Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2016 Dec 30;83(2):e02468-16. doi: 10.1128/AEM.02468-16

Extracellular Nucleases of Streptococcus equi subsp. zooepidemicus Degrade Neutrophil Extracellular Traps and Impair Macrophage Activity of the Host

Fang Ma a, Xiao Guo a, Hongjie Fan a,b,✉
Editor: Harold L Drakec
PMCID: PMC5203633  PMID: 27815272

ABSTRACT

The pathogen Streptococcus equi subsp. zooepidemicus is associated with a wide range of animals, including humans, and outbreaks frequently occur in pigs, equines, and goats. Thus far, few studies have assessed interactions between the host immune system and S. equi subsp. zooepidemicus and how these interactions explain the wide host spectrum of S. equi subsp. zooepidemicus. Neutrophils, the first line of innate immunity, possess a defense mechanism called neutrophil extracellular traps (NETs), which primarily consist of DNA and granule proteins that trap bacteria via charge interactions. Extracellular nucleases play important roles in the degradation of the DNA backbone of NETs. Here, two related extracellular nucleases, nuclease and 5′-nucleotidase (named ENuc and 5Nuc, respectively, in this study), were identified as being encoded by the SESEC_RS04165 gene and the SESEC_RS05720 gene (named ENuc and 5Nuc, respectively), and three related gene deletion mutant strains, specifically, the single-mutant ΔENuc and Δ5Nuc strains and the double-mutant ΔENuc Δ5Nuc strain, were constructed. The ΔENuc and Δ5Nuc single-mutant strains and the ΔENuc Δ5Nuc double-mutant strain demonstrated lower virulence than wild-type S. equi subsp. zooepidemicus when the mouse survival rate was evaluated postinfection. Furthermore, wild-type S. equi subsp. zooepidemicus more frequently traversed the bloodstream and transferred to other organs. Wild-type S. equi subsp. zooepidemicus induced fewer NETs and was able to survive in NETs, whereas only 40% of the ΔENuc Δ5Nuc double-mutant cells survived. S. equi subsp. zooepidemicus degraded the NET DNA backbone and produced deoxyadenosine, primarily through the action of ENuc and/or 5Nuc. However, the double-mutant ΔENuc Δ5Nuc strain lost the ability to degrade NETs into deoxyadenosine. Deoxyadenosine decreased RAW 264.7 cell phagocytosis to 40% of that of normal macrophages.

IMPORTANCE Streptococcus equi subsp. zooepidemicus causes serious bacteremia in its hosts. However, little is known about how S. equi subsp. zooepidemicus interacts with the host innate immune system, particularly innate cells found in the blood. S. equi subsp. zooepidemicus is capable of evading NET-mediated killing via the actions of its potent extracellular nucleases, ENuc and 5Nuc, which directly degrade the NET DNA backbone to deoxyadenosine. In previous studies, other pathogens have required the synergism of nuclease and 5′-nucleotidase to engage in this self-protective process; however, ENuc and 5Nuc both possess nuclease activity and 5′-nucleotidase activity, highlighting the novelty of this discovery. Furthermore, deoxyadenosine impairs phagocytosis but not the intracellular bactericidal activity of macrophages. Here we describe a novel mechanism for S. equi subsp. zooepidemicus extracellular nucleases in NET degradation, which may provide new insights into the pathogen immune evasion mechanism and the prevention and treatment of bacterial disease.

KEYWORDS: bacteremia, host-pathogen interactions, immune evasion, pathogenic mechanism, zoonoses

INTRODUCTION

Streptococcus equi subsp. zooepidemicus is a zoonotic pathogen belonging to Lancefield group C, which includes Streptococcus equi subsp. equi and Streptococcus equi subsp. ruminatorum. Streptococcus equi subsp. equi is an important horse pathogen causing strangles, a serious and highly contagious disease of the upper respiratory tract (1). S. equi subsp. zooepidemicus is thought to be the ancestor of Streptococcus equi subsp. equi and infects a wild range of animal species, including humans, who contract the disease through contact with infected animals and via consumption of contaminated dairy products (2, 3). Recent S. equi subsp. zooepidemicus outbreaks in Sweden (2009/2010) and Brazil (1997/1998) led to significant suffering and economic loss (4). The widespread nature of S. equi subsp. zooepidemicus may be related to its strong ability to evade the immune systems of its hosts.

Neutrophils are regarded as the first line of immune defense against bacterial infection (5) and kill microbes by releasing antimicrobial proteins into extracellular space via degranulation or by phagocytosing invading microbes (6, 7). However, neutrophils also kill pathogens by unleashing neutrophil extracellular traps (NETs) (8). NETs respond to bacteria, fungi, viruses, other chemical compounds, and even host factors such as activated platelets and interleukin-8 (IL-8). Upon neutrophil activation, the nuclear envelope disintegrates, and DNA fibers burst into extracellular space (9).

To survive in the host, many bacteria produce extracellular DNases, such as Sda1 of Streptococcus pyogenes and EndA of Streptococcus pneumoniae, to degrade the NET DNA backbone (10, 11). These enzymes allow bacteria to evade the host immune system. In recent years, the involvement of many extracellular nucleotidases in the interaction between NETs and bacteria has been identified. For example, adenosine synthase A (AdsA) of Staphylococcus aureus acts as a nucleotidase to convert NET degradation products into deoxyadenosine, which activates caspase-3-mediated apoptosis in macrophages and monocytes (12). However, few studies have assessed the interaction between NETs and S. equi subsp. zooepidemicus, and the mechanism underlying S. equi subsp. zooepidemicus-mediated bacteremia remains unclear.

Therefore, in this study, we aimed to assess the interaction between NETs and S. equi subsp. zooepidemicus to determine whether the actions of extracellular nucleases contribute to NET evasion and the spread of S. equi subsp. zooepidemicus in the host. Here, we found two genes, the SESEC_RS04165 gene and the SESEC_RS05720 gene (named ENuc and 5Nuc, respectively, in this study), encoding putative extracellular nucleases. ENuc is predicted to encode nuclease (ENuc), and 5Nuc is predicted to encode 5′-nucleotidase (5Nuc). The properties of the two related extracellular nuclease genes are characterized, and their roles in immune evasion are confirmed.

RESULTS

Determination and identification of ENuc and 5Nuc.

Seven genes in wild-type (WT) S. equi subsp. zooepidemicus are predicted to encode related extracellular nucleases according to a literature search in the NCBI database (see Table 2 for a list); however, it is unknown whether these genes are transcribed. Therefore, reverse transcription-quantitative PCR (qRT-PCR) was performed to study the transcriptional levels of these genes. mRNA expression levels at 2 h were set as 1-fold, and all 7 genes were transcribed during growth, particularly by 10 h (early in the stationary phase). However, the expression levels of ENuc and 5Nuc were significantly higher by 10 h (P < 0.001) than those of other nuclease genes. At 10 h, ENuc and 5Nuc transcription levels were 165 times and 67 times higher, respectively, than their transcription levels at 2 h (Fig. 1A).

TABLE 2.

Predicted genes encoding extracellular nucleases in S. equi subsp. zooepidemicus

Gene Producta Abbreviation
SESEC_RS04165 Nuclease ENuc
SESEC_RS05720 5′-Nucleotidase 5Nuc
SESEC_RS02695 CRISP-associated protein Cas4
SESEC_RS03220 DNA/RNA-nonspecific endonuclease
SESEC_RS04065 DNase
SESEC_RS04270 Competence-associated endonuclease
SESEC_RS05625 DNA/RNA-nonspecific endonuclease
a

Data information refers to the genomic information for Streptococcus equi subsp. zooepidemicus ATCC 35246 (NC_017582.1) in the NCBI database.

FIG 1.

FIG 1

Major nucleases and their virulence as determined by qRT-PCR and in a mouse survival assay. (A) Changes in the transcription of predicted extracellular nuclease genes measured by qRT-PCR during different growth phases of wild-type S. equi subsp. zooepidemicus (SEZ). S. equi subsp. zooepidemicus glyceraldehyde-3-phosphate dehydrogenase (GADPH) 16S rRNA was chosen as the internal control. The results are depicted as means ± standard deviations (SD) (n = 3). (B) Survival rates of mice challenged with wild-type S. equi subsp. zooepidemicus and 3 gene deletion mutants. During the first 72 h, all mice challenged with wild-type S. equi subsp. zooepidemicus died. At 84 h, mice challenged with the ΔENuc single-mutant strain began to die, and all mice were dead by 120 h. Mice challenged with the Δ5Nuc single-mutant strain began to die at 48 h postinfection, and almost 20% of mice survived by 148 h. Mice challenged with the ΔENuc Δ5Nuc double-mutant strain showed low mortality; approximately 50% survived by 148 h. The virulences of the three mutants and wild-type S. equi subsp. zooepidemicus were compared. ***, P < 0.001.

ENuc (2,781-bp open reading frame [ORF]; NCBI gene identification, SESEC_RS04165) and 5Nuc (2,007-bp ORF; NCBI gene identification, SESEC_RS05720) are uncharacterized genes encoding a nuclease and a 5′-nucleotidase, and their corresponding proteins are designated ENuc and 5Nuc, respectively. ENuc contains a Gram-positive coccus surface protein LPXTG motif, a signal peptide, and three predicted extracellular nuclease domains, including two motifs similar to the OB fold of Bacillus subtilis YhcR: a sugar-nonspecific nuclease (YhcR_OBF_like; accession, cd04486; E value = 2.72e−13 and 2.13e−12) and an exonuclease-endonuclease-phosphatase domain (accession, cl00490; E value = 4.48e−30). 5Nuc contains an LPXTG motif, a peptide, and two 5′-nucleotidase metallophosphatase domains in the amino-terminal region (accession, cl13995; E value = 1.26e−121) and a 5′-nucleotidase domain (accession, pfam02872; E value = 3.18e−32) in the carboxyl-terminal region. All data available from the NCBI were analyzed.

Virulence comparison.

The virulence of the three gene deletion mutants decreased to various degrees compared with that of WT S. equi subsp. zooepidemicus (P < 0.001). Half of the mice challenged with the ΔENuc Δ5Nuc double-mutant strain survived for 7 days postinfection. All mice in the WT S. equi subsp. zooepidemicus group died between 24 h and 72 h postinfection. In contrast, mice challenged with the ΔENuc single-mutant strain and the ΔENuc Δ5Nuc double-mutant strain exhibited no obvious symptoms during the first 3 days postinfection; however, all mice challenged with the ΔENuc single-mutant strain eventually died between 84 h and 120 h postinfection, suggesting that ENuc contributes to bacterial survival during the early stage of infection. Mice challenged with the Δ5Nuc single-mutant strain began to die at 48 h postinfection, and 20% of mice in the Δ5Nuc single-mutant strain group survived, indicating an important role for 5Nuc in bacterial proliferation during infection (Fig. 1B). Clearly, ENuc and 5Nuc are important virulence factors during S. equi subsp. zooepidemicus infection, and ENuc may play a role in early infection, while 5Nuc appears to be more active than ENuc. All mice challenged with phosphate-buffered saline (PBS) survived (these data are not shown in Fig. 1B).

Roles of ENuc and 5Nuc in NET entrapment evasion.

To study the functions of ENuc and 5Nuc, we cloned their two genes from the genome of WT S. equi subsp. zooepidemicus and ligated them into the vectors pET-32a(+) and pET-28a(+), respectively. Recombinant proteins were purified from Escherichia coli Rosetta. ENuc recombinant protein (rENuc) and 5Nuc recombinant protein (r5Nuc) both degraded calf thymus DNA within 1 h at 37°C. Notably, the ΔENuc Δ5Nuc double-mutant strain lost its ability to degrade calf thymus DNA compared with those of WT S. equi subsp. zooepidemicus and the ΔENuc and Δ5Nuc single-mutant strains (Fig. 2). Thus, the expression levels of ENuc and 5Nuc allow WT S. equi subsp. zooepidemicus to acquire the ability to degrade extracellular DNA.

FIG 2.

FIG 2

DNase activities of ENuc and 5Nuc. (A) ENuc and 5Nuc degrade calf thymus DNA. Banding indicates the remaining DNA, and lanes from left to right represent DNase I, reaction buffer, rENuc, and r5Nuc incubated with calf thymus DNA. (B) Wild-type S. equi subsp. zooepidemicus and the 3 mutants degrade calf thymus DNA. Lanes from left to right indicate the remaining DNA after calf thymus DNA was incubated with wild-type S. equi subsp. zooepidemicus, the ΔENuc and Δ5Nuc single-mutant strains, the ΔENuc Δ5Nuc double-mutant strain, reaction buffer, and DNase I.

Deoxyadenosine derived from the degradation of the NET DNA backbone is toxic to host immune cells. To determine whether ENuc and 5Nuc degrade DNA into deoxyadenosine, deoxyadenosine production was analyzed using reverse-phase high-performance liquid chromatography (rpHPLC). Recombinant proteins rENuc and r5Nuc degraded calf thymus DNA, which mimics the DNA backbone of NETs, and NET DNA and produced deoxyadenosine (Fig. 3A to G). WT S. equi subsp. zooepidemicus and the ΔENuc and Δ5Nuc single-mutant strains also produced deoxyadenosine following NET interaction, but the ΔENuc Δ5Nuc double-mutant strain did not (Fig. 3H to K). Additionally, the WT and the ΔENuc and Δ5Nuc single-mutant strains degraded calf thymus DNA to produce deoxyadenosine (see Fig. S1 in the supplemental material). Thus, ENuc and 5Nuc, which possess both nuclease activity and 5′-nucleotidase activity, appear to be the primary nucleases that allow S. equi subsp. zooepidemicus to evade entrapment by NETs.

FIG 3.

FIG 3

Production of deoxyadenosine detected by rpHPLC. (A) A standard deoxyadenosine sample (Sigma-Aldrich) was evaluated by rpHPLC. (B) Calf thymus DNA was evaluated by rpHPLC. (C and D) Deoxyadenosine production following the incubation of rENuc and r5Nuc with calf thymus DNA. (E) NETs derived from neutrophils induced by PMA were measured by rpHPLC. (F to K) Deoxyadenosine production after the incubation of NETs with rENuc, r5Nuc, wild-type S. equi subsp. zooepidemicus, the ΔENuc and Δ5Nuc single-mutant strains, and the ΔENuc Δ5Nuc double-mutant strain was determined by rpHPLC. The arrows indicate deoxyadenosine.

Recombinant proteins rENuc and r5Nuc both exhibited 5′-nucleotidase activity and hydrolyzed ATP, ADP, and AMP to produce adenosine (Fig. 4). Adenosine is an immunomodulatory molecule that suppresses neutrophil functions such as degranulation. Therefore, the ability of ENuc and 5Nuc to generate adenosine enhances the virulence of S. equi subsp. zooepidemicus.

FIG 4.

FIG 4

Hydrolysis of AMP, ADP, and ATP by ENuc and 5Nuc. (A and B) Standard adenosine and AMP samples were evaluated by rpHPLC. (C and D) AMP was hydrolyzed by rENuc and r5Nuc to generate adenosine. (E) Standard ADP sample. (F and G) Adenosine evaluated by rpHPLC as a product of rENuc and r5Nuc following incubation with ADP. (H) Standard ATP sample. (I and J) ATP was hydrolyzed by rENuc and r5Nuc to generate adenosine. The arrows indicate the adenosine produced.

Survival in different organs.

NET degradation contributes to S. equi subsp. zooepidemicus-induced bacteremia and spread to the organs from the blood. In particular, WT S. equi subsp. zooepidemicus showed a greater tendency to break through the blood barrier and cause bacteremia. At 24 h postinfection, only mice challenged with WT S. equi subsp. zooepidemicus demonstrated bacterial loads in the blood, lung, spleen, and liver, indicating that the mutant strains were less able to survive and cross the blood barrier. Mice challenged with the ΔENuc single-mutant strain showed bacterial loads at 48 h and 72 h, but mice challenged with the Δ5Nuc single-mutant strain only showed bacteria loads at 48 h, suggesting an increased tendency for single-mutant ΔENuc cells to spread to the organs from the blood. The nuclease activity of 5Nuc appears to be more potent than that of ENuc, which is consistent with the virulence of the ΔENuc and Δ5Nuc single-mutant strains. Importantly, at 72 h postinfection, mice challenged with the ΔENuc single-mutant strain demonstrated bacterial loads equivalent to those in mice challenged with WT S. equi subsp. zooepidemicus; however, at 96 h postinfection, WT S. equi subsp. zooepidemicus was better able to survive in organs such as the lung, liver, and spleen. Thus, WT S. equi subsp. zooepidemicus not only demonstrates a superior ability to transfer to organs but also impedes clearance by the host. Mice challenged with the ΔENuc Δ5Nuc double-mutant strain did not exhibit bacterial loads from 24 h to 96 h, suggesting that bacteria were killed by the host immune system at an early stage in the blood due to the lack of ENuc and 5Nuc (Fig. 5).

FIG 5.

FIG 5

Survival of wild-type S. equi subsp. zooepidemicus and the 3 mutant strains in different organs. Rows represent the time points postinfection for sample collection. Columns represent organs collected from infected mice. The results are depicted as means ± SD (n = 5). *, P < 0.05; **, P < 0.01; ***, P < 0.001; ns, no difference between groups.

Bactericidal capacity of NETs.

WT S. equi subsp. zooepidemicus resists killing by NETs. The bactericidal activity of NETs after incubation with WT S. equi subsp. zooepidemicus was negative, facilitating bacterial replication and increased numbers of WT S. equi subsp. zooepidemicus bacteria. However, approximately 30% of the ΔENuc single-mutant, 50% of the Δ5Nuc single-mutant, and 60% of the ΔENuc Δ5Nuc double-mutant cells were killed following incubation with NETs for 90 min (Fig. 6). In addition, the fibrous structure of the NET DNA backbone was only found in gene deletion mutant strains and NET concentrations induced by the ΔENuc and Δ5Nuc single-mutant strains were 2 and 5 times higher, respectively, than that induced by WT S. equi subsp. zooepidemicus. Importantly, NET concentrations induced by the ΔENuc Δ5Nuc double-mutant strain were more than 7 times higher than that induced by WT S. equi subsp. zooepidemicus (see Fig. S2 in the supplemental material). A weaker ability to induce NET formation by WT S. equi subsp. zooepidemicus than by gene deletion mutants may be attributed to the DNA degradation activities of ENuc and 5Nuc, which contribute to bacterial survival in NETs. Therefore, ENuc and 5Nuc play important roles in protecting bacteria against killing by NETs, aiding S. equi subsp. zooepidemicus proliferation and spread to deep tissues.

FIG 6.

FIG 6

NET survival capacity of wild-type S. equi subsp. zooepidemicus and its 3 mutants. Nearly all wild-type S. equi subsp. zooepidemicus cells survived and proliferated in the presence of NETs, whereas 30%, 50%, and 60% of the ΔENuc single-mutant, Δ5Nuc single-mutant, and ΔENuc Δ5Nuc double-mutant cells, respectively, were killed in the presence of NETs. The results are depicted as the means ± SD (n = 5). *, P < 0.05; **, P < 0.01.

Effects of deoxyadenosine on RAW 264.7 phagocytosis.

To evaluate the cytotoxic effects of the NET degradation product deoxyadenosine on immune cells, RAW 264.7 cells and neutrophils and monocytes obtained from blood were employed. Phagocytosis and the bactericidal capacity of RAW 264.7 pretreated with deoxyadenosine decreased by almost 60% (Fig. 7A). Surprisingly, in an intracellular killing assay, the intracellular killing activity of RAW 264.7 cells pretreated with deoxyadenosine was equivalent to that of RAW 264.7 cells without pretreatment (Fig. 7B). Thus, deoxyadenosine primarily impairs the phagocytosis of macrophages but does not affect the intracellular killing process. Furthermore, deoxyadenosine did not influence the bactericidal activity of monocytes (Fig. 7C).

FIG 7.

FIG 7

Effects of deoxyadenosine on RAW 264.7 phagocytosis. Deoxyadenosine(−) indicates control groups that were not treated with deoxyadenosine; deoxyadenosine(+) indicates groups that were pretreated with deoxyadenosine. (A) The percent bactericidal activity of the control group was set to 100%. The bactericidal activity of RAW 264.7 cells treated with deoxyadenosine decreased to 40%. (B) △1 h, △2 h, and △3 h indicate the intracellular bactericidal rates of RAW 264.7 cells between 1 and 2 h, 2 and 3 h, and 3 and 4 h after extracellular bacteria were killed. Bactericidal activities for the time ranges were compared. After 4 h, all intracellular bacteria were killed in both the control and treatment groups. (C) The bactericidal activity of monocytes was evaluated by determining the CFU of viable bacteria after incubation. The CFU of viable bacteria in the control group was set to 100%. The results are depicted as means ± SD (n = 5). ***, P < 0.001; ns, no differences between groups.

Effects of deoxyadenosine on neutrophil function.

To evaluate the effects of deoxyadenosine on neutrophils, two assays were designed. In the first, we tested the influence of deoxyadenosine on bacterial killing activity, and in the second, we tested the effects of deoxyadenosine on NET formation induced by phorbol myristate acetate (PMA). Based on the results of both assays, deoxyadenosine did not affect neutrophil function (Fig. 8). Purified neutrophils comprised greater than 90% of total cells, and viability was nearly 90% over 4 h in vitro in this study (see Fig. S3 in the supplemental material). Thus, our experiments were carried out with active and pure neutrophils, lending credibility to the results.

FIG 8.

FIG 8

Measurement of the effects of deoxyadenosine on neutrophil function. Deoxyadenosine(−) indicates control groups that were not treated with deoxyadenosine; deoxyadenosine(+) indicates treatment groups that were pretreated with deoxyadenosine. (A) The bactericidal activity of neutrophils was evaluated by determining the CFU of surviving bacteria after incubation. (B) PMA-stimulating NET formation by neutrophils was measured as the concentration of extracellular DNA, which was assessed with PicoGreen and is represented as relative fluorescence units (RFU). Resulted are depicted as means ± SD (n = 5). ns, no differences between groups.

DISCUSSION

This study was initially designed to identify the functions of the extracellular nucleases of S. equi subsp. zooepidemicus in the context of immune evasion and provide new ideas for future studies examining bacterial zoonosis. We assessed the interactions between S. equi subsp. zooepidemicus and NETs and observed the ability of S. equi subsp. zooepidemicus bacteria to evade entrapment and killing by NETs. Importantly, S. equi subsp. zooepidemicus possesses a potent ability to degrade NETs into deoxyadenosine, negatively influencing macrophage phagocytic activity. The production of extracellular nucleases by bacteria is a significant mechanism utilized by bacteria to escape NETs (13). In this work, we confirmed the identities of two primary extracellular nucleases by conducting a literature search of the NCBI database and performing qRT-PCR. Interestingly, recombinant proteins rENuc and r5Nuc demonstrated both nuclease and nucleotidase activities, allowing both to degrade NETs and produce deoxyadenosine. To further study the functions of these two enzymes, three gene deletion mutant strains, the ΔENuc and Δ5Nuc single-mutant strains and the ΔENuc Δ5Nuc double-mutant strain, were constructed. These mutants exhibited lower virulence and a weaker ability to spread from the blood to organs than the WT S. equi subsp. zooepidemicus strain; this was particularly the case for the two-gene deletion mutant ΔENuc Δ5Nuc strain. Half of the mice challenged with the ΔENuc Δ5Nuc double-mutant strain survived, while all of the mice in the WT S. equi subsp. zooepidemicus group were dead within 3 days. Thus, it appears difficult for ΔENuc Δ5Nuc double-mutant cells to exit the bloodstream. Despite the degradation of NETs by S. equi subsp. zooepidemicus, deoxyadenosine, a NET degradation product, may contribute to bacterial survival in the host; according to our results, deoxyadenosine suppresses macrophage phagocytosis. These two characteristics of S. equi subsp. zooepidemicus strongly contribute to its pathogenicity and proliferation in the host.

NETs constitute an important and novel innate immune defense system that influences pathogen invasion. Recently, this phenomenon was noted in several bacteria, including Staphylococcus aureus and Streptococcus pyogenes (14). In this study, when the genes ENuc and 5Nuc were knocked down simultaneously, S. equi subsp. zooepidemicus was less able to survive in NETs and better able to stimulate neutrophils to produce NETs, which indicated that ENuc and 5Nuc influenced S. equi subsp. zooepidemicus virulence. PMA is generally acknowledged to be an appropriate positive control when neutrophils are stimulated to produce NETs and was employed in this study in vitro (15). In previous studies examining the interactions between pathogens and NETs in the context of DNase, extracellular deoxyribonucleases protected pathogens by allowing them to evade entrapment by NETs; these include EndA produced by Streptococcus pneumoniae and Sda1 produced by Streptococcus pyogenes (16–19). The recombinant rENuc and r5Nuc proteins both degraded calf thymus DNA, a common substitute for the NET DNA backbone in laboratory research. Thus, ENuc and 5Nuc likely protect S. equi subsp. zooepidemicus from NET entrapment. In addition, high bacterial loads were only observed in mice challenged with WT S. equi subsp. zooepidemicus at 24 h postinfection; this may be attributable to the functions of ENuc and 5Nuc such that WT S. equi subsp. zooepidemicus not only survived in the host but also was able to spread to organs better than the mutant strains. Moreover, the Δ5Nuc single-mutant and ΔENuc Δ5Nuc double-mutant cells demonstrated difficulty in spreading to other organs from the blood, probably due to the deletion of 5Nuc. Thus, 5Nuc may be more active than ENuc. Importantly, mice challenged with the ΔENuc Δ5Nuc double-mutant strain demonstrated no bacterial loads, highlighting the importance and virulence of ENuc and 5Nuc. In summary, S. equi subsp. zooepidemicus degrades NETs and protects itself by evading entrapment by the host immune system, which may account for the differences in virulence between WT S. equi subsp. zooepidemicus, the ΔENuc and Δ5Nuc single-mutant strains, and the ΔENuc Δ5Nuc double-mutant strain.

Extracellular 5′-nucleotidases, such as AdsA of Staphylococcus aureus, produce adenosine, which is an immunomodulatory molecule (20, 21). However, Thammavongsa and colleagues noted cooperation between AdsA and a nuclease, facilitating the production of deoxyadenosine through the degradation of NET DNA. Deoxyadenosine induces macrophage apoptosis via caspase-3 activation, thereby restricting macrophage survival and promoting the establishment of infection (12). In this study, S. equi subsp. zooepidemicus degraded the NET DNA backbone and produced deoxyadenosine to suppress the phagocytosis of macrophages but did not negatively influence neutrophils and monocytes. Unexpectedly, both ENuc and 5Nuc demonstrated the ability to convert calf thymus DNA and NET DNA into deoxyadenosine as directly detected by rpHPLC. This mechanism differs from that observed in other pathogens such as Staphylococcus aureus and Streptococcus pyogenes because these pathogens possess NET-cleaving nucleases in addition to 5′-nucleotidases (20, 22, 23). In this study, S. equi subsp. zooepidemicus secreted two major extracellular enzymes, ENuc and 5Nuc, that degraded the DNA backbone of NETs and produced deoxyadenosine. Even with the deletion of either of their two genes, S. equi subsp. zooepidemicus was also able to degrade NETs into deoxyadenosine. However, when both genes were knocked out, S. equi subsp. zooepidemicus virulence decreased, and its ability to degrade NETs and generate deoxyadenosine was lost. Additionally, ENuc and 5Nuc possess the ability to hydrolyze AMP, ADP, and ATP to produce the immunomodulatory substrate adenosine, similar to Nt5e produced by Streptococcus sanguinis and AdsA produced by Staphylococcus aureus but unlike S5nA produced by Streptococcus pyogenes and NudP produced by Streptococcus agalactiae, which demonstrate limited specificity for AMP and ADP (21, 24, 25). Adenosine suppresses neutrophil activation by occupying the A2a receptor on neutrophils and promoting bacterial survival in the host bloodstream (26). Our data reveal a novel and potent mechanism in which extracellular nucleases degrade NETs and produce deoxyadenosine.

Deoxyadenosine is cytotoxic to macrophages. During infection with Staphylococcus aureus, deoxyadenosine production is sufficient to restrict macrophage survival and promote the establishment of persistent infection (12). The production of deoxyadenosine through the degradation of the DNA backbone of NETs is an important mechanism enabling bacterial survival. However, only a few studies have examined the functions of deoxyadenosine in immune cells. In this study, we investigated the influence of deoxyadenosine on macrophages, neutrophils, and monocytes and only observed negative effects on macrophage phagocytosis; however, deoxyadenosine did not affect the bactericidal activity of macrophages. Additionally, deoxyadenosine exerted no influence on the functions of neutrophils and monocytes. The molecular mechanism of deoxyadenosine underlying immune cell impairment will be explored in a future study.

In summary, S. equi subsp. zooepidemicus secretes two potent extracellular enzymes, ENuc and 5Nuc, each demonstrating nuclease and 5′-nucleotidase activities, which allow it to evade entrapment by degrading NETs, and producing the cytotoxic substrate deoxyadenosine to impair macrophage phagocytosis. This mechanism differs from a previously reported mechanism in which bacteria utilize nuclease in collaboration with 5′-nucleotidase to degrade NET DNA into deoxyadenosine. Our novel mechanism represents an ingenious method for bacteria to utilize host components for survival and simultaneously perturb host immune defenses. In addition, the two enzymes hydrolyze ATP, ADP, and AMP to produce the immunomodulatory substrate adenosine. Thus, ENuc and 5Nuc are novel and important virulence factors for S. equi subsp. zooepidemicus, and their identification will aid in the further study of immune evasion by zoonotic pathogens and contribute to the design of therapeutic agents.

MATERIALS AND METHODS

Bacterial strains, cells, and experimental animals.

The bacterial strains and plasmids used in this study are listed in Table 1. The wild-type S. equi subsp. zooepidemicus strain ATCC 35246 (here referred to as WT S. equi subsp. zooepidemicus) was purchased from the American Type Culture Collection (ATCC) and grown in Todd-Hewitt broth (THB) medium (Difco; BD, Franklin, NJ, USA) at 37°C on a gentle rocking shaker. Escherichia coli strains were grown in Luria-Bertani (LB) broth at 37°C. When necessary, antibiotics were used at the following concentrations to screen transformants: 100 μg/ml spectinomycin (Sigma-Aldrich, St. Louis, MO, USA) for S. equi subsp. zooepidemicus, 50 μg/ml spectinomycin for E. coli, 50 μg/ml ampicillin (Sigma-Aldrich) for E. coli, and 50 μg/ml kanamycin (Sigma-Aldrich) for E. coli. RAW 264.7 cells (ATCC TIB-71) were purchased from ATCC. The cells were cultured in Dulbecco's modified Eagle's medium (DMEM) (Wisent, Canada) supplemented with 10% fetal bovine serum at 37°C in 5% CO2.

TABLE 1.

Strains and plasmids used in this study

Bacterial strain or plasmid Notable characteristic(s)a Source or reference
S. equi subsp. zooepidemicus strains
    S. equi subsp. zooepidemicus ATCC 35246 Wild type isolated from infected pig Purchased from ATCC
    ΔENuc single mutant SESEC_RS04165 (ENuc) deletion mutant of S. equi subsp. zooepidemicus ATCC 35246 This study
    Δ5Nuc single mutant SESEC_RS05720 (5Nuc) deletion mutant of S. equi subsp. zooepidemicus ATCC 35246 This study
    ΔENuc Δ5Nuc double mutant ENuc and 5Nuc double gene deletion mutant of S. equi subsp. zooepidemicus ATCC 35246 This study
E. coli strains
    E. coli DH5a Plasmid cloning host and Gram-negative replicon Purchased from Invitrogen
    E. coli Rosetta E. coli plasmid-expressing host Purchased from Invitrogen
    E. coli Rosetta 32a-ENuc E. coli Rosetta carrying plasmid pET32a-ENuc, Ampr This study
    E. coli Rosetta 28a-5Nuc E. coli Rosetta carrying plasmid pET28a-5Nuc, Kmr This study
Plasmids
    pSET4s Streptococcus thermosensitive suicide vector, Spcr Takamatsu et al. (29)
    pSET4s-ΔENuc pSET4s containing the upstream and downstream sequences surrounding ENuc for deleting ENuc, Spcr This study
    pSET4s-Δ5Nuc pSET4s containing the upstream and downstream sequences surrounding 5Nuc for deleting 5Nuc, Spcr This study
    pET-32a(+) E. coli gene-expressing vector, Ampr Purchased from Invitrogen
    pET32a-ENuc pET-32a containing ENuc gene, Ampr This study
    pET-28a(+) E. coli gene-expressing vector, Kmr Purchased from Invitrogen
    pET28a-5Nuc pET-28a containing 5Nuc gene, Kmr This study
a

Ampr, ampicillin resistance cassette; Kmr, kanamycin resistance cassette; Spcr, spectinomycin resistance cassette.

Four-week-old female ICR (Institute of Cancer Research) specific-pathogen-free mice were purchased from the Comparative Medicine Center of Yangzhou University. All experimental protocols were approved by the Laboratory Animal Monitoring Committee of Jiangsu Province. Animals showing signs of illnesses were humanely euthanized with 100% CO2.

qRT-PCR analysis.

Total RNA was extracted from WT S. equi subsp. zooepidemicus in the logarithmic phase using TRIzol reagent (Gibco-BRL; Thermo Fisher Scientific, Waltham, MA, USA). Briefly, the bacteria were washed 3 times with phosphate-buffered saline (PBS). One milliliter of TRIzol solution was added to the bacterial precipitate, which was shaken for 15 s to lyse the bacterial cells; after that, 200 μl of chloroform was added. The mixture stood at room temperature for 2 min and was then centrifuged at 12,000 × g for 15 min. Two hundred microliters of the upper phase (avoiding the middle layer containing DNA) was collected, and 500 μl of isopropyl alcohol was added to precipitate the RNA. The suspension was centrifuged to collect the RNA and washed twice with 75% ethanol. Seven genes predicted to encode extracellular nucleases were chosen based on genomic information for Streptococcus equi subsp. zooepidemicus ATCC 35246 (NC_017582.1) in the NCBI database. qRT-PCR was performed to determine the transcript concentrations of these 7 predicted extracellular nuclease genes: ENuc, 5Nuc, SESEC_RS02695, SESEC_RS03220, SESEC_RS04065, SESEC_RS04270, and SESEC_RS05625 (Table 2). All primers used are listed in Table 3. The results were analyzed using the 2−ΔΔCT method.

TABLE 3.

Primers used in this study

Primer Sequence (5′ to 3′)a Restriction enzyme
Fl-ENucF TCACTGGCTGCTGAGTTTATT
Fl-ENucR CGGCTGAACACGTCCATATAA
Fl-5NucF TCAGTCAAGGTGGGCTTTATC
Fl-5NucR CCACTCTAGGCAACCATCTTC
Fl-Nuc1F GCTTGGGTCTGTATGGGATTAT
Fl-Nuc1R CCACTCTAGGCAACCATCTTC
Fl-Nuc2F CTGGAGTGCTTTCGTCTGTAATA
Fl-Nuc2R TACCAATATGGCGGCATCAG
Fl-Nuc3F GCATTCCTGTGCGGTAATCTA
Fl-Nuc3R CAAATTGGGAGGCAACAAAGAA
Fl-Nuc4F CTTCTAGGCTATGCGCTTGTT
Fl-Nuc4R CTCTCGTTAGCTGCTTGGTTAG
Fl-Nuc5F ATTACCAATCCAGCCAGAAGG
Flu-Nuc5R CAGGTCGCAAGAGGAACAATA
ENucF CGCGGATCCCAGTCTTCAGCTCAGCATGTTTATG BamHI
ENucR GCCCTCGAGGCTTCCTTTCCTGACGTTTCCTA XhoI
ENuc-L-F GCCGGATCCAGCTTAGCTCGTTATGGAAGAGTGT BamHI
ENuc-L-R AAAGAAATCCTTTACTTCCTTTCCTTTGACATAAAAACTCCTTTTTAATG
ENuc-R-F CATTAAAAAGGAGTTTTTATGTCAAAGGAAAGGAAGTAAAGGATTTCTTT
ENuc-R-R GCCGTCGACTCTACCACGTTTGTAATATGCTTGG SalI
5NucF CGCGGATCCGATCAGGTAGACGTGCAATTTCTTG BamHI
5NucR GCCCTCGAGTTATAAGGCAGCATTAGCTTGCTTT XhoI
5Nuc-L-F GCCGGATCCGGAATAATAAAAGCAATCATACCAC BamHI
5Nuc-L-R GCCGGTTTTATTGGCCTTCCTTTTTAAACAAAATGCTTTTTCATAAACGC
5Nuc-R-F GCGTTTATGAAAAAGCATTTTGTTTAAAAAGGAAGGCCAATAAAACCGGC
5Nuc-R-R GCCGTCGACTCATCGATTGTATGACATCATGAAG SalI
a

Restriction enzyme sites are underlined.

Cloning and purification of recombinant ENuc and 5Nuc.

Cloning and purification of the recombinant protein ENuc (rENuc) were performed as previously described (27). ENuc was cloned by PCR using the primers ENucF and ENucR (Table 3) and the WT S. equi subsp. zooepidemicus genome as a template. The cloned ENuc was digested with BamHI and XhoI and cloned into the pET-32a(+) vector (Invitrogen; Thermo Fisher Scientific, Waltham, MA, USA). After sequencing (Shanghai Sunny Biotechnology Co., Ltd., China), the recombinant plasmid pET32a-ENuc was transformed into E. coli Rosetta cells with ampicillin selection. The recombinant E. coli was incubated at 37°C until the exponential growth phase was reached, and then protein expression was induced for 6 h with the addition of 0.1 mM isopropyl-β-d-thiogalactopyranoside (Sigma-Aldrich). Cells were harvested, washed, and suspended in ice-cold binding buffer (20 mM Tris, 200 mM NaCl [pH 7.4]).

Protein purification procedures were performed at 4°C. Bacteria were homogenized by ultrasonication for 30 min. The resulting crude extract was centrifuged at 10,000 × g for 30 min. Recombinant rENuc were purified using a 1-ml Ni Sepharose 6 Fast Flow column (GE Healthcare, Uppsala, Sweden). 5Nuc was cloned into the pET-28a(+) vector (Invitrogen) to improve its expression; purification of 5Nuc recombinant protein (r5Nuc) was performed as mentioned above.

Construction of gene deletion mutants.

The construction of ENuc and 5Nuc single-gene deletion mutants (here called ΔENuc and Δ5Nuc, respectively) and double-gene deletion mutant (ΔENuc Δ5Nuc) was performed as previously described (28). Briefly, the upstream and downstream sequences surrounding ENuc were amplified from WT S. equi subsp. zooepidemicus chromosomal DNA using the primer combinations ENuc-L-F/ENuc-L-R and ENuc-R-F/ENuc-R-R (Table 3). The upstream and downstream flanking sequences of ENuc were ligated between the SalI and BamHI sites of the thermosensitive suicide vector pSET4s to yield the recombinant plasmid pSET4s-ΔENuc, which was electroporated into WT S. equi subsp. zooepidemicus (29). The plasmid pSET4s-ΔENuc and the bacterial genome exchanged genetic fragments twice via intermolecular recombination. Putative deletion mutants were screened by PCR performed with the primer combination ENucF/ENucR (Table 3). The Δ5Nuc single-mutant strain was constructed on the WT S. equi subsp. zooepidemicus background using the process mentioned above, and the ΔENuc Δ5Nuc double-mutant strain was constructed using the same process on the ΔENuc background.

Isolation and purification of neutrophils.

Murine neutrophils were isolated from fresh, heparinized venous blood of healthy ICR mice as previously described, with some modifications (30). Briefly, whole blood was centrifuged at 400 × g for 30 min, and then the top layer of plasma was discarded. Red blood cells were treated with lysis buffer (Tris-NH4Cl). White blood cells were suspended in 0.85% NaCl. Three milliliters of 65% Percoll was gently overlaid in a 15-ml tube (BD Falcon), followed by a 3-ml layer of 55% Percoll; finally, the cell suspension was carefully overlaid as the top layer. The Percoll gradient was centrifuged at 1,000 × g for 30 min, and the cells at the plasma interface were carefully removed and discarded. The cells between the 55% and 65% Percoll layers were collected, washed in RPMI 1640 medium (Gibco), and resuspended in RPMI 1640 medium. Neutrophil purity was confirmed by performing flow cytometry, and cell viability was detected by performing trypan blue staining and counting cells in a chamber slide (Invitrogen).

Isolation and purification of monocytes from blood.

Blood from the ICR mice was diluted in PBS and overlaid on a Histopaque 1077 solution (Sigma-Aldrich) via gradient centrifugation at 400 × g for 20 min (31). The upper layer was aspirated, and monocytes were enriched in the interphase. Then, the cells were washed with PBS, suspended in RPMI 1640, and seeded into 24-well plates for further study.

Mouse survival assay.

A mouse survival assay was carried out to assess the virulence of WT S. equi subsp. zooepidemicus, the ΔENuc and Δ5Nuc single-mutant strains, and the ΔENuc Δ5Nuc double-mutant strain. Fifty ICR mice were divided into 5 groups, with 10 mice in each group. The positive group was challenged with WT S. equi subsp. zooepidemicus at a dose of 105 CFU via intraperitoneal injection. The experimental groups were challenged with 105 CFU of the ΔENuc and Δ5Nuc strains and the ΔENuc Δ5Nuc double-mutant strain via intraperitoneal injection. The negative-control group was challenged with PBS. The symptoms of the mice were documented for 7 days postinfection.

Bacterial dissemination assay.

Bacterial dissemination was evaluated as described previously (32). Mice were inoculated with 104 CFU of WT S. equi subsp. zooepidemicus, the ΔENuc and Δ5Nuc single-mutant strains, and the ΔENuc Δ5Nuc double-mutant strain, with 5 mice in each group, via intravenous injection into the caudal vein to ensure the direct interaction of bacteria and neutrophils; this dose of bacteria causes asymptomatic infection. Bacterial burdens were enumerated in the blood, liver, lung, and spleen at 24 h, 48 h, 72 h, and 96 h to evaluate bacterial proliferation. At each time point, mice were euthanized. Livers, spleens, lungs, and blood were harvested, weighed, and homogenized in 1 ml of PBS. After that, the mixture was serially diluted and plated on THB agar plates.

NET bactericidal assays.

Bactericidal assays were carried out to compare the survival abilities of WT S. equi subsp. zooepidemicus, the ΔENuc and Δ5Nuc single-mutant strains, and the ΔENuc Δ5Nuc double-mutant strain in the presence of NETs, as described elsewhere (33). For the NET bactericidal assays, neutrophils were activated with phorbol myristate acetate (PMA) (Sigma-Aldrich) for 3 h, after which cytochalasin B (Sigma-Aldrich) was added to a final concentration of 10 μg/ml to suppress cell phagocytosis. WT S. equi subsp. zooepidemicus bacteria and the three mutant strains were grown to the logarithmic phase in THB, washed 3 times with sterile PBS, and added to neutrophils at an multiplicity of infection (MOI) of 100 at 37°C under a 5% CO2 atmosphere. After incubation for 90 min, the remaining neutrophils were lysed with 0.02% Triton X-100 (Sigma-Aldrich), and the contents were serially diluted and plated on THB agar plates to determine the number of viable bacteria. For the blank control, the same numbers of CFU for each bacterial strain were plated without incubation. The percent bactericidal activity was calculated as ([CFU per milliliter in the blank control] − [CFU per milliliter in the experimental group])/[CFU per milliliter in the blank control] × 100%.

Nuclease activity assay.

To detect the function of ENuc and 5Nuc, nuclease assays were performed as described previously (34, 35). Briefly, 10 μl of calf thymus DNA (Sigma-Aldrich) at a dose of 100 ng/μl was mixed with reaction buffer (300 mM Tris, 3 mM MgCl2, 3 mM CaCl2 [pH 7.0]) in a total volume of 200 μl. The reaction was initiated by addition of 0.1 μM rENuc or r5Nuc protein and DNase I (Sigma-Aldrich). DNase I and reaction buffer were used as a positive control and a negative control, respectively. After incubation at 37°C for 1 h, the reaction was halted with the addition of EDTA at a final concentration of 50 mM. The remaining DNA was visualized using GoldView nucleic acid stain (Vazyme Biotech Co., Ltd., Nanjing, China) under UV light. To further study the function of ENuc and 5Nuc in S. equi subsp. zooepidemicus, WT S. equi subsp. zooepidemicus and the three mutant strains were collected in the logarithmic phase of growth and washed 3 times with PBS. Thereafter, 10 μl of bacterial suspension at a dose of 106 CFU/ml was incubated with 1 μg of calf thymus DNA in reaction buffer in a total volume of 50 μl at 37°C for 3 h. The remaining DNA was detected as described above. DNase I and reaction buffer were used as a positive control and a negative control, respectively.

Nucleotidase activity and rpHPLC.

To digest nucleotides and DNA, reaction buffer (300 mM Tris, 3 mM MgCl2, 3 mM CaCl2 [pH 7.0]) was mixed with 1 mM nucleotides or 1 μg of calf thymus DNA (Sigma-Aldrich) and 0.1 μM rENuc, r5Nuc, or bacteria at doses of 106 CFU/ml in a total volume of 500 μl, followed by incubation at 37°C for 1 h. The enzymatic reaction was stopped by addition of EDTA at a final concentration of 50 mM. To assess NET digestion, 0.5 μM rENuc, r5Nuc, or bacteria at a dose of 107 CFU/ml was incubated with NETs for 3 h. The solution was centrifuged at 800 × g for 10 min, and the supernatant was collected.

The production of deoxyadenosine and adenosine was determined by rpHPLC. Samples underwent chromatography on a 250- by 4.6-mm column (BDS Hypersil C18, 5-μm particle size; Thermo Fisher Scientific). The mobile phase was a solution of 70% 65 mM K3PO4 mixed with 30% methanol (pH 6.8). The reaction samples were eluted with the mobile-phase solution for 20 min for deoxyadenosine or 15 min for adenosine at a flow rate of 0.8 ml/min. Peaks were detected via UV absorbance at 260 nm. Commercial nucleosides (Sigma-Aldrich) were used as a standard sample.

Phagocytosis assay.

A phagocytosis assay was performed according to a previously described method with modifications (36). RAW 264.7 cells in 24-well plates were pretreated with 50 μM deoxyadenosine for 1 h. WT S. equi subsp. zooepidemicus was cultured to the mid-exponential phase and washed 3 times with PBS. The RAW 264.7 cells were then washed 3 times with DMEM without fetal bovine serum. Semiconfluent monolayers were infected with 100-μl suspensions containing 106 CFU/ml WT S. equi subsp. zooepidemicus. The control group comprised RAW 264.7 cells without deoxyadenosine pretreatment. Each 24-well plate was concentrated at 800 × g for 10 min and incubated for 2 h at 37°C in 5% CO2. Cells were washed 3 times with DMEM, followed by treatment with penicillin-streptomycin at a concentration of 100 μg/ml for 1 h to kill extracellular bacteria. The cells were again washed 3 times with DMEM, and 100 μl of trypsin and 900 μl of sterile deionized water were added to release all bacteria. CFU numbers were determined by plating serial dilutions. WT S. equi subsp. zooepidemicus without incubation was plated on THB agar as the initial concentration, and the percent bactericidal activity in the control group was set as 100%. The percent bactericidal activity in the treatment group was calculated as (bactericidal CFU in the treatment group)/(bactericidal CFU in the control group) × 100%.

To study the effects of deoxyadenosine on macrophages, we designed the following assay. Briefly, cells were pretreated with or without 50 μM deoxyadenosine for 1 h and then incubated with WT S. equi subsp. zooepidemicus for 2 h; following this, extracellular bacteria were killed with 100 μg/ml penicillin-streptomycin for 1 h, 2 h, 3 h, and 4 h, and the number of viable bacteria on THB agar was calculated for each time point. The number of surviving bacteria after antibiotic killing for 1 h was considered the total number of viable intracellular bacteria. RAW 264.7 cells without treatment were used as controls. The bactericidal percentage was calculated as follows: ([CFU per milliliter at n hours] − [CFU per milliliter at n + 1 h])/(CFU per milliliter at 1 h) × 100%.

Neutrophil and monocyte bactericidal assays.

Cells isolated from murine blood were pretreated with or without 50 μM deoxyadenosine; following this, WT S. equi subsp. zooepidemicus bacteria cultured to the mid-exponential growth phase were washed 3 times with PBS and added to murine blood cells. The mixture was incubated for 90 min and lysed with 0.02% Triton X-100 on ice. The CFU of viable bacteria were determined by plating serial dilutions on THB agar.

Statistical analysis.

All experiments were repeated at least 3 times. The Prism 5 software package (GraphPad Software, La Jolla, CA, USA) was used to perform statistical analyses. P values of <0.05 were considered statistically significant.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

We thank the high-performance liquid chromatography unit and flow cytometer unit of the Laboratory Center of Life Science, Nanjing Agriculture University.

This work was supported by grants from the National Transgenic Major Program (2014ZX0800946B), the Special Fund for Agro-scientific Research in the Public Interest (201403054), the National Natural Science Foundation of China (31272581, 31672574) the Jiangsu Agriculture Science and Technology Innovation Fund [CX (15)1056], and the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

Footnotes

Supplemental material for this article may be found at https://doi.org/10.1128/AEM.02468-16.

REFERENCES

  • 1.Moloney E, Kavanagh KS, Buckley TC, Cooney JC. 2013. Lineages of Streptococcus equi ssp. equi in the Irish equine industry. Ir Vet J 66:1. doi: 10.1186/2046-0481-66-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ma Z, Geng J, Yi L, Xu B, Jia R, Li Y, Meng Q, Fan H, Hu S. 2013. Insight into the specific virulence related genes and toxin-antitoxin virulent pathogenicity islands in swine streptococcosis pathogen Streptococcus equi ssp. zooepidemicus strain ATCC35246. BMC Genomics 14:377. doi: 10.1186/1471-2164-14-377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Holden MTG, Heather Z, Paillot R, Steward KF, Webb K, Ainslie F, Jourdan T, Bason NC, Holroyd NE, Mungall K, Quail MA, Sanders M, Simmonds M, Willey D, Brooks K, Aanensen DM, Spratt BG, Jolley KA, Maiden MCJ, Kehoe M, Chanter N, Bentley SD, Robinson C, Maskell DJ, Parkhill J, Waller AS. 2009. Genomic evidence for the evolution of Streptococcus equi: host restriction, increased virulence, and genetic exchange with human pathogens. PLoS Pathog 5:e1000346. doi: 10.1371/journal.ppat.1000346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Lindahl SB, Aspan A, Baverud V, Paillot R, Pringle J, Rash NL, Soderlund R, Waller AS. 2013. Outbreak of upper respiratory disease in horses caused by Streptococcus equi subsp. zooepidemicus ST-24. Vet Microbiol 166:281–15. doi: 10.1016/j.vetmic.2013.05.006. [DOI] [PubMed] [Google Scholar]
  • 5.Wartha F, Beiter K, Normark S, Henriques-Normark B. 2007. Neutrophil extracellular traps: casting the NET over pathogenesis. Curr Opin Microbiol 10:52–56. doi: 10.1016/j.mib.2006.12.005. [DOI] [PubMed] [Google Scholar]
  • 6.Borregaard N. 2010. Neutrophils, from marrow to microbes. Immunity 33:657–670. doi: 10.1016/j.immuni.2010.11.011. [DOI] [PubMed] [Google Scholar]
  • 7.Fuchs TA, Abed U, Goosmann C, Hurwitz R, Schulze I, Wahn V, Weinrauch Y, Brinkmann V, Zychlinsky A. 2007. Novel cell death program leads to neutrophil extracellular traps. J Cell Biol 176:231–241. doi: 10.1083/jcb.200606027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Brinkmann V, Zychlinsky A. 2012. Neutrophil extracellular traps: is immunity the second function of chromatin? J Cell Biol 198:773–783. doi: 10.1083/jcb.201203170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Yost CC, Cody MJ, Harris ES, Thornton NL, McInturff AM, Martinez ML, Chandler NB, Rodesch CK, Albertine KH, Petti CA, Weyrich AS, Zimmerman GA. 2009. Impaired neutrophil extracellular trap (NET) formation: a novel innate immune deficiency of human neonates. Blood 113:6419–6427. doi: 10.1182/blood-2008-07-171629. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Buchanan JT, Simpson AJ, Aziz RK, Liu GY, Kristian SA, Kotb M, Feramisco J, Nizet V. 2006. DNase expression allows the pathogen group A streptococcus to escape killing in neutrophil extracellular traps. Curr Biol 16:396–400. doi: 10.1016/j.cub.2005.12.039. [DOI] [PubMed] [Google Scholar]
  • 11.Puyet A, Greenberg B, Lacks SA. 1990. Genetic and structural characterization of endA: a membrane-bound nuclease required for transformation of Streptococcus pneumoniae. J Mol Biol 213:727–738. doi: 10.1016/S0022-2836(05)80259-1. [DOI] [PubMed] [Google Scholar]
  • 12.Thammavongsa V, Missiakas DM, Schneewind O. 2013. Staphylococcus aureus degrades neutrophil extracellular traps to promote immune cell death. Science 342:863–866. doi: 10.1126/science.1242255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Altincicek B, Stotzel S, Wygrecka M, Preissner KT, Vilcinskas A. 2008. Host-derived extracellular nucleic acids enhance innate immune responses, induce coagulation, and prolong survival upon infection in insects. J Immunol 181:2705–2712. doi: 10.4049/jimmunol.181.4.2705. [DOI] [PubMed] [Google Scholar]
  • 14.Brinkmann V, Reichard U, Goosmann C, Fauler B, Uhlemann Y, Weiss DS, Weinrauch Y, Zychlinsky A. 2004. Neutrophil extracellular traps kill bacteria. Science 303:1532–1535. doi: 10.1126/science.1092385. [DOI] [PubMed] [Google Scholar]
  • 15.Daigo K, Hamakubo T. 2012. Host-protective effect of circulating pentraxin 3 (PTX3) and complex formation with neutrophil extracellular traps. Front Immunol 3:378. doi: 10.3389/fimmu.2012.00378. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.de Buhr N, Neumann A, Jerjomiceva N, von Kockritz-Blickwede M, Baums CG. 2014. Streptococcus suis DNase SsnA contributes to degradation of neutrophil extracellular traps (NETs) and evasion of NET-mediated antimicrobial activity. Microbiology 160:385–395. doi: 10.1099/mic.0.072199-0. [DOI] [PubMed] [Google Scholar]
  • 17.Sumby P, Barbian KD, Gardner DJ, Whitney AR, Welty DM, Long RD, Bailey JR, Parnell MJ, Hoe NP, Adams GG, Deleo FR, Musser JM. 2005. Extracellular deoxyribonuclease made by group A streptococcus assists pathogenesis by enhancing evasion of the innate immune response. Proc Natl Acad Sci U S A 102:1679–1684. doi: 10.1073/pnas.0406641102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Zhu L, Kuang Z, Wilson BA, Lau GW. 2013. Competence-independent activity of pneumococcal EndA mediates degradation of extracellular DNA and NETs and is important for virulence. PLoS One 8:e70363. doi: 10.1371/journal.pone.0070363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Chatellier S, Ihendyane N, Kansal RG, Khambaty F, Basma H, Norrby-Teglund A, Low DE, McGeer A, Kotb M. 2000. Genetic relatedness and superantigen expression in group A streptococcus serotype M1 isolated from patients with severe and nonsevere invasive diseases. Infect Immun 68:3523–3534. doi: 10.1128/IAI.68.6.3523-3534.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zheng L, Khemlani A, Lorenz N, Loh JM, Langley RJ, Proft T. 2015. Streptococcal 5′-nucleotidase A (S5nA), a novel Streptococcus pyogenes virulence factor that facilitates immune evasion. J Biol Chem 290:31126–31137. doi: 10.1074/jbc.M115.677443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Thammavongsa V, Schneewind O, Missiakas DM. 2011. Enzymatic properties of Staphylococcus aureus adenosine synthase (AdsA). BMC Biochem 12:56. doi: 10.1186/1471-2091-12-56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Fan J, Zhang Y, Chuang-Smith ON, Frank KL, Guenther BD, Kern M, Schlievert PM, Herzberg MC. 2012. Ecto-5′-nucleotidase: a candidate virulence factor in Streptococcus sanguinis experimental endocarditis. PLoS One 7:e38059. doi: 10.1371/journal.pone.0038059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Thammavongsa V, Kern JW, Missiakas DM, Schneewind O. 2009. Staphylococcus aureus synthesizes adenosine to escape host immune responses. J Exp Med 206:2417–2427. doi: 10.1084/jem.20090097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zimmermann H. 1992. 5′-Nucleotidase: molecular structure and functional aspects. Biochem J 285:345–365. doi: 10.1042/bj2850345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Firon A, Dinis M, Raynal B, Poyart C, Trieu-Cuot P, Kaminski PA. 2014. Extracellular nucleotide catabolism by the group B streptococcus ectonucleotidase NudP increases bacterial survival in blood. J Biol Chem 289:5479–5489. doi: 10.1074/jbc.M113.545632. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Haskó G. 2004. Adenosine: an endogenous regulator of innate immunity. Trends Immunol 25:33–39. doi: 10.1016/j.it.2003.11.003. [DOI] [PubMed] [Google Scholar]
  • 27.White MJ, Boyd JM, Horswill AR, Nauseef WM. 2014. Phosphatidylinositol-specific phospholipase C contributes to survival of Staphylococcus aureus USA300 in human blood and neutrophils. Infect Immun 82:1559–1571. doi: 10.1128/IAI.01168-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Miyoshi-Akiyama T, Takamatsu D, Koyanagi M, Zhao J, Imanishi K, Uchiyama T. 2005. Cytocidal effect of Streptococcus pyogenes on mouse neutrophils in vivo and the critical role of streptolysin S. J Infect Dis 192:107–116. doi: 10.1086/430617. [DOI] [PubMed] [Google Scholar]
  • 29.Takamatsu D, Osaki M, Sekizaki T. 2001. Thermosensitive suicide vectors for gene replacement in Streptococcus suis. Plasmid 46:140–148. doi: 10.1006/plas.2001.1532. [DOI] [PubMed] [Google Scholar]
  • 30.Brinkmann V, Laube B, Abu Abed U, Goosmann C, Zychlinsky A. 2010. Neutrophil extracellular traps: how to generate and visualize them. J Vis Exp 36:1724. doi: 10.3791/1724. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Bernatowicz P, Kowal K. 2016. Soluble CD163 modulates cytokine production by peripheral blood mononuclear cells stimulated by Dermatophagoides pteronyssinus allergens in vitro. Adv Med Sci 61:249–254. doi: 10.1016/j.advms.2016.02.004. [DOI] [PubMed] [Google Scholar]
  • 32.Ermert D, Shaughnessy J, Joeris T, Kaplan J, Pang CJ, Kurt-Jones EA, Rice PA, Ram S, Blom AM. 2015. Virulence of group A streptococci is enhanced by human complement inhibitors. PLoS Pathog 11:e1005043. doi: 10.1371/journal.ppat.1005043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Liu P, Pian Y, Li X, Liu R, Xie W, Zhang C, Zheng Y, Jiang Y, Yuan Y. 2014. Streptococcus suis adenosine synthase functions as an effector in evasion of PMN-mediated innate immunity. J Infect Dis 210:35–45. doi: 10.1093/infdis/jiu050. [DOI] [PubMed] [Google Scholar]
  • 34.Moon AF, Gaudu P, Pedersen LC. 2014. Structural characterization of the virulence factor nuclease A from Streptococcus agalactiae. Acta Crystallogr D Biol Crystallogr 70:2937–2949. doi: 10.1107/S1399004714019725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.de Buhr N, Stehr M, Neumann A, Naim HY, Valentin-Weigand P, von Kockritz-Blickwede M, Baums CG. 2015. Identification of a novel DNase of Streptococcus suis (EndAsuis) important for neutrophil extracellular trap degradation during exponential growth. Microbiology 161:838–850. doi: 10.1099/mic.0.000040. [DOI] [PubMed] [Google Scholar]
  • 36.Mitterstiller AM, Haschka D, Dichtl S, Nairz M, Demetz E, Talasz H, Soares M, Einwallner E, Esterbauer H, Fang FC, Geley S, Weiss G. 2016. Heme oxygenase 1 controls early innate immune response of macrophages to Salmonella typhimurium infection. Cell Microbiol 18:1374−1389. doi: 10.1111/cmi.12578. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES