] [Google Scholar]
- 5. Woehrer A, Slavc I, Waldhoer T, Heinzl H, Zielonke N, Czech T, Benesch M, Hainfellner JA, Haberler C, Austrian Brain Tumor R. Incidence of atypical teratoid/rhabdoid tumors in children: a population-based study by the Austrian Brain Tumor Registry, 1996-2006. Cancer 2010; 116:5725-32; PMID:20737418; http://dx.doi.org/10.1002/cncr.25540 [DOI] [PubMed] [Google Scholar]
- 6. Nejat F, El Khashab M, Rutka JT. Initial management of childhood brain tumors: neurosurgical considerations. J Child Neurol 2008; 23:1136-48; PMID:18952580; http://dx.doi.org/10.1177/0883073808321768 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Gajjar A, Chintagumpala M, Ashley D, Kellie S, Kun LE, Merchant TE, Woo S, Wheeler G, Ahern V, Krasin MJ, et al. Risk-adapted craniospinal radiotherapy followed by high-dose chemotherapy and stem-cell rescue in children with newly diagnosed medulloblastoma (St Jude Medulloblastoma-96): long-term results from a prospective, multicentre trial. Lancet Oncol 2006; 7:813-20; PMID:17012043; http://dx.doi.org/10.1016/S1470-2045(06)70867-1 [DOI] [PubMed] [Google Scholar]
- 8. Packer RJ, Gajjar A, Vezina G, Rorke-Adams L, Burger PC, Robertson PL, Bayer L, LaFond D, Donahue BR, Marymont MH, et al. Phase III study of craniospinal radiation therapy followed by adjuvant chemotherapy for newly diagnosed average-risk medulloblastoma. J Clin Oncol 2006; 24:4202-8; PMID:16943538; http://dx.doi.org/10.1200/JCO.2006.06.4980 [DOI] [PubMed] [Google Scholar]
- 9. Burkhard C, Di Patre PL, Schuler D, Schuler G, Yasargil MG, Yonekawa Y, Lutolf UM, Kleihues P, Ohgaki H. A population-based study of the incidence and survival rates in patients with pilocytic astrocytoma. J Neurosurg 2003; 98:1170-4; PMID:12816259; http://dx.doi.org/10.3171/jns.2003.98.6.1170 [DOI] [PubMed] [Google Scholar]
- 10. Gore L, DeGregori J, Porter CC. Targeting developmental pathways in children with cancer: what price success? Lancet Oncol 2013; 14:e70-8; PMID:23369685; http://dx.doi.org/10.1016/S1470-2045(12)70530-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Schwartz CL. Long-term survivors of childhood cancer: the late effects of therapy. Oncologist 1999; 4:45-54; PMID:10337370 [PubMed] [Google Scholar]
- 12. Arina A, Murillo O, Hervas-Stubbs S, Azpilikueta A, Dubrot J, Tirapu I, Huarte E, Alfaro C, Perez-Gracia JL, Gonzalez-Aseguinolaza G, et al. The combined actions of NK and T lymphocytes are necessary to reject an EGFP+ mesenchymal tumor through mechanisms dependent on NKG2D and IFN gamma. Int J Cancer 2007; 121:1282-95; PMID:17520674; http://dx.doi.org/10. 1002/ijc.22795 [DOI] [PubMed] [Google Scholar]
- 13. Koebel CM, Vermi W, Swann JB, Zerafa N, Rodig SJ, Old LJ, Smyth MJ, Schreiber RD. Adaptive immunity maintains occult cancer in an equilibrium state. Nature 2007; 450:903-7; PMID:18026089; http://dx.doi.org/10.1038/nature06309 [DOI] [PubMed] [Google Scholar]
- 14. Penn I. Malignant melanoma in organ allograft recipients. Transplantation 1996; 61:274-8; PMID:8600636; http://dx.doi.org/10.1097/00007890-199601270-00019 [DOI] [PubMed] [Google Scholar]
- 15. Dunn GP, Koebel CM, Schreiber RD. Interferons, immunity and cancer immunoediting. Nat Rev Immunol 2006; 6:836-48; PMID:17063185; http://dx.doi.org/10.1038/nri1961 [DOI] [PubMed] [Google Scholar]
- 16. Dunn GP, Old LJ, Schreiber RD. The immunobiology of cancer immunosurveillance and immunoediting. Immunity 2004; 21:137-48; PMID:15308095; http://dx.doi.org/10.1016/j.immuni.2004.07.017 [DOI] [PubMed] [Google Scholar]
- 17. Kim R, Emi M, Tanabe K. Cancer immunoediting from immune surveillance to immune escape. Immunology 2007; 121:1-14; PMID:17386080; http://dx.doi.org/10.1111/j.1365-2567.2007.02587.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Swann JB, Vesely MD, Silva A, Sharkey J, Akira S, Schreiber RD, Smyth MJ. Demonstration of inflammation-induced cancer and cancer immunoediting during primary tumorigenesis. Proc Natl Acad Sci U S A 2008; 105:652-6; PMID:18178624; http://dx.doi.org/10.1073/pnas.0708594105 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Mukherji B, Wilhelm SA, Guha A, Ergin MT. Regulation of cellular immune response against autologous human melanoma. I. Evidence for cell-mediated suppression of in vitro cytotoxic immune response. J Immunol 1986; 136:1888-92; PMID:2419418 [PubMed] [Google Scholar]
- 20. Annunziato F, Cosmi L, Liotta F, Lazzeri E, Manetti R, Vanini V, Romagnani P, Maggi E, Romagnani S. Phenotype, localization, and mechanism of suppression of CD4(+)CD25(+) human thymocytes. J Exp Med 2002; 196:379-87; PMID:12163566; http://dx.doi.org/10.1084/jem.20020110 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Huang B, Pan PY, Li Q, Sato AI, Levy DE, Bromberg J, Divino CM, Chen SH. Gr-1+CD115 +immature myeloid suppressor cells mediate the development of tumor-induced T regulatory cells and T-cell anergy in tumor-bearing host. Cancer Res 2006; 66:1123-31; PMID:16424049; http://dx.doi.org/10.1158/0008-5472.CAN-05-1299 [DOI] [PubMed] [Google Scholar]
- 22. Camus M, Tosolini M, Mlecnik B, Pages F, Kirilovsky A, Berger A, Costes A, Bindea G, Charoentong P, Bruneval P, et al. Coordination of intratumoral immune reaction and human colorectal cancer recurrence. Cancer Res 2009; 69:2685-93; PMID:19258510; http://dx.doi.org/10.1158/0008-5472.CAN-08-2654 [DOI] [PubMed] [Google Scholar]
- 23. Lakshmikanth T, Burke S, Ali TH, Kimpfler S, Ursini F, Ruggeri L, Capanni M, Umansky V, Paschen A, Sucker A, et al. NCRs and DNAM-1 mediate NK cell recognition and lysis of human and mouse melanoma cell lines in vitro and in vivo. J Clin Invest 2009; 119:1251-63; PMID:19349689; http://dx.doi.org/10.1172/JCI36022 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Menard C, Blay JY, Borg C, Michiels S, Ghiringhelli F, Robert C, Nonn C, Chaput N, Taieb J, Delahaye NF, et al. Natural killer cell IFN-gamma levels predict long-term survival with imatinib mesylate therapy in gastrointestinal stromal tumor-bearing patients. Cancer Res 2009; 69:3563-9; PMID:19351841; http://dx.doi.org/10.1158/0008-5472.CAN-08-3807 [DOI] [PubMed] [Google Scholar]
- 25. Crane CA, Han SJ, Barry JJ, Ahn BJ, Lanier LL, Parsa AT. TGF-beta downregulates the activating receptor NKG2D on NK cells and CD8+ T cells in glioma patients. Neuro Oncol 2010; 12:7-13; PMID:20150362; http://dx.doi.org/10.1093/neuonc/nop009 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Imai K, Matsuyama S, Miyake S, Suga K, Nakachi K. Natural cytotoxic activity of peripheral-blood lymphocytes and cancer incidence: an 11-year follow-up study of a general population. Lancet 2000; 356:1795-9; PMID:11117911; http://dx.doi.org/10.1016/S0140-6736(00)03231-1 [DOI] [PubMed] [Google Scholar]
- 27. Lanier LL. Natural killer cell receptor signaling. Curr Opin Immunol 2003; 15:308-14; PMID:12787756; http://dx.doi.org/10.1016/S0952-7915(03)00039-6 [DOI] [PubMed] [Google Scholar]
- 28. Lanier LL. NK cell recognition. Ann Rev Immunol 2005; 23:225-74; PMID:15771571; http://dx.doi.org/10.1146/annurev.immunol.23.021704.115526 [DOI] [PubMed] [Google Scholar]
- 29. Lanier LL. Up on the tightrope: natural killer cell activation and inhibition. Nat Immunol 2008; 9:495-502; PMID:18425106; http://dx.doi.org/10.1038/ni1581 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Bauer S, Groh V, Wu J, Steinle A, Phillips JH, Lanier LL, Spies T. Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science 1999; 285:727-9; PMID:10426993; http://dx.doi.org/10.1126/science.285.5428.727 [DOI] [PubMed] [Google Scholar]
- 31. Salih HR, Goehlsdorf D, Steinle A. Release of MICB molecules by tumor cells: mechanism and soluble MICB in sera of cancer patients. Hum Immunol 2006; 67:188-95; PMID:16698441; http://dx.doi.org/10.1016/j.humimm.2006.02.008 [DOI] [PubMed] [Google Scholar]
- 32. Cosman D, Mullberg J, Sutherland CL, Chin W, Armitage R, Fanslow W, Kubin M, Chalupny NJ. ULBPs, novel MHC class I-related molecules, bind to CMV glycoprotein UL16 and stimulate NK cytotoxicity through the NKG2D receptor. Immunity 2001; 14:123-33; PMID:11239445; http://dx.doi.org/10.1016/S1074-7613(01)00095-4 [DOI] [PubMed] [Google Scholar]
- 33. Billadeau DD, Upshaw JL, Schoon RA, Dick CJ, Leibson PJ. NKG2D-DAP10 triggers human NK cell-mediated killing via a Syk-independent regulatory pathway. Nat Immunol 2003; 4:557-64; PMID:12740575; http://dx.doi.org/10.1038/ni929 [DOI] [PubMed] [Google Scholar]
- 34. Horng T, Bezbradica JS, Medzhitov R. NKG2D signaling is coupled to the interleukin 15 receptor signaling pathway. Nat Immunol 2007; 8:1345-52; PMID:17952078; http://dx.doi.org/10.1038/ni1524 [DOI] [PubMed] [Google Scholar]
- 35. Parsa AT, Waldron JS, Panner A, Crane CA, Parney IF, Barry JJ, Cachola KE, Murray JC, Tihan T, Jensen MC, et al. Loss of tumor suppressor PTEN function increases B7-H1 expression and immunoresistance in glioma. Nat Med 2007; 13:84-8; PMID:17159987; http://dx.doi.org/10.1038/nm1517 [DOI] [PubMed] [Google Scholar]
- 36. Brunet JF, Denizot F, Luciani MF, Roux-Dosseto M, Suzan M, Mattei MG, Golstein P. A new member of the immunoglobulin superfamily–CTLA-4. Nature 1987; 328:267-70; PMID:3496540; http://dx.doi.org/10.1038/328267a0 [DOI] [PubMed] [Google Scholar]
- 37. Wallick SC, Figari IS, Morris RE, Levinson AD, Palladino MA. Immunoregulatory role of transforming growth factor beta (TGF-beta) in development of killer cells: comparison of active and latent TGF-beta 1. J Exp Med 1990; 172:1777-84; PMID:2258706; http://dx.doi.org/10.1084/jem.172.6.1777 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Matsuda M, Salazar F, Petersson M, Masucci G, Hansson J, Pisa P, Zhang QJ, Masucci MG, Kiessling R. Interleukin 10 pretreatment protects target cells from tumor- and allo-specific cytotoxic T cells and downregulates HLA class I expression. J Exp Med 1994; 180:2371-6; PMID:7964510; http://dx.doi.org/10.1084/jem.180.6.2371 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Piccirillo CA, Shevach EM. Cutting edge: control of CD8+ T cell activation by CD4+CD25 +immunoregulatory cells. J Immunol 2001; 167:1137-40; PMID:11466326; http://dx.doi.org/10.4049/jimmunol.167.3.1137 [DOI] [PubMed] [Google Scholar]
- 40. Smyth MJ, Teng MW, Swann J, Kyparissoudis K, Godfrey DI, Hayakawa Y. CD4+CD25+ T regulatory cells suppress NK cell-mediated immunotherapy of cancer. J Immunol 2006; 176:1582-7; PMID:16424187; http://dx.doi.org/10.4049/jimmunol.176.3.1582 [DOI] [PubMed] [Google Scholar]
- 41. Weber JS, Rosenberg SA. Modulation of murine tumor major histocompatibility antigens by cytokines in vivo and in vitro. Cancer Res 1988; 48:5818-24; PMID:3139284 [PubMed] [Google Scholar]
- 42. Gajewski TF, Schreiber H, Fu Y-X. Innate and adaptive immune cells in the tumor microenvironment. Nat Immunol 2013; 14:1014-22; PMID:24048123; http://dx.doi.org/10.1038/ni.2703 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Jackson C, Ruzevick J, Phallen J, Belcaid Z, Lim M. Challenges in immunotherapy presented by the glioblastoma multiforme microenvironment. Clinical & developmental immunology 2011; 2011:732413-; PMID:22190972; http://dx.doi.org/10.1155/2011/732413 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Champsaur M, Lanier LL. Effect of NKG2D ligand expression on host immune responses. Immunol Rev 2010; 235:267-85; PMID:20536569; http://dx.doi.org/10.1111/j.0105-2896.2010.00893.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Crane CA, Austgen K, Haberthur K, Hofmann C, Moyes KW, Avanesyan L, Fong L, Campbell MJ, Cooper S, Oakes SA, et al. Immune evasion mediated by tumor-derived lactate dehydrogenase induction of NKG2D ligands on myeloid cells in glioblastoma patients. Proc Natl Acad Sci U S A 2014; 111:12823-8; PMID:25136121; http://dx.doi.org/10.1073/pnas.1413933111 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Gabrusiewicz K, Rodriguez B, Wei J, Hashimoto Y, Healy LM, Maiti SN, Thomas G, Zhou S, Wang Q, Elakkad A, et al. Glioblastoma-infiltrated innate immune cells resemble M0 macrophage phenotype. JCI Insight 2016. Feb 25; 1(2): e85841; PMID:26973881; http://dx.doi.org/10.1172/jci.insight.85841 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Donson AM, Birks DK, Schittone SA, Kleinschmidt-DeMasters BK, Sun DY, Hemenway MF, Handler MH, Waziri AE, Wang M, Foreman NK. Increased immune gene expression and immune cell infiltration in high-grade astrocytoma distinguish long-term from short-term survivors. J Immunol 2012; 189:1920-7; PMID:22802421; http://dx.doi.org/10.4049/jimmunol.1103373 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Waziri A. Glioblastoma-derived mechanisms of systemic immunosuppression. Neurosurg Clin N Am 2010; 21:31-42; PMID:19944964; http://dx.doi.org/10.1016/j.nec.2009.08.005 [DOI] [PubMed] [Google Scholar]
- 49. Wei J, Barr J, Kong LY, Wang Y, Wu A, Sharma AK, Gumin J, Henry V, Colman H, Sawaya R, et al. Glioma-associated cancer-initiating cells induce immunosuppression. Clin Cancer Res 2010; 16:461-73; PMID:20068105; http://dx.doi.org/10.1158/1078-0432.CCR-09-1983 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 50. Zou JP, Morford LA, Chougnet C, Dix AR, Brooks AG, Torres N, Shuman JD, Coligan JE, Brooks WH, Roszman TL, et al. Human glioma-induced immunosuppression involves soluble factor(s) that alters monocyte cytokine profile and surface markers. J Immunol 1999; 162:4882-92; PMID:10202033 [PubMed] [Google Scholar]
- 51. Groh V, Wu J, Yee C, Spies T. Tumour-derived soluble MIC ligands impair expression of NKG2D and T-cell activation. Nature 2002; 419:734-8; PMID:12384702; http://dx.doi.org/10.1038/nature01112 [DOI] [PubMed] [Google Scholar]
- 52. Coudert JD, Zimmer J, Tomasello E, Cebecauer M, Colonna M, Vivier E, Held W. Altered NKG2D function in NK cells induced by chronic exposure to NKG2D ligand-expressing tumor cells. Blood 2005; 106:1711-7; PMID:15886320; http://dx.doi.org/10.1182/blood-2005-03-0918 [DOI] [PubMed] [Google Scholar]
- 53. Coudert JD, Scarpellino L, Gros F, Vivier E, Held W. Sustained NKG2D engagement induces cross-tolerance of multiple distinct NK cell activation pathways. Blood 2008; 111:3571-8; PMID:18198346; http://dx.doi.org/10.1182/blood-2007-07-100057 [DOI] [PubMed] [Google Scholar]
- 54. Louveau A, Smirnov I, Keyes TJ, Eccles JD, Rouhani SJ, Peske JD, Derecki NC, Castle D, Mandell JW, Lee KS, et al. Structural and functional features of central nervous system lymphatic vessels. Nature 2015; 523:337-41; PMID:26030524; http://dx.doi.org/10.1038/nature14432 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55. Rivest S. Regulation of innate immune responses in the brain. Nat Rev Immunol 2009; 9:429-39; PMID:19461673; http://dx.doi.org/10.1038/nri2565 [DOI] [PubMed] [Google Scholar]
- 56. Dendrou CA, Fugger L, Friese MA. Immunopathology of multiple sclerosis. Nat Rev Immunol 2015; 15:545-58; PMID:26250739; http://dx.doi.org/10.1038/nri3871 [DOI] [PubMed] [Google Scholar]
- 57. Louveau A, Harris TH, Kipnis J. Revisiting the Mechanisms of CNS Immune Privilege. Trends Immunol 2015; 36:569-77; PMID:26431936; http://dx.doi.org/10.1016/j.it.2015.08.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58. Rudolph BM, Loquai C, Gerwe A, Bacher N, Steinbrink K, Grabbe S, Tuettenberg A. Increased frequencies of CD11b(+) CD33(+) CD14(+) HLA-DR(low) myeloid-derived suppressor cells are an early event in melanoma patients. Exp Dermatol 2014; 23:202-4; PMID:24495013; http://dx.doi.org/10.1111/exd.12336 [DOI] [PubMed] [Google Scholar]
- 59. Lanier LL. Of snowflakes and natural killer cell subsets. Nat Biotechnol 2014; 32:140-2; PMID:24509762; http://dx.doi.org/10.1038/nbt.2810 [DOI] [PubMed] [Google Scholar]
- 60. Nielsen CM, White MJ, Goodier MR, Riley EM. Functional Significance of CD57 Expression on Human NK Cells and Relevance to Disease. Front Immunol 2013; 4:422; PMID:24367364; http://dx.doi.org/10.3389/fimmu.2013.00422 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61. Lanier LL, Le AM, Civin CI, Loken MR, Phillips JH. The relationship of CD16 (Leu-11) and Leu-19 (NKH-1) antigen expression on human peripheral blood NK cells and cytotoxic T lymphocytes. J Immunol 1986; 136:4480-6; PMID:3086432 [PubMed] [Google Scholar]
- 62. Beziat V, Duffy D, Quoc SN, Le Garff-Tavernier M, Decocq J, Combadiere B, Debre P, Vieillard V. CD56brightCD16+ NK cells: a functional intermediate stage of NK cell differentiation. J Immunol 2011; 186:6753-61; PMID:21555534; http://dx.doi.org/10.4049/jimmunol.1100330 [DOI] [PubMed] [Google Scholar]
- 63. Andre P, Castriconi R, Espeli M, Anfossi N, Juarez T, Hue S, Conway H, Romagne F, Dondero A, Nanni M, et al. Comparative analysis of human NK cell activation induced by NKG2D and natural cytotoxicity receptors. Eur J Immunol 2004; 34:961-71; PMID:15048706; http://dx.doi.org/10.1002/eji.200324705 [DOI] [PubMed] [Google Scholar]
- 64. Guerra N, Tan YX, Joncker NT, Choy A, Gallardo F, Xiong N, Knoblaugh S, Cado D, Greenberg NM, Raulet DH. NKG2D-deficient mice are defective in tumor surveillance in models of spontaneous malignancy. Immunity 2008; 28:571-80; PMID:18394936; http://dx.doi.org/10.1016/j.immuni.2008.02.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65. Codo P, Weller M, Meister G, Szabo E, Steinle A, Wolter M, Reifenberger G, Roth P. MicroRNA-mediated down-regulation of NKG2D ligands contributes to glioma immune escape. Oncotarget 2014; 5:7651-62; PMID:25277195; http://dx.doi.org/10.18632/oncotarget.2287 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66. Merchant TE, Pollack IF, Loeffler JS. Brain tumors across the age spectrum: biology, therapy, and late effects. Semin Radiat Oncol 2010; 20:58-66; PMID:19959032; http://dx.doi.org/10.1016/j.semradonc.2009.09.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67. Diaz AK, Baker SJ. The genetic signatures of pediatric high-grade glioma: no longer a one-act play. Semin Radiat Oncol 2014; 24:240-7; PMID:25219808; http://dx.doi.org/10.1016/j.semradonc.2014.06.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68. Jones C, Perryman L, Hargrave D. Paediatric and adult malignant glioma: close relatives or distant cousins? Nat Rev Clin Oncol 2012; 9:400-13; PMID:22641364; http://dx.doi.org/10.1038/nrclinonc.2012.87 [DOI] [PubMed] [Google Scholar]
- 69. Fangusaro J. Pediatric high grade glioma: a review and update on tumor clinical characteristics and biology. Front Oncol 2012; 2:105; PMID:22937526; http://dx.doi.org/10.3389/fonc.2012.00105 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70. Husain Z, Huang Y, Seth P, Sukhatme VP. Tumor-derived lactate modifies antitumor immune response: effect on myeloid-derived suppressor cells and NK cells. J Immunol 2013; 191:1486-95; PMID:23817426; http://dx.doi.org/10.4049/jimmunol.1202702 [DOI] [PubMed] [Google Scholar]
- 71. Medicine UoPSo. Results from clinical trial of personalized cellular therapy in brain tumors: Investigational 'hunter' T cells expand in blood and traffic to glioblastoma tumors. In: Daily S, ed. Science Daily, 2016. [Google Scholar]
- 72. Ransohoff RM, Brown MA. Innate immunity in the central nervous system. J Clin Invest 2012; 122:1164-71; PMID:22466658; http://dx.doi.org/10.1172/JCI58644 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73. Fecci PE, Heimberger AB, Sampson JH. Immunotherapy for primary brain tumors: no longer a matter of privilege. Clin Cancer Res 2014; 20:5620-9; PMID:25398845; http://dx.doi.org/10.1158/1078-0432.CCR-14-0832 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74. Kim Y-H, Jung T-Y, Jung S, Jang W-Y, Moon K-S, Kim I-Y, Lee M-C, Lee J-J. Tumour-infiltrating T-cell subpopulations in glioblastomas. Br J Neurosurg 2012; 26:21-7; PMID:21707245; http://dx.doi.org/10.3109/02688697.2011.584986 [DOI] [PubMed] [Google Scholar]
- 75. Griesinger AM, Donson AM, Foreman NK. Immunotherapeutic implications of the immunophenotype of pediatric brain tumors. Oncoimmunology 2014; 3:e27256-e; PMID:24575386; http://dx.doi.org/10.4161/onci.27256 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76. Vogel C, Marcotte EM. Insights into the regulation of protein abundance from proteomic and transcriptomic analyses. Nat Rev Genet 2012; 13:227-32; PMID:22411467 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.

