Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2018 Jan 1.
Published in final edited form as: Mol Microbiol. 2016 Nov 22;103(2):269–281. doi: 10.1111/mmi.13555

Salmonella enterica synthesizes 5,6-dimethylbenzimidazolyl-(DMB)-α-riboside. Why some Firmicutes do not require the canonical DMB activation system to synthesize adenosylcobalamin

Theodoric A Mattes 1, Jorge C Escalante-Semerena 1,*
PMCID: PMC5218876  NIHMSID: NIHMS826767  PMID: 27748967

Abstract

5,6-Dimethylbenzimidazolyl-(DMB)-α-ribotide, [α-ribazole-5′-phosphate (α-RP)] is an intermediate in the biosynthesis of adenosylcobalamin (AdoCbl) in many prokaryotes. In such microbes, α-RP is synthesized by nicotinate mononucleotide (NaMN):DMB phosphoribosyltransferases (CobT in S. enterica), in a reaction that is considered to be the canonical step for the activation of the base of the nucleotide present in adenosylcobamides. Some Firmicutes lack CobT-type enzymes, but have a two-protein system comprised of a transporter (i.e., CblT) and a kinase (i.e., CblS) that can salvage exogenous α-ribazole (α-R) from the environment using CblT to take up α-R, followed by α-R phosphorylation by CblS. We report that Geobacillus kaustophilus CblT and CblS proteins restore α-RP synthesis in S. enterica lacking the CobT enzyme. We also show that a S. enterica cobT strain that synthesizes GkCblS ectopically makes only AdoCbl, even under growth conditions where the synthesis of pseudoCbl is favored. Our results indicate that S. enterica synthesizes α-R, a metabolite that had not been detected in this bacterium, and that GkCblS has a strong preference for DMB-ribose over adenine-ribose as substrate. We propose that in some Firmicutes DMB is activated to α-RP via α-R using an as-yet-unknown route to convert DMB to α-R, and CblS to convert α-R to α-RP.

Graphical Abstract

graphic file with name nihms826767u1.jpg

Introduction

Cobamides (Cbas) are cobalt containing cyclic tetrapyrroles. In these structurally complex molecules the pyrrolic N atoms of the ring (a.k.a. the corrin ring) chelate the cobalt ion. In addition to these equatorial ligands, the cobalt ion interacts with two axial ligands (a.k.a. upper, lower ligands). The lower ligand of cobamides is tethered to the ring through a structure known as the nucleotide loop (Fig. 1A). Cobamides differ from each other by the nature of the base of the nucleotide loop, which can range from purines, purine analogues, or phenolics (Chan & Escalante-Semerena, 2011). The best-studied cobamide is cobalamin (Cbl), which contains 5,6-dimethylbenzimidazole (DMB) as its lower ligand base. In its coenzymic form, the upper ligand of Cbl is 5-′deoxyadenosine (AdoCbl, Fig. 1A).

Figure 1. Late steps in AdoCbl biosynthesis.

Figure 1

Open in a new tab

A. Structures relevant to this study. Adenosylcobalamin, AdoCbl; 5,6-dimethylbenzimidazole, DMB; α-ribazole-5′-phosphate, α–RP. B. Activation of DMB in S. enterica and its incorporation into AdoCbl. In S. enterica, DMB and other purines and purine analogues, are activated to the corresponding α-ribotide by the NaMN:DMB phosphoribosyltransferase CobT. Abbreviations: NaMN, nicotinate mononucleotide; Na, nicotinate; HO-Cbi, hydroxocobinamide; CobA, ATP:Co(I)rrinoid adenosyltransferase; CobU, NTP:Ado-cobinamide kinase/NTP:Ado-cobinamide-phosphate guanylyltransferase; CobS, AdoCbl-5′ phosphate synthase; CobC, Ado-Cba-P phosphatase. Biosynthetic intermediates are generated in the following order: [1], AdoCbi; [2], AdoCbi-P; [3], AdoCbi-GDP; [4], AdoCbl-5′-P.

Salmonella enterica sv Typhimurium strain LT2 (hereafter S. enterica) synthesizes the corrin ring de novo only under anoxic conditions (Jeter & Roth, 1987, Escalante-Semerena & Roth, 1987); for a review see (Escalante-Semerena & Warren, 2008). This bacterium incorporates different ligand bases as a function of oxygen in the environment. Under microaerophilic conditions, S. enterica synthesizes AdoCbl, but under anoxic conditions S. enterica incorporates adenine or 2-methyladenine into the final product of the pathway (Keck & Renz, 2000). The cobamide containing adenine as the lower ligand base is known as pseudoCbl (Friedmann & Fyfe, 1969).

Notably, under normoxic conditions and in the presence of precursors including a complete corrin ring S. enterica can assemble the nucleotide loop via the branch of the pathway known as the nucleotide loop assembly (NLA) pathway. (Escalante-Semerena, 2007). Under nomoxic conditions S. enterica cannot synthesize the corrin ring, therefore the synthesis of AdoCba can only occur if the cell has complete corrin ring precursors in its environment. Under such conditions five enzymes are needed to assemble the nucleotide loop starting with cobinamide (Fig. 1): CobA, adenosylates cobinamide to yield AdoCbi; CobU activates AdoCbi at the expense of GTP to yield AdoCbi-GDP; CobT activates the lower ligand base at the expense of nicotinate mononucleotide (NaMN) to yield α-base-RP (where ‘base’ could DMB, adenine, etc); CobS joins the activated ring and base to yield AdoCba-P; and the last enzyme, CobC, dephosphorylates the molecule yielding the final product, AdoCba.

We are interested in the synthesis and activation of DMB in this bacterium (Fig. 1A, shaded, upper right). The biosynthesis of DMB has been described in other organisms. For example, in Eubacterium limosum, DMB synthesis proceeds through a five-enzyme pathway starting from 5′-aminoimidazole ribotide (AIR), the central branch point of thiamine and purine biosynthesis (Hazra et al., 2015) by an enzyme homologous to the HMP-P synthase (ThiC) (Martinez-Gomez & Downs, 2008, Martinez-Gomez et al., 2009). In Rhodobacter sphaeroides and other organisms, DMB synthesis proceeds through a single-enzyme conversion of reduced flavin mononucleotide (Gray & Escalante-Semerena, 2007, Taga et al., 2007, Campbell et al., 2006). To date, neither mechanism has been identified in S. enterica, although a report in the literature suggests that riboflavin may be a precursor to DMB in this bacterium (Keck et al., 1998).

In S. enterica, DMB is activated in one step to its ribotide form (Fig. 1B). This reaction is catalyzed by the nicotinate mononucleotide (NaMN):DMB phosphoribosyltransferase CobT enzyme (Trzebiatowski et al., 1994), which transfers the ribosyl-5′-phosphate moiety from NaMN to DMB, releasing the activated α-ribotide, α-ribazole-phosphate (hereafter α-RP) and nicotinate (Fig. 1A). CobT-like enzymes are wide spread amongst AdoCba producers (Rodionov et al., 2003).

The S. enterica CobT enzyme can activate a wide variety of substrates including adenine (Cheong et al., 2001). Homologues of the SeCobT enzyme in the acetogenic bacterium Sporomusa ovata can also activate phenolic bases such as p-cresol and phenol (Chan & Escalante-Semerena, 2011, Chan et al., 2014).

The lack of substrate specificity of the S. enterica CobT enzyme poses a problem for the studies of DMB biosynthesis in this bacterium. Notably, to date true DMB auxotrophs of S. enterica have not been isolated. S. enterica ΔcobT strains require exogenous DMB to grow, but this requirement is not due to a block in DMB biosynthesis but to the presence of an alternative enzyme (Trzebiatowski et al., 1994). The NAD+-dependent CobB sirtuin can substitute for CobT in the activation of DMB (Tsang & Escalante-Semerena, 1998), further complicating the analysis of DMB biosynthesis in this bacterium.

In Listeria innocua, we identified a pair of proteins that are responsible for the transport and conversion of the DMB riboside (α–R) to its α-ribotide (α–RP) (Gray & Escalante-Semerena, 2010). The above-mentioned L. innocua proteins are known as LinCblT (a transporter), and LinCblS (a kinase). Notably, the LinCblTS proteins showed specificity for α-R, but it required α-R to be provided exogenously (Gray & Escalante-Semerena, 2010). Here, we report the identification of homologues of LinCblT and LinCblS in Geobacillus kaustophilus, which support Cbl-dependent growth of a S. enterica ΔcobT strain without the addition of α–R, opening the doors for the use of genetic approaches for the analysis of DMB synthesis, and its activation to α-R.

Results

Geobacillus kaustophilus CblT and CblS restore cobamide-dependent methionine synthesis in S. enterica in the absence of exogenous α-R. Efforts aimed at validating the function of CblS and CblT homologues in Firmicutes led us to a pair of proteins from the deep-sea thermophile Geobacillus kaustophilus, namely GK2255 (hereafter GkCblS) and GK2256 (hereafter GkCblT). We used Clustal Omega (Sievers et al., 2011) to compare the sequence of these proteins. Using this approach we determined that the GkCblT and GkCblS proteins were 45% and 51% similar, respectively, to the L. innocua counterparts (Fig. S1B and S1C). In G. kaustophilus, the cblS and cblT genes are located within the cob operon of G. kaustophilus (Fig. S1A), suggesting that in this bacterium, the CblS and CblT proteins participate in AdoCbl biosynthesis.

Assessing the functionality of G. kaustophilus CblTS proteins in S. enterica

To determine whether or not GkCblS and GkCblT were functional, the G. kaustophilus cblT+ and cblS+ alleles were placed under the control of the arabinose-inducible ParaBAD promoter of plasmid pBAD24 (Guzman et al., 1995). The resulting plasmid (pGkCblTS2) was transformed into JE12939 (cobT cobB), which lacked the two enzymes (CobT, CobB) known to activate lower ligand bases into their corresponding α-ribotides (Trzebiatowski et al., 1994, Tsang & Escalante-Semerena, 1998). Strain JE12939 also lacked the cobamide-independent methionine synthase MetE enzyme, resulting in a methionine auxotrophy that, under normoxic conditions, could be corrected by cobamides or methionine (Jeter et al., 1984). In the absence of methionine, the strain uses the cobamide-dependent methionine synthase MetH enzyme to methylate homocysteine yielding methionine (Jeter et al., 1984); the metE cobT cobB/pGkCblTS2 strain is hereafter referred to as JE17830. A negative control strain (JE17827) had the same genetic background but carried the empty cloning vector pBAD24. A positive control strain (JE17828) harboring a plasmid encoding the wild-type CobT protein was also constructed.

The above-mentioned strains were used in experiments aimed at assessing α-RP synthesis in vivo and whether GkCblT, GkCblS or both were needed. For this purpose, strains were grown under normoxic conditions at 37°C. In all experiments described below, minimal NCE medium was supplemented with (CN)2Cbi as a precursor of AdoCbl. We supplemented the culture medium with (CN)2Cbi because under normoxic conditions S. enterica does not synthesize the corrin ring (Jeter & Roth, 1987, Jeter et al., 1984), due to the lack of activation of the adenosylcobinamide-phosphate (AdoCbi-P) biosynthetic genes (Escalante-Semerena & Roth, 1987). In S. enterica, the conversion of (CN)2Cbi into AdoCbl requires the synthesis of α-RP by SeCobT.

i) GkCblTS compensate for the absence of CobT in the presence of high concentrations of cobinamide and the absence of exogenous α-R

In the first experiment, the medium was supplemented with (CN)2Cbi (5 nM) but not with α-R. Under these conditions strain JE17827 carrying the cloning vector failed to grow (Fig. 2A,triangles) and required the addition of CNCbl to grow (Fig. 2A, diamonds), the strain carrying plasmids encoding cobT+ (Fig. 2A, squares) or cblTS+ (Fig. 2A, circles) exhibited robust growth.

Figure 2. GkCblS is necessary and sufficient for incorporation of endogenously generated α-R into AdoCba.

Figure 2

Open in a new tab

Four strains were used in these experiments, all of which had the following chromosomal mutations: ΔmetE ara-9 ΔcobT ΔcobB. The difference among strains was the plasmid they harbored. JE17827 (pBAD24), JE17828 (pSeCobT), JE17830 (pGkCblTS), and JE21364 (pGkCblS). A. Growth behavior of strains JE17827, JE17828, and JE17830 under conditions of excess cobinamide (5 nM) in the medium. B. Growth behavior of strain JE17830 under conditions of limiting cobinamide in the medium (0.25 nM). When added to the medium DMB and α-R were present at the indicated concentrations. C. Growth behavior of strain JE21364 under limiting cobinamide conditions (0.25 nM). When added to the medium, DMB and α-R were present at the indicated concentrations. These results are representative of six biological replicates each one of which was performed in technical duplicates.

ii) At low concentrations of cobinamide GkCblTS compensate for the absence of CobT only if DMB or α-RP is provided

It has been reported that the activity of the AdoCbl-5′-P synthase CobS enzyme of S. enterica increases when the enzyme is saturated with either AdoCbi-GDP or α-RP (Zayas & Escalante-Semerena, 2007). With this in mind, we decreased the concentration of (CN)2Cbi to determine whether the addition of DMB would stimulate α-R synthesis, hence growth. Strain JE17830 was grown as above, except that the concentration of cobinamide in the medium was reduced to 0.25 nM. (a 200-fold reduction). At this cobinamide concentration, strain JE17830 failed to grow (Fig. 2B, solid circles). In contrast, the addition of DMB (200 μM) or α-R (300 nM) restored growth (Fig. 2B, open circles, black triangles, respectively). These data suggested that DMB synthesis or scavenging was the limiting factor in the synthesis of α-RP in strain JE17830 under the conditions tested.

iii) GkCblT is not required for the conversion of DMB to α-R

These of the experiments described in section ii) above did not inform on whether or not CblT function (α-R transporter) was needed for the conversion of DMB to α-R. To address the latter question, a strain carrying a plasmid encoding GkCblS under ParaBAD control was constructed and grown under limited concentration of cobinamide (0.25 nM) with or without α-R or DMB supplementation, or with excess cobinamide (5nM). As shown in figure 2C, when the concentration of cobinamide was limiting and neither DMB nor α-R was present in the medium, strain JE21364 (ΔmetE ara-9 ΔcobT ΔcobB/pGkCblS) did not grow (Fig. 2C, squares). Strain JE21364 failed to respond to the presence of DMB (Fig. 2C, diamonds), but did respond to the presence of α-R (Fig. 2C, solid triangles). In addition, when the concentration of cobinamide was increased 200 fold (to 0.5 nM) without α-R supplementation, the strain grew fast and to high density with a minimal lag time (Fig. 2C, open triangles). Our interpretation of these is discussed below.

G. kaustophilus CblS is an α-ribazole kinase

The similarity of GkCblS to L. innocua CblS (Fig. S1) suggested that GkCblS had α-R kinase activity. To investigate this possibility, G. kaustophilus cblS+ was cloned into vector pTEV5 (Rocco et al., 2008) and over-produced as a hexahistidine-tagged fusion protein in strain JE13607 (E. coli BL21(λDE3) cobT762::kan+). The protein was purified by nickel-affinity chromatography; the His6 tag was not removed. Elution of the tagged protein from the column resulted in highly enriched His6-GkCblS around approximately 28.5 kDa (Fig. 3, lane 6), consistent with the expected molecular mass of GkCblS (25.5 kDa).

Figure 3. Purified His6-GkCblS.

Figure 3

Open in a new tab

Lanes, left to right: 1, Molecular mass markers; 2, crude cell-free extract; 3, column flow through; 4, bind buffer eluate (10 mM imidazole); 5, wash buffer eluate (150 mM imidazole); 6, elution buffer eluate [imidazole (750 mM), TCEP (5 mM), glycerol (5%, v/v)]. Molecular mass of His6-GkCblS (28.5 kDa) calculated from its primary sequence.

The purified protein was tested for α-R kinase and NaMN::DMB phosphoribosyltransferase (CobT) activity. To test for α-R kinase activity, protein (3 μg) was added to a reaction mixture containing HEPES (50 mM, pH 7.4), MgCl2 (5 mM), KCl (750 mM), TCEP (5 mM), ATP (0.5 mM), and α-R (0.25 mM). The reaction was incubated for 3 h at 37 °C. As a negative control, a reaction mixture devoid of protein was incubated under the same conditions. The products of the reactions were separated by RP-HPLC on a C18 column as described under Experimental procedures. The addition of GkCblS resulted in the loss of the α-R peak (Fig. 4A, 10.2 min) and formation of a new peak (Fig. 4B, 8.9 min). To verify the identity of this peak, DMB and NaMN were incubated with purified SeCobT to generate α-RP, and the reaction products were separated by RP-HPLC using the same conditions. Addition of SeCobT resulted in the loss of the DMB peak (Fig. 4C, 11 min) and the formation of the expected product α-RP peak (Fig. 4D, 8.5 min). The UV-spectra and retention times were similar to those observed in Fig. 4B, indicating that the product of GkCblS was α-RP. An observed shift in the retention time for α-RP (8.5 min to 8.9 min) between the SeCobT and the α-R kinase results was likely due to a difference in the pH of the CobT reaction mixture (10 vs 7.4). The UV-vis spectrum of the compound eluting 8.5 min post injection was similar to the spectrum of the compound eluting 8.9 min post injection. In a parallel experiment, DMB and NaMN were incubated with GkCblS, but no α-RP formation was detected (data not shown).

Figure 4. GkCblS converts α-R to α-RP at the expense of ATP.

Figure 4

Open in a new tab

In vitro assay conditions and the RP-HPLC protocol are described in the Experimental procedures section. The addition of purified GkCblS to a reaction mixture containing α–R (A) and ATP gave rise to a peak at 8.9 min (B). The UV-spectrum of the compound generating the signal is shown in the inset. The identity of this peak was confirmed to be α-RP by using the SeCobT phosphoribosyltransferase reaction as a control. SeCobT synthesizes α-RP from DMB and NaMN (Claas et al., 2010, Trzebiatowski & Escalante-Semerena, 1997, Trzebiatowski et al., 1994). The retention time of SeCobT-derived α-RP (panel D) was the same as that of the GkCblS reaction product (B). The UV-spectra of each product are shown in the insets. Compound elution was monitored at 287 nm. Chromatograms do not show the peaks for donor nucleotides, which eluted between 2 and 3 min post injection.

S. enterica does not produce pseudoCbl in the presence of GkCblTS

To determine what lower ligand GkCblTS activated when produced in S. enterica, corrinoids were extracted from cells grown under different conditions. Deproteinated extracts obtained as described under Experimental procedures were resolved by RP-HPLC and fractionated. Two indicator strains were used to establish the presence of cobamides in deproteinated extracts of strains of interest. The first indicator strain was JE8214 (metE cobS), a strain lacking the Cbl-independent methionine synthase (MetE) and the AdoCbl-5′-P synthase (CobS) enzymes. The absence of MetE demanded that the methylation homocysteine to methionine occurred via the Cba-dependent MetH enzyme; the absence of CobS in strain JE8214 blocked adenosylcobamide biosynthesis. The presence of metE and cobS null alleles in strain JE8214 rendered the strain auxotrophic for cobamides or methionine. To determine whether methionine or cobamides were present in deproteinated extracts, we used a second indicator strain, namely strain JE12403. In addition to the metE and cobS null alleles, strain JE12403 also carried a btuB null allele. The BtuB protein is responsible for the transport of corrinoids (including cobamides) across the S. enterica outer membrane. Unlike strain JE8214, strain JE12403 grew only if methionine was present in the deproteinated extract being tested. A soft agar layer seeded with one of these strains was poured over a minimal medium plate lacking corrinoids. Samples of fractions obtained after RP-HPLC analysis of deproteinated extracts were spotted onto the hardened soft agar layer. A fraction was determined to contain a complete cobamide if it supported growth of strain JE8214 but not JE12403. The presence of cobamides in a fraction of interest was confirmed by UV-vis spectroscopy and mass spectrometry.

As a control, a mixture of authentic pseudoCbl, (CN)2Cbi, and CNCbl at a known concentration was resolved, fractionated, and assayed (Fig. 5A). Bioassay of the fractions collected indicated the presence of complete cobamides in fractions eluting between 11.5 min and 18.5 min post injection. The strongest signals were detected at 12 and 17 min. UV-vis spectra and mass spectrometry confirmed the presence of pseudoCbl and Cbl, respectively. The peak observed at 14 min in the HPLC trace was cobinamide (denoted by (CN)2Cbi in Fig. 5).

Figure 5. RP-HPLC Analysis of corrinoid extracts.

Figure 5

Open in a new tab

RP-HPLC. Corrinoid extracts from JE12939 derivatives were separated by RP-HPLC as described in the Experimental procedures section; their elution was monitored at 367 nm. DMB or adenine was added as indicated to determine whether biosynthesis could be directed. Traces were normalized for comparison purposes. Normalization was achieved by considering the peak with the highest absorbance as 100%. Dashed lines indicate fractions at 12 and 17 min post injection. Expected retention times for pseudoCbl, CNCbl, and (CN)2Cbi are indicated below the traces. Peak indicated by “X” is not a corrinoid as indicated by its UV-vis spectrum and bioassay results (Fig. S2); its identity was not established. As a control, a 0.5 μM solution of authentic pseudoCbl, (CN)2Cbi, and CNCbl was analyzed under the same conditions (Fig. 6A). UV-vis spectra. Spectra were obtained from the RP-HPLC chromatogram at the elution time identified by the dashed line. UV-vis spectra shown in row A were obtained with authentic compounds. The first column reflects the UV-vis spectrum collected at 12 min and the second column reflects the spectrum at 17 min. Peaks at 367 nm and 525 nm were indicative of a corrinoid. ΔcobS bioassay. Bioassays were performed as described in the Experimental procedures section. These fractions are representative of the highest peak for pseudoCbl and CNCbl elution, respectively, as confirmed by mass spectrometry. Growth indicates the presence of a complete cobamide. Abbreviations: NG, no growth; +, halo diameter < 5 mm; ++, diameter between 5 mm and 10 mm; +++, halo diameter > 10 mm. The following strains were used: Panel A, none; panels B, D, F, JE17830; panels C, G, E, JE17828.

RP-HPLC analysis of deproteinated extracts of strain JE17828 (pSeCobTWT) grown on minimal medium supplemented with (CN)2Cbi (300 nM) but no DMB, showed the presence of complete cobamides in fractions collected between 11.5 min and 13 min as well as between fractions collected between 16 min and 17.5 min (Fig. 5C). The strongest signal was observed with compounds eluting 12 min post injection. When strain JE17830 (pGkCblTSWT) was grown under similar conditions, complete cobamides were detected in fractions collected between 14.5 and 18 min, with the strongest signal obtained with compounds eluting 17 min post injection (Fig. 5B). These data suggested that strain JE17830 did not synthesize pseudoCbl, an idea that was supported by the lack of signal in the UV-vis spectra (Fig. 5B) or the mass spectrometry data (data not shown).

To try and guide cobamide biosynthesis towards pseudoCbl, adenine (200 μM) was added to the culture medium already containing (CN)2Cbi (300 nM). Deproteinated extracts of strain JE17828 contained complete cobamides with the strongest signal observed at 12.5 min post injection (Fig. 5E). Extracts of strain JE17830 grown under the same conditions contained complete cobamides between 14.5 min and 18 min, with the strongest signal observed at 17 min (Fig. 5D). These data supported the conclusion that JE17830 did not produce pseudoCbl under the growth conditions used. For comparison, a strain with the same genetic background but carrying a plasmid encoding SeCobTWT made pseudoCbl (Fig. 5E).

To determine whether or not the addition of DMB would change the cobamide made by strains JE17828 (pSeCobT) and JE17830 (pGkCblTS), DMB (200 μM) was added to medium containing (CN)2Cbi (300 nM). RP-HPLC analysis of deproteinated extracts of strain JE17828 showed a shift, with cobamides detected between 12.5 min and 18.5 min, with the largest peak at 17 min (Fig. 5G). That is, strain JE17828 made Cbl only, with no detectable evidence of pseudoCbl production. In contrast, extracts of strain JE17830 contained complete cobamides that were detected between 14.5 min and 18 min post injection, with the strongest growth response observed when material eluted at 17 min was tested (Fig. 5F). Notably, no detectable increase was observed in the bioassay of any of the fractions of extracts of strain JE17830. Close analysis of the chromatogram at 17 min revealed a signal in extracts of the strain grown in DMB-supplemented medium, but not in extracts of the same strain grown in adenine-supplemented medium or in extracts of the strain grown in medium devoid of base supplements. We note that a signal detected in all prepared samples around 16 min (denoted by X in Fig. 6) was not a cobamide on the basis of the UV-vis spectrum and bioassay results (Fig. S2), did not support growth (data not shown) and was not further identified.

Figure 6. Expanded view of α-RP biosynthesis via direct DMB activation or α-R scavenging.

Figure 6

Open in a new tab

The presence of the CobT-dependent synthesis of α-RP and the CblTS proteins in a single organism (e.g., G. kaustophilus) may be an indicator of the presence of α-R in the environment. As shown in this study, S. enterica can convert DMB to α-R via an unknown mechanism. Other bacteria, like G. kaustophilus may also be able to convert DMB to α-R, thus expanding the role of the CblTS system from salvaging to de novo synthesis. In S. enterica, it has been proposed that DMB is derived from FMN, but the enzymes involved have not been identified. Abbreviations: FMN, flavin mononucleotide; CobU, NTP:Ado-cobinamide kinase and NTP:Ado-cobinamide-phosphate guanylyltransferase; CobS, AdoCbl-phosphate synthase; CobC, Ado-Cba-P phosphatase.

Discussion

Here we report that the CblS and CblT proteins from the Firmicute G. kaustophilus can substitute for the CobT enzyme in the synthesis of the intermediate α-RP of the AdoCba biosynthetic pathway in S. enterica. One interesting finding of this work was that when GkCblS substituted for SeCobT, the the product of the pathway was AdoCbl. Below we discuss our interpretation of the results and the implications of the findings.

What is the physiological role of the GkCblTS proteins in Firmicutes?

Prior to this work, it was accepted that in cobamide producers DMB activation to α-RP was catalyzed by a DMB:NaMN phosphoribosyltransferase, e.g., the CobT enzyme of S. enterica (Trzebiatowski & Escalante-Semerena, 1997). From previous work we learned that some Firmicutes (e.g., L. innocua) possessed what appeared to be an α-R salvaging system comprised of an α-R transporter (CblT) and an α-R kinase (CblS) (Gray & Escalante-Semerena, 2010). The identification of the CblTS system in L. innocua left one question unanswered. Since the L. innocua genome does not encode a CobT homologue, is L. innocua an obligate α-R salvaging bacterium? If the answer were yes, then one wonders how this bacterium survives in an environment where it needs to synthesize AdoCbl, but the environment is devoid of α-R. The results reported herein recapitulate the L. innocua conundrum in a S. enterica ΔcobT strain that can synthesize CblTS. Growth analyses of such a strain showed that S. enterica has an as-yet-unknown mechanism to synthesize α-R. We propose that Firmicutes also synthesize α-R endogenously, and that the CblTS proteins serve the dual purpose of being a system that generates α-RP from exogenous or endogenously synthesized α-R.

S. enterica synthesizes α-R, a previously unknown capability of this bacterium

The in vivo analyses of GkCblTS functions revealed an unexpected metabolic capability of S. enterica, which is that S. enterica can convert DMB into its riboside, α-R. Results shown in figure 2, support the following conclusions: i) In the presence of high amounts of cobinamide, an AdoCbl precursor, GkCblTS can compensate for the lack of SeCobT during the synthesis of AdoCbl without any addition to the medium, meaning that the α-R needed by the GkCblS kinase to make α-RP must be endogenously synthesized (Fig. 2A); ii) under the same growth conditions (i.e., high exogenous cobinamide levels), the GkCblT protein is dispensable (Fig. 2C, open triangles), supporting the idea that GkCblS is necessary and sufficient for the phosphorylation of α-R; iii) that GkCblT may be able to transport DMB (compare open circles in Fig. 2B to diamonds in Fig. 2C); iv) that S. enterica can acquire α-R in the absence of GkCblT (Fig. 2C, solid triangles). Since S. enterica does not make a CblT homologue, these results suggest that α-R is transported into S. enterica via non-specific means. Although it is unclear whether DMB was endogenously synthesized or salvaged in the experiments perform in these studies, the results strongly support the conclusion that S. enterica can convert DMB to α-R. To the best of our knowledge, this is the first example of such a conversion in any organism.

GkCblS has kinase activity, and appears to prefer α-R over α-adenosine as substrate

Given the primary sequence similarity between GkCblS and LinCblS (Fig. S1), it was not unexpected to find that GkCblS had α-R kinase activity. What was surprising, however, was the strong preference of the enzyme for α-R over α-adenosine. Results of guided biosynthesis experiments with GkCblS as the sole means to activate DMB or adenine failed to yield pseudoCbl, even though the cultures were grown in the presence of excess adenine and no exogenous DMB. These results suggest that GkCblS had a strong preference for α-R over α-adenosine (Fig. 5D). When the control experiment was performed with SeCobT, the cell made mostly pseudoCbl (Fig. 5E), consistent with our knowledge that the SeCobT enzyme can use either DMB or adenine as substrate. The conclusion that GkCblS prefers α-R over α-adenosine as substrate is further supported by results of in vivo (Fig. 2) and in vitro experiments (Fig. 4).

An opportunity to identify the S. enterica enzyme that converts DMB to α-R, and to investigate the putative DMB biosynthetic pathway in this bacterium

An understanding of if and how S. enterica makes DMB has remained an enigma since the discovery of cobamide biosynthesis in this bacterium was reported over three decades ago (Jeter et al., 1984). The lack of a system that would use α-R but not α-adenosine as substrate made it difficult to isolate bona fide DMB auxotrophs of S. enterica. Because strain JE21634 (Δmet ara-9 ΔcobT ΔcobB/pGkCblS) only makes AdoCbl, this genetic background offers an opportunity for the use of in vivo genetic approaches to investigate the putative DMB biosynthetic pathway in this bacterium, and the conversion of DMB to α-R. To our knowledge, the existence of these enzymes has not been reported in S. enterica or any other cobamide producer.

At present, it is unclear whether S. enterica synthesizes DMB de novo. The claim that this bacterium synthesizes DMB is weakened by the fact that genes encoding enzymes responsible for its synthesis have not been identified. It is possible that S. enterica and other organisms synthesize DMB via an as-yet uncharacterized pathway distinct from the five-enzyme, anoxic pathway found in Eubacterium limosum (Hazra et al., 2015) and the single enzyme, oxygen-dependent pathway identified in Rhodobacter sphaeroides and Sinorhizobium meliloti (Gray & Escalante-Semerena, 2007, Campbell et al., 2006, Taga et al., 2007). The absence of bona fide S. enterica DMB auxotrophs suggests that either that this bacterium does not have a dedicated pathway for DMB synthesis, that the pathway is also needed for other metabolic purposes, or that one or more of the functions involved in the putative pathway is essential. The isolation of DMB auxotrophs probably has been complicated by the broad distribution of DMB in the environment and culture media commonly used in our laboratories (Crofts et al., 2014).

An expanded model for the synthesis of α-RP in bacteria

Collectively, our data support the conclusion that S. enterica can synthesize α-R but cannot phosphorylate it to α-RP (Figs. 2, 5). It appears, however, that some Firmicutes have evolved an α-R kinase that can phosphorylate α-R. It is unclear what the selective pressure for the evolution of such a kinase may have been in G. kaustophilus, since the genome of this bacterium also encodes a homologue of the SeCobT enzyme (locus tag gk1793). It is possible that this bacterium is exposed to α-R in the marine environment it inhabits, which is not unlikely since the presence of α-R in marine environments was recently reported (Johnson et al., 2016). If that were the case, then the GkCblTS proteins would likely be the α-R scavenging system, while the GkCobT enzyme would play a role in de novo synthesis in this bacterium. Figure 6 shows a model for the synthesis and activation of DMB in bacteria that either have the canonical DMB activation system (e.g., CobT) or the CblS-dependent pathway to convert α-R, to α-RP. We suggest that G. kaustophilus uses GkCblTS and GkCobT for different purposes.

Experimental procedures

Chemicals

Unless otherwise indicated, chemicals were obtained from Sigma-Aldrich. Pseudocobalamin was extracted from laboratory strains by growing S. enterica in medium containing 1,2-propanediol as the sole source of carbon and energy. Under such conditions, this bacterium produces only pseudoCbl (Anderson et al., 2008). Corrinoids were extracted from cultures grown on 1,2-propanediol using procedures described below. Alpha-ribazole (α-R) was obtained by the method described in (Pakin et al., 2005) with the modifications described in (Gray & Escalante-Semerena, 2010).

Bacterial strain construction

All strains and plasmids used are listed in table 1. Transformations were performed as described (Maniatis et al., 1982) with no modifications.

Table 1. Strains and plasmids used in this study.

Unless otherwise stated, strains and plasmids were constructed during the course of this work

Strains Antibiotic resistance Relevant genotype Reference or source
E. coli strains1
DH5α/F′
JE13607 KmR BL21 (λDE3) cobT762::kan+ (Chan & Escalante-Semerena, 2011)
S. enterica strains2
TR6583 metE205 ara-9 K. Sanderson via J. Roth
JE7088 ΔmetE2702 ara-9 Lab collection
JE8214 CmR metE205 ara-9 cobS1312::cat Lab collection
JE12403 KmR metE205 ara-9 ΔcobS1313 btuB7::MudJ3 Lab collection
JE12939 ΔmetE2702 ara-9 ΔcobT1380 ΔcobB1375 Lab collection
JE17827 ApR ΔmetE2702 ara-9 ΔcobT1380 ΔcobB1375/pBAD24
JE17828 ApR ΔmetE2702 ara-9 ΔcobT1380 ΔcobB1375/pCOBT140
JE17830 ApR ΔmetE2702 ara-9 ΔcobT1380 ΔcobB1375/pGkCblTS2
JE21364 ApR ΔmetE2702 ara-9 ΔcobT1380 ΔcobB1375/pGkCblS3
Plasmids
pGEM-T Easy ApR TA cloning vector Promega
pT7-5 ApR Overexpression vector (Tabor & Richardson, 1992)
pBAD24 ApR Cloning vector with ParaBAD arabinose-inducible promoter (Guzman et al., 1995)
pBAD33 CmR Cloning vector with ParaBAD arabinose-inducible promoter (Guzman et al., 1995)
pTEV5 ApR TEV protease-cleavable His6 tag overexpression vector (Rocco et al., 2008)
pJO27 ApR S. enterica cobT+ in pT7-5 (Trzebiatowski et al., 1994)
pGkCblTS1 ApR G. kaustophilus cblT+ cblS+ in pGEM-T Easy
pGkCblTS2 ApR G. kaustophilus cblT+ cblS+ in pBAD24
pGkCblS1 CmR G. kaustophilus cblS+ in pBAD33
pGkCblS2 ApR G. kaustophilus cblS+ translational fusion to His6 tag for protein purification in pTEV5
pGkCblS3 ApR G. kaustophilus cblS+ in pBAD24
pCOBT81 CmR S. enterica cobT+ in pBAD33
pCOBT140 ApR S. enterica cobT+ in pBAD24
Open in a new tab
1

All E. coli strains used in this study were derivatives of E. coli K-12

2

All S. enterica strains used in this study were derivatives of S. enterica sv Typhimurium strain LT2

3

MudJ is an abbreviation of MudII1734 (Castilho et al., 1984)

ApR, Ampicillin resistance; CmR, chloramphenicol resistance; KmR, kanamycin resistance

Plasmid construction

All primers used in this study are listed in table 2. DNA amplification and restriction digestions were performed according to manufacturer’s protocols. All restriction enzymes used were purchased from Thermo Fisher Scientific Inc., unless otherwise stated.

Table 2.

Oligonucleotides used in this study.

Primer Sequence (5′ → 3′)*
Gk_cblTS_EcoRI_5′ AGAATTCCACCATGAACCGCCGCTTGGCTT
Gk_cblTS_HindIII_3′ ATGAAGCTTTTACCACTCGACGTGCAGTG
Gk_cblS_XbaI_RBS_5′ GAGGCGTCTAGAAGGAGGCACCATGCGTGATGTGCTTTTCC
pTEV5_ PIPE_gkCblS_5′ AACCTGTATTTTCAGGGCATGCGTGATGTGCTTTTCC
pTEV5_ PIPE_gkCblS_3′ AGCTCGAGAATTCCATGGTTACCACTCGACGTGCAG
pTEV5_PIPE_NheI_5′ GCCCTGAAAATACAGGTTTTCACTAGTTG
pTEV5_PIPE_XhoI_3′ CCATGGAATTCTCGAGCTCCCG
Gk_CblS_EcoRI_5′ GAGGCGGAATTCCACCATGCGTGATGTGCTTTTCC
Sal_CobT_BAD24_EcoRI_5′ CAGGAATTCCGAGACATCTTATGCAGACACTACACGC
Sal_CobT_BAD24_XbaI_3′ CAGTCTAGACGATGGGTCGGGTTATGTTGC
Open in a new tab
*

Restriction sites introduced for cloning are underlined.

pGkCblTS1

The adjacent Geobacillus kaustophilus cblT+ and cblS+ coding sequences (locus tags gk2256 and gk2255, respectively) were amplified from G. kaustophilus HTA426 genomic DNA using primers Gk_cblTS_EcoRI_5′ and Gk_cblTS_HindIII_3′ and the resulting PCR product was inserted into plasmid pGEM-T Easy (Promega) using the cloning strategy described by the manufacturer; the resulting plasmid was named pGkCblTS1.

pGkCblTS2

The G. kaustophilus cblT+ and cblS+ coding sequences were excised from pGkCblTS1 and subcloned into the EcoRI and HindIII sites of pBAD24 to yield plasmid pGkCblTS2. The plasmid pGkCblTS2 was used for complementation assays and corrinoid analyses.

pGkCblS1

The G. kaustophilus cblS+ coding sequence was amplified off pGkCBLTS2 using primers Gk_cblS_XbaI_RBS_5′ and Gk_cblTS_HindIII_3′. The DNA fragment was cut and inserted between the XbaI and HindIII sites of pBAD33. The resulting plasmid was named pGkCblS1

pGkCblS2

This vector was constructed using the polymerase incomplete primer extension (PIPE) method (Klock et al., 2008). The G. kaustophilus cblS+ coding sequence was amplified off pGkCBLS1 using the primers pTEV5_PIPE_gkCblS_5′ and pTEV5_PIPE_gkCblS_3′. The vector backbone pTEV5 was amplified using the primers pTEV5_PIPE_NheI_5′ and pTEV5_PIPE_XhoI_3′. Following overnight cutting with DpnI, the fragments were mixed in equal volumes and transformed into chemically competent E. coli DH5α cells (Maniatis et al., 1982). The constructed plasmid results in the cblS coding sequence being inserted between the NheI and XhoI sites of pTEV5. The plasmid pGkCblS2 was used for protein overproduction.

pGkCblS3

The G. kaustophilus cblS+ coding sequence was amplified off pGkCBLS1 using primers Gk_cblS_EcoRI_5′ and Gk_cblTS_HindIII_3′. The DNA fragment was cut and inserted between the EcoRI and HindIII sites of pBAD24. The plasmid pGkCblS3 was used for complementation assays.

pCOBT81

The Salmonella enterica cobT+ coding sequence was excised from pJO27 (O’Toole et al., 1993) and subcloned into the SacI and HindIII sites of pBAD33 to yield plasmid pCOBT81. The plasmid pCOBT81 was used for constructing pCOBT140.

pCOBT140

The Salmonella enterica cobT+ coding sequence was amplified off pCOBT81 using primers Sal_CobT_BAD24_EcoRI_5′ and Sal_CobT_BAD24_XbaI_3′. The DNA fragment was inserted between the EcoRI and XbaI sites of pBAD24. The plasmid pCOBT140 was used for complementation assays and corrinoid analyses.

Growth analyses

Strains were grown at 37 °C in no-carbon essential (NCE) minimal medium (Berkowitz et al., 1968) supplemented with ribose (22 mM) as a carbon and energy source. Minimal medium also contained trace minerals, magnesium sulfate (1 mM), ampicillin (100 μg mL−1), and L(+)-arabinose (500 μM). Where indicated, 5,6-dimethylbenzimidazole (DMB, 200 μM), α-ribazole (α-R, 300 nM), dicyanocobinamide [(CN)2Cbi] (0.25 nM or 5 nM), and cyanocobalamin (CNCbl, 0.5 nM) were added. α-Ribazole was synthesized as reported (Gray & Escalante-Semerena, 2010). Growth analyses were performed in 96-well microtiter dishes, with each strain grown under indicated conditions in duplicate. Each well contained 200 μL of medium inoculated with 1% (v/v) of an overnight starter culture grown for at least 20 h on nutrient broth (Difco) to lower the level of residual nutrients in the medium. Cell density was monitored at 650 nm using a computer-controlled BioTek ELx808 absorbance plate reader (BioTek Instruments). Readings were acquired every 30 min with continuous shaking. Data were analyzed using the GraphPad Prism v4 software package (GraphPad Software).

Corrinoid extraction and analysis

Production

Strains were grown at 37 °C in NCE minimal medium supplemented with ribose (22 mM) as a carbon and energy source. Minimal medium also contained trace minerals, magnesium sulfate (1 mM), ampicillin (100 μg mL−1), (CN)2Cbi (300 nM), and L(+)-arabinose (500 μM). Where indicated, DMB or adenine (200 μM) was added. Culture medium (100 mL) was prepared in 500-mL baffled flasks and inoculated by the addition of 1% (v/v) of an overnight culture grown for at least 20 h in nutrient broth (NB, Difco). Cultures were grown for >20 h at 37 °C with shaking (150 rpm) (New Brunswick Innova 44R refrigerated incubator shaker). The cells were then harvested by centrifugation at 5,500 × g for 15 min (Beckman/Coulter Avanti J25-I centrifuge, equipped with a JLA-16.250 rotor). Cell pellets were resuspended in 5 mL of 100 mM ammonium acetate solution containing potassium cyanide (10 mM) at pH 4, and frozen at −20 °C until processed.

Extraction protocol

Cobamide extraction and isolation was performed using a modification of procedures reported elsewhere (Keller et al., 2014, Kittaka-Katsura et al., 2002). Briefly, frozen cell suspensions were thawed and incubated at 70 °C with constant shaking (100 rpm) for 2.5 h using a ThermoScientific MaxQ 4000 shaker. Cell debris was removed by centrifugation at 43,000 × g for 1 h (Beckman/Coulter Avanti J25-I centrifuge, equipped with a JA-25.25 rotor). The supernatant was passed over a 0.45-μm polyethersulfone syringe filter (VWR). Amberlite XAD4 resin (Rohm and Haas) was cleaned of impurities by washing with methanol, followed by extensive washing with water prior to use. Amberlite XAD4 resin (250 mg) was used per ml of extract, and allowed to incubate overnight at 37 °C with shaking to bind corrinoids. The unbound material was removed separated from the resin by suction, and the resin was washed with 10 volumes of MilliQ water (EMD Millipore). Two volumes of methanol were added to the resin and incubated overnight to desorb corrinoids. The methanol layer was pulled off, dispensed into a tube, and concentrated under vacuum (Eppendorf Vacufuge Plus) at 60 °C for 5.5 h at max speed (1400 rpm). The pellets were resupsended in 400 μL of a 1:4 ratio of buffer B (KH2PO4 (100 mM), KCN (10 mM), pH 8 + 50% (v/v) acetonitrile) and buffer C (KH2PO4 (100 mM), KCN (10 mM), pH 6.5). Resuspended samples were passed over a Costar® Spin-X® Centrifuge Tube Filter (Corning; 0.45 μM cellulose acetate) and incubated overnight at 4 °C.

Isolation

Ten-fold dilutions of the extracts were prepared and passed over a Costar® Spin-X® centrifuge tube filter (Corning; 0.45 μM cellulose acetate). The filtrates were dispensed into Prominence 12×32mm MT-IT autosampler vials (Shimadzu) and capped with 9-mm screw caps fitted with PTFE/Silicone septa (VWR). Cobamides were resolved by RP-HPLC using a Shimadzu Prominence UFLC equipped with a Phenomenex Synergi Hydro-RP (150 × 4.6 mm) as described (Blanche et al., 1990, Chan & Escalante-Semerena, 2011), with some modifications. The column was equilibrated at 20 % buffer B (see above) for 2.5 min at a flow rate of 1.0 mL min−1 and developed on a linear gradient to 35% buffer B over 9 min, further developed to100% buffer B over 7 min, and operated for 5 min at 100% buffer B. Corrinoids were detected at 367 nm on a computer-controlled Shimadzu Nexera X2 SPD-30A diode array detector. Fractions (0.5 mL ea.) were collected on a computer-controlled Shimadzu FRC-10 fraction collector between 7 and 20 min post injection.

Bioassay

Fractions were tested for the presence of complete corrinoids by bioassay. Agar plates containing NCE medium were supplemented with trace minerals, ribose (22 mM), and magnesium sulfate (1 mM) and antibiotic (chloramphenicol, 5 μg/mL; or kanamycin, 25 μg/mL). A 4-mL soft agar (0.7%, w/v) overlay was seeded with 100 μL of an overnight starter culture of indicator strains JE8214 (cobS) or JE12403 (cobS btuB) and poured over the minimal plates. Samples (2 μL ea.) of the fractions were spotted on the overlay and plates were incubated overnight at 37 °C. A halo of growth in the soft agar layer seeded with JE8214 (cobS) but not in the layer seeded with JE12403 (cobS btuB) indicated the presence of a cobamide. The diameter of the halo was recorded and compared to the HPLC trace. Cobamide identity was analyzed by MALDI-TOF mass spectrometry.

Purification of His6-tagged GkCblS protein

His6-tagged GkCblS was overproduced in JE13607 (BL21 (λDE3) cobT762::kan+) (Chan & Escalante-Semerena, 2011) using plasmid pGkCblS2 (cblS+). Cells were grown in 50 mL of Terrific Broth (Cold Spring Harbor Laboratory Protocols, http://cshprotocols.cshlp.org/content/2006/1/pdb.rec8620) overnight at 37 °C in a 250-mL flask. The cells were harvested by centrifugation at 6,000 × g using an Avanti J-20 XPI floor centrifuge equipped with a JLA-8.1000 rotor (Beckman Coulter). Eight grams of cell paste were frozen at −80 °C until use. Cell paste was resuspended in binding buffer containing HEPES (4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid, 50 mM), NaCl (500 mM), imidazole (10 mM), pH 7.3 @ 24 °C). The cell paste (g): buffer (ml) ratio used was 1:5. To ensure cell lysis, 15 mg of lysozyme was added to the suspension and the cell was allowed to incubate for 30 min at room temperature. The serine protease inhibitor phenylmethanesulfonyl fluoride (PMSF; Acros Organics) was added at a concentration of 200 μM. Cells were broken by sonication (3 cycles, 50% duty, 1.2-min cycle, 2 s on, 8 s off) with a 550 Sonic Dismembrator (Fisher Scientific). A salted ice bath was used to prevent enzyme inactivation due to heat. Cell debris was removed by centrifugation at 39,000 × g using an Avanti J-25I floor centrifuge with a JA-25.25 rotor (Beckman Coulter). The supernatant was passed over a 0.45-μm polyethersulfone syringe filter (VWR) to remove any remaining debris.

The filtered cell-free extract was loaded onto 5 mL of Ni-NTA affinity resin (HisPur; ThermoFisher Scientific) column. After loading, the column was washed with four column volumes using the following buffers: binding buffer (described above); washing buffer [HEPES (50 mM, pH 7.3), NaCl (500 mM), imidazole (150 mM)]; and elution buffer [HEPES (50 mM, pH 7.3), NaCl (500 mM), imidazole (750 mM), tris(2-carboxyethyl)phosphine (TCEP, 5 mM), glycerol (5%, v/v)]. The final elutant was concentrated using an Amicon-15 concentrator (MWCO 10 kDa; Millipore) for 13 min at 3,220 × g (Eppendorf 5810). The concentrate was dialyzed against decreasing salt concentrations down to 250 mM NaCl. The first dialysis also included EDTA (0.5 mM) for nickel chelation. The final protein concentration was quantified using a microtiter plate protocol for the Bradford protein assay (Bradford, 1976) using a commercially available kit (BioRad). Purified protein was flash frozen in liquid nitrogen and stored at −80 °C until used.

Assessment of α–ribazole kinase activity

In vitro activity assay

The enzymatic activity of purified His6-GkCblS protein was assayed using a modification of the α-R kinase assay (Gray & Escalante-Semerena, 2010). Reaction mixtures (100 μL) contained HEPES buffer (50 mM, pH 7.4), MgCl2 (5 mM), KCl (750 mM), TCEP (5 mM), ATP (0.5 mM), α-ribazole (0.25 mM) and protein (3 μg); α-R was obtained as described (Gray & Escalante-Semerena, 2010). Reactions were incubated for 3 h at 37 °C in a BioRad DNA Engine Dyad ThermoCycler, and stopped by heating for 10 min at 80 °C. A sample (120 μL) of ammonium acetate (20 mM) at pH 4.5 was added to the reactions, which were then passed over a Costar® Spin-X® Centrifuge Tube Filter (Corning; 0.45 μM cellulose acetate). The filtrates were dispensed into Prominence 12×32mm MT-IT autosampler vials (Shimadzu) and capped with 9-mm screw caps fitted with PTFE/Silicone septa (VWR).

HPLC analysis

The product of the kinase assay was resolved by RP-HPLC using a modification of the described separation protocol for α-RP (Gray & Escalante-Semerena, 2010). A Shimadzu Prominence UFLC equipped with a Kinetex 5μ C18 column (150 × 4.6 mm; Phenomenex) and a SecurityGuard ULTRA guard column (C18 cartridge; Phenomenex) was equilibrated at a flow rate of 0.8 mL min−1 with 3% (v/v) acetonitrile/97% (v/v) of ammonium acetate (20 mM, pH 4.5). After injection, the column was developed for 12 min to 40% (v/v) acetonitrile and then 5 min to 80% (v/v) acetonitrile. Compounds were detected at 287 nm using a computer-controlled Shimadzu Nexera X2 SPD-30A diode array detector. As a reference for the formation of α-ribazole-5′-phosphate (α-RP), retention time and spectra of the product peak were compared to the product formed as a result of the described SeCobT activity assay (Claas et al., 2010, Chan & Escalante-Semerena, 2011) for the formation of α-RP from DMB and NaMN. Data were analyzed using the GraphPad Prism v4 software package (GraphPad Software).

Supplementary Material

Supp data

Acknowledgments

The authors do not have a conflict of interest. This work was supported by USPHS grant R37 GM40313 from the National Institutes of General Medical Sciences to J. C. E.-S. The authors thank Dr. Dennis Phillips and the University of Georgia Proteomics and Mass Spectrometry Core Facility for technical assistance.

References

  1. Anderson PJ, Lango J, Carkeet C, Britten A, Kräutler B, Hammock BD, Roth JR. One pathway can incorporate either adenine or dimethylbenzimidazole as an alpha-axial ligand of B12 cofactors in Salmonella enterica. J Bacteriol. 2008;190:1160–1171. doi: 10.1128/JB.01386-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Berkowitz D, Hushon JM, Whitfield HJ, Jr, Roth J, Ames BN. Procedure for identifying nonsense mutations. J Bacteriol. 1968;96:215–220. doi: 10.1128/jb.96.1.215-220.1968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Blanche F, Thibaut D, Couder M, Muller JC. Identification and quantitation of corrinoid precursors of cobalamin from Pseudomonas denitrificans by high-performance liquid chromatography. Anal Biochem. 1990;189:24–29. doi: 10.1016/0003-2697(90)90038-b. [DOI] [PubMed] [Google Scholar]
  4. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  5. Campbell GR, Taga ME, Mistry K, Lloret J, Anderson PJ, Roth JR, Walker GC. Sinorhizobium meliloti bluB is necessary for production of 5,6-dimethylbenzimidazole, the lower ligand of B12. Proc Natl Acad Sci U S A. 2006;103:4634–4369. doi: 10.1073/pnas.0509384103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Castilho BA, Olfson P, Casadaban MJ. Plasmid insertion mutagenesis and lac gene fusion with mini-Mu bacteriophage transposons. J Bacteriol. 1984;158:488–495. doi: 10.1128/jb.158.2.488-495.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chan CH, Escalante-Semerena JC. ArsAB, a novel enzyme from Sporomusa ovata activates phenolic bases for adenosylcobamide biosynthesis. Mol Microbiol. 2011;81:952–967. doi: 10.1111/j.1365-2958.2011.07741.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chan CH, Newmister SA, Talyor K, Claas KR, Rayment I, Escalante-Semerena JC. Dissecting cobamide diversity through structural and functional analyses of the base-activating CobT enzyme of Salmonella enterica. Biochim Biophys Acta. 2014;1840:464–475. doi: 10.1016/j.bbagen.2013.09.038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cheong CG, Escalante-Semerena JC, Rayment I. Structural investigation of the biosynthesis of alternative lower ligands for cobamides by nicotinate mononucleotide: 5,6-dimethylbenzimidazole phosphoribosyltransferase from Salmonella enterica. J Biol Chem. 2001;276:37612–37620. doi: 10.1074/jbc.M105390200. [DOI] [PubMed] [Google Scholar]
  10. Claas KR, Parrish JR, Maggio-Hall LA, Escalante-Semerena JC. Functional analysis of the nicotinate mononucleotide:5,6-dimethylbenzimidazole phosphoribosyltransferase (CobT) enzyme, involved in the late steps of coenzyme B12 biosynthesis in Salmonella enterica. J Bacteriol. 2010;192:145–154. doi: 10.1128/JB.01159-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Crofts TS, Men Y, Alvarez-Cohen L, Taga ME. A bioassay for the detection of benzimidazoles reveals their presence in a range of environmental samples. Front Microbiol. 2014;5:592. doi: 10.3389/fmicb.2014.00592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Escalante-Semerena JC. Conversion of cobinamide into adenosylcobamide in bacteria and archaea. J Bacteriol. 2007;189:4555–4560. doi: 10.1128/JB.00503-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Escalante-Semerena JC, Roth JR. Regulation of cobalamin biosynthetic operons in Salmonella typhimurium. J Bacteriol. 1987;169:2251–2258. doi: 10.1128/jb.169.5.2251-2258.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Escalante-Semerena JC, Warren MJ. In: Biosynthesis and Use of Cobalamin (B12). In: EcoSal - Escherichia coli and Salmonella: cellular and molecular biology. Böck A, Curtiss R III, Kaper JB, Karp PD, Neidhardt FC, Nyström T, Slauch JM, Squires CL, editors. Washington, D. C: ASM Press; 2008. [Google Scholar]
  15. Friedmann HC, Fyfe JA. Pseudovitamin B12 biosynthesis. Enzymatic formation of a new adenylic acid, 7-α-D-ribofuranosyladenine 5′-phosphate. J Biol Chem. 1969;244:1667–1671. [PubMed] [Google Scholar]
  16. Gray MJ, Escalante-Semerena JC. Single-enzyme conversion of FMNH2 to 5,6-dimethylbenzimidazole, the lower ligand of B12. Proc Natl Acad Sci U S A. 2007;104:2921–2926. doi: 10.1073/pnas.0609270104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gray MJ, Escalante-Semerena JC. A new pathway for the synthesis of alpha-ribazole-phosphate in Listeria innocua. Mol Microbiol. 2010;77:1429–1438. doi: 10.1111/j.1365-2958.2010.07294.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Guzman LM, Belin D, Carson MJ, Beckwith J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J Bacteriol. 1995;177:4121–4130. doi: 10.1128/jb.177.14.4121-4130.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hazra AB, Han AW, Mehta AP, Mok KC, Osadchiy V, Begley TP, Taga ME. Anaerobic biosynthesis of the lower ligand of vitamin B12. Proc Natl Acad Sci U S A. 2015;112:10792–10797. doi: 10.1073/pnas.1509132112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Jeter RM, Olivera BM, Roth JR. Salmonella typhimurium synthesizes cobalamin (vitamin B12) de novo under anaerobic growth conditions. J Bacteriol. 1984;159:206–213. doi: 10.1128/jb.159.1.206-213.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Jeter RM, Roth JR. Cobalamin (vitamin B12) biosynthetic genes of Salmonella typhimurium. J Bacteriol. 1987;169:3189–3198. doi: 10.1128/jb.169.7.3189-3198.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Johnson WM, Kido Soule MC, Kujawinski EB. Evidence for quorum sensing and differential metabolite production by a marine bacterium in response to DMSP. ISME J. 2016 doi: 10.1038/ismej.2016.6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Keck B, Munder M, Renz P. Biosynthesis of cobalamin in Salmonella typhimurium: transformation of riboflavin into the 5,6-dimethylbenzimidazole moiety. Arch Microbiol. 1998;171:66–68. doi: 10.1007/s002030050679. [DOI] [PubMed] [Google Scholar]
  24. Keck B, Renz P. Salmonella typhimurium forms adenylcobamide and 2-methyladenylcobamide, but no detectable cobalamin during strictly anaerobic growth. Arch Microbiol. 2000;173:76–77. doi: 10.1007/s002030050011. [DOI] [PubMed] [Google Scholar]
  25. Keller S, Ruetz M, Kunze C, Krautler B, Diekert G, Schubert T. Exogenous 5,6-dimethylbenzimidazole caused production of a non-functional tetrachloroethene reductive dehalogenase in Sulfurospirillum multivorans. Environmental Microbiology. 2014;16:3361–3369. doi: 10.1111/1462-2920.12268. [DOI] [PubMed] [Google Scholar]
  26. Kittaka-Katsura H, Fujita T, Watanabe F, Nakano Y. Purification and characterization of a corrinoid compound from Chlorella tablets as an algal health food. J Agric Food Chem. 2002;50:4994–4997. doi: 10.1021/jf020345w. [DOI] [PubMed] [Google Scholar]
  27. Klock HE, Koesema EJ, Knuth MW, Lesley SA. Combining the polymerase incomplete primer extension method for cloning and mutagenesis with microscreening to accelerate structural genomics efforts. Prot-Struct Funct Bioinformat. 2008;71:982–994. doi: 10.1002/prot.21786. [DOI] [PubMed] [Google Scholar]
  28. Maniatis T, Fritsch EF, Sambrook J. Introduction of plasmid and bacteriophage lambda into Escherichia coli. In: Maniatis T, Fritsch EF, Sambrook J, editors. Molecular cloning: a laboratory manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory; 1982. pp. 250–251. [Google Scholar]
  29. Martinez-Gomez NC, Downs DM. ThiC is an [Fe-S] cluster protein that requires AdoMet to generate the 4-amino-5-hydroxymethyl-2-methylpyrimidine moiety in thiamin synthesis. Biochemistry. 2008;47:9054–9056. doi: 10.1021/bi8010253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Martinez-Gomez NC, Poyner RR, Mansoorabadi SO, Reed GH, Downs DM. Reaction of AdoMet with ThiC generates a backbone free radical. Biochemistry. 2009;48:217–219. doi: 10.1021/bi802154j. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. O’Toole GA, Rondon MR, Escalante-Semerena JC. Analysis of mutants of defective in the synthesis of the nucleotide loop of cobalamin. J Bacteriol. 1993;175:3317–3326. doi: 10.1128/jb.175.11.3317-3326.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Pakin C, Bergaentzle M, Aoude-Werner D, Hasselmann C. α-Ribazole, a fluorescent marker for the liquid chromatographic determination of vitamin B12 in foodstuffs. Journal of chromatography A. 2005;1081:182–189. doi: 10.1016/j.chroma.2005.05.066. [DOI] [PubMed] [Google Scholar]
  33. Rocco CJ, Dennison KL, Klenchin VA, Rayment I, Escalante-Semerena JC. Construction and use of new cloning vectors for the rapid isolation of recombinant proteins from Escherichia coli. Plasmid. 2008;59:231–237. doi: 10.1016/j.plasmid.2008.01.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Rodionov DA, Vitreschak AG, Mironov AA, Gelfand MS. Comparative genomics of the vitamin B12 metabolism and regulation in prokaryotes. J Biol Chem. 2003;278:41148–41159. doi: 10.1074/jbc.M305837200. [DOI] [PubMed] [Google Scholar]
  35. Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H, Remmert M, Soding J, Thompson JD, Higgins DG. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol. 2011;7:539. doi: 10.1038/msb.2011.75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Tabor S, Richardson CC. A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes. Biotechnology. 1992;24:280–284. [PubMed] [Google Scholar]
  37. Taga ME, Larsen NA, Howard-Jones AR, Walsh CT, Walker GC. BluB cannibalizes flavin to form the lower ligand of vitamin B12. Nature. 2007;446:449–453. doi: 10.1038/nature05611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Trzebiatowski JR, Escalante-Semerena JC. Purification and characterization of CobT, the nicotinate-mononucleotide:5,6-dimethylbenzimidazole phosphoribosyltransferase enzyme from Salmonella typhimurium LT2. J Biol Chem. 1997;272:17662–17667. doi: 10.1074/jbc.272.28.17662. [DOI] [PubMed] [Google Scholar]
  39. Trzebiatowski JR, O’Toole GA, Escalante-Semerena JC. The cobT gene of Salmonella typhimurium encodes the NaMN: 5,6-dimethylbenzimidazole phosphoribosyltransferase responsible for the synthesis of N1-(5-phospho-alpha-D-ribosyl)-5,6-dimethylbenzimidazole, an intermediate in the synthesis of the nucleotide loop of cobalamin. J Bacteriol. 1994;176:3568–3575. doi: 10.1128/jb.176.12.3568-3575.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Tsang AW, Escalante-Semerena JC. CobB, a new member of the SIR2 family of eucaryotic regulatory proteins, is required to compensate for the lack of nicotinate mononucleotide:5,6-dimethylbenzimidazole phosphoribosyltransferase activity in cobT mutants during cobalamin biosynthesis in Salmonella typhimurium LT2. J Biol Chem. 1998;273:31788–31794. doi: 10.1074/jbc.273.48.31788. [DOI] [PubMed] [Google Scholar]
  41. Zayas CL, Escalante-Semerena JC. Reassessment of the late steps of coenzyme B12 synthesis in Salmonella enterica: Evidence that dephosphorylation of adenosylcobalamin-5′-phosphate by the CobC phosphatase is the last step of the pathway. J Bacteriol. 2007;189:2210–2218. doi: 10.1128/JB.01665-06. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp data
NIHMS826767-supplement-Supp_data.pdf (585.2KB, pdf)

RESOURCES