Skip to main content
NCBI home page
Scientific Reports logoLink to Scientific Reports
. 2017 Jan 9;7:40024. doi: 10.1038/srep40024

Regulation of FADS2 transcription by SREBP-1 and PPAR-α influences LC-PUFA biosynthesis in fish

Xiaojing Dong 1, Peng Tan 1, Zuonan Cai 1, Hanlin Xu 1, Jingqi Li 1, Wei Ren 1, Houguo Xu 1, Rantao Zuo 1, Jianfeng Zhou 3, Kangsen Mai 1,2, Qinghui Ai 1,2,a
PMCID: PMC5220380  PMID: 28067297

Abstract

The present study was conducted to explore the mechanisms leading to differences among fishes in the ability to biosynthesize long-chain polyunsaturated fatty acids (LC-PUFAs). Replacement of fish oil with vegetable oil caused varied degrees of increase in 18-carbon fatty acid content and decrease in n-3 LC-PUFA content in the muscle and liver of rainbow trout (Oncorhynchus mykiss), Japanese seabass (Lateolabrax japonicus) and large yellow croaker (Larimichthys crocea), suggesting that these fishes have differing abilities to biosynthesize LC-PUFAs. Fish oil replacement also led to significantly up-regulated expression of FADS2 and SREBP-1 but different responses of the two PPAR-α homologues in the livers of these three fishes. An in vitro experiment indicated that the basic transcription activity of the FADS2 promoter was significantly higher in rainbow trout than in Japanese seabass or large yellow croaker, which was consistent with their LC-PUFA biosynthetic abilities. In addition, SREBP-1 and PPAR-α up-regulated FADS2 promoter activity. These regulatory effects varied considerably between SREBP-1 and PPAR-α, as well as among the three fishes. Taken together, the differences in regulatory activities of the two transcription factors targeting FADS2 may be responsible for the different LC-PUFA biosynthetic abilities in these three fishes that have adapted to different ambient salinity.

Decreasing global availability, coupled with the high cost of fish oil, has forced the aquaculture industry to investigate possible alternative sources of dietary lipids. Vegetable oils stand out as the most likely candidates for partial substitutes for fish oils in fish feeds because of their lower price and higher levels of production. Some vegetable oils, such as soybean oil and linseed oil, are considered good alternative lipid sources for salmonids and freshwater fish1,2,3. Although replacing fish oil with vegetable oil generally does not affect the overall health and growth of the fish, most studies have shown that the fish possess reduced levels of long-chain polyunsaturated fatty acids (LC-PUFAs), particularly of DHA and EPA, which are indispensable for their growth and nutrition4,5,6,7.

In comparison with freshwater fish, marine fish species generally lack the ability to synthesize LC-PUFAs from their 18-carbon precursor fatty acids8,9. However, euryhaline fish commonly show varying levels of capacity to synthesize LC-PUFAs, depending on the ambient salinity10,11,12. Because FADS2 has been shown to catalyse the first limiting step in the LC-PUFA biosynthesis pathway in mammals, special attention has been given to characterization of the FADS2 product13,14. Thus, FADS2 has been cloned, and its nutritional regulation has been widely investigated in many fish species15,16,17,18,19,20,21,22,23,24,25. Although the expression level of FADS2 generally indicates the capacity for LC-PUFA synthesis in fish16,26, the underlying mechanisms by which FADS2 expression is regulated have rarely been reported.

Two transcription factors, SREBP and PPAR, are involved in the regulation of fatty acid biosynthesis in mammals27,28,29,30,31,32,33, by binding to sterol regulatory elements (SREs)27,34 and peroxisome proliferator response elements (PPREs)35, respectively. In fish, previous studies have shown that SREBP-1 is related to fatty acid metabolism36,37 and that the gene expression of SREBP-1 and PPAR-α can be regulated by dietary fatty acids33. However, it remains unclear whether these two factors are involved in fatty acid biosynthesis by targeting FADS2.

In the present study, a 70 d feeding experiment was conducted on rainbow trout, Japanese seabass and large yellow croaker to comprehensively compare the effects of different levels of vegetable oil substitution on tissue fatty acid composition and on the expression of genes related to LC-PUFA biosynthesis (FADS2, SREBP-1 and PPAR-α). Then, an in vitro experiment was conducted to investigate the activity of SREBP-1 and PPAR-α in regulating the expression of the FADS2 gene promoter.

Results

Growth and survival performance

In rainbow trout, partial or total replacement of fish oil with vegetable oil had no significant effects on SGR, FER, SR and FI compared with the control group. In Japanese seabass, however, increasing the level at which fish oil was replaced with vegetable oil significantly decreased the SGR, FER, FI and SR (P < 0.05), although the survival rate showed no significant difference between the FV and VO groups. For large yellow croaker, SGR, FER and SR were significantly reduced by fish oil substitution; however, no significant difference was observed between the 50% and 100% substitutions. Interestingly, fish oil replacement showed no influence on feed intake in large yellow croaker, which was also true with rainbow trout (Table 1).

Table 1. Growth performance and survival rates of three fishes fed experimental diets with vegetable oil instead of fish oil (Mean ± SEM)*.

  RFO1 RFV2 RVO3 JFO4 JFV5 JVO6 LFO7 LFV8 LVO9
IBW10 (g) 11.36 ± 0.34 11.24 ± 0.31 11.14 ± 0.32 18.66 ± 0.36 18.55 ± 0.28 18.59 ± 1.07 9.00 ± 0.41 9.09 ± 0.23 8.69 ± 0.46
FBW11 (g) 47.68 ± 1.42 50.95 ± 2.27 48.36 ± 1.90 86.83 ± 1.76a 76.90 ± 1.56b 52.66 ± 1.15c 31.51 ± 1.19a 27.64 ± 0.81b 23.69 ± 0.77c
SGR12 (g d−1) 1.95 ± 0.04 2.00 ± 0.07 1.95 ± 0.06 2.19 ± 0.02a 2.01 ±  ± 0.02b 1.49 ± 0.03c 1.79 ± 0.08a 1.59 ± 0.05ab 1.43 ± 0.05b
FER13 0.68 ± 0.02 0.72 ± 0.02 0.69 ± 0.01 0.90 ± 0.01a 0.75 ± 0.02b 0.46 ± 0.01c 0.64 ± 0.03a 0.54 ± 0.02b 0.52 ± 0.03b
FI14 (% d−1) 2.51 ± 0.05 2.41 ± 0.02 2.44 ± 0.03 1.84 ± 0.01a 1.74 ± 0.01b 1.37 ± 0.02c 2.52 ± 0.04 2.64 ± 0.04 2.56 ± 0.06
SR15 (%) 98.67 ± 1.33 98.67 ± 1.33 94.67 ± 1.33 78.89 ± 1.11a 63.33 ± 1.92b 65.56 ± 2.22b 88.33 ± 0.96a 67.22 ± 1.26b 62.78 ± 1.82b
Open in a new tab

*The statistical analysis was conducted in each fish species.

1RFO: 100% Fish oil as lipid source (control) in rainbow trout.

2RFV: Vegetable oil blend (linseed oil: soya bean oil = 1:1) replacing 50% of fish oil in rainbow trout.

3RVO: 100% Vegetable oil blend as lipid source in rainbow trout.

4JFO: 100% Fish oil as lipid source (control) in Japanese seabass.

5JFV: Vegetable oil blend (linseed oil: soya bean oil = 1:1) replacing 50% of fish oil in Japanese seabass.

6JVO: 100% Vegetable oil blend as lipid source in Japanese seabass.

7LFO: 100% Fish oil as lipid source (control) in large yellow croaker.

8LFV: Vegetable oil blend (linseed oil: soya bean oil = 1:1) replacing 50% of fish oil in large yellow croaker.

9LVO: 100% Vegetable oil blend as lipid source in large yellow croaker.

10IBW: Initial body weight.

11FBW: Final body weight.

12SGR = 100 × (ln Wt − ln W0)/t.

13FER = (Wt − W0)/dry feed intake.

14FI = 100 × dry feed intake × 2/(W0 + Wt)/t.

15SR = 100 × final amount of fish/initial amount of fish.

Fatty acid compositions in the liver and muscle

Vegetable oil substitution caused an increase in 18-carbon fatty acids, such as C18:3n-3 and C18:2n-6, in both the livers and muscles of all three fishes, especially in the liver of large yellow croaker, in which the increases reached 4.5-fold (from 1.49 mg/g to 6.74 mg/g) and 5-fold (from 6.8 mg/g to 34.64 mg/g) in the 50% and 100% replacement groups, respectively. The fish fed 50% or 100% vegetable oil showed significantly lower contents of n-3 LC-PUFAs in the muscle and liver than did the fish fed fish oil. The decrease was greatest in large yellow croaker; for example, C20:5n-3 content in muscle decreased from 2.58 mg/g (FO) to 0.84 mg/g (FV) and 0.15 mg/g (VO). However, no significant difference was observed in the C22:6n-3 content of the muscle between rainbow trout fed 50% vegetable oil and those fed 100% fish oil (Tables 2 and 3).

Table 2. Muscle fatty acid contents of three fishes fed the experimental diets with vegetable oil instead of fish oil (mg/g, Mean ± SEM)*.

Fatty acid RFO1 RFV2 RVO3 JFO4 JFV5 JVO6 LFO7 LFV8 LVO9
C14:0 1.09 ± 0.00a 0.75 ± 0.00b 0.75 ± 0.02b 1.09 ± 0.00a 0.79 ± 0.01c 0.86 ± 0.02b 1.76 ± 0.08a 1.20 ± 0.03b 0.78 ± 0.01c
C16:0 4.35 ± 0.00a 3.41 ± 0.18b 3.21 ± 0.09b 2.95 ± 0.18a 1.90 ± 0.07b 2.22 ± 0.07b 7.17 ± 0.43a 6.04 ± 0.29a 4.24 ±  ± 0.38b
C18:0 1.40 ± 0.01 1.36 ± 0.12 1.59 ± 0.00 1.50 ±  ± 0.06a 1.08 ± 0.03b 1.44 ± 0.04a 2.98 ± 0.09 3.01 ± 0.31 2.48 ± 0.22
∑SFA10 6.84 ± 0.02a 5.53 ± 0.30b 5.55 ± 0.09b 5.54 ± 0.25a 3.78 ± 0.10c 4.52 ± 0.11b 11.90 ± 0.51a 10.25 ± 0.61a 7.51 ± 0.59b
C16:1 0.96 ± 0.09a 0.49 ± 0.04b 0.29 ± 0.01b 0.41 ± 0.06a 0.24 ± 0.03b 0.15 ± 0.01b 2.51 ± 0.53a 1.33 ± 0.19ab 0.38 ± 0.05b
C18:1 3.40 ± 0.43ab 4.48 ± 0.28a 2.30 ± 0.10b 1.99 ± 0.39 1.76 ± 0.18 2.03 ± 0.09 8.66 ± 0.53a 7.97 ± 0.68a 4.64 ± 0.71b
∑MUFA11 4.36 ± 0.52a 4.97 ± 0.26a 2.59 ± 0.10b 2.40 ± 0.44 2.00 ± 0.18 2.18 ± 0.10 11.18 ± 0.64a 9.31 ± 0.86a 5.01 ± 0.71b
C18:2n-6 2.58 ± 0.57b 5.39 ± 0.44a 5.61 ± 0.31a 1.89 ± 0.43b 2.44 ± 0.38b 4.46 ± 0.27a 7.41 ± 0.04b 11.85 ± 0.46a 14.55 ± 1.24a
C20:4n-6 0.20 ± 0.01a 0.14 ± 0.00b 0.11 ± 0.01b 0.22 ± 0.02a 0.17 ± 0.01ab 0.14 ± 0.01b 0.28 ± 0.04a 0.16 ± 0.01b 0.10 ± 0.00b
∑n-6 PUFA12 2.78 ± 0.59b 5.53 ± 0.44a 2.72 ± 0.31b 2.11 ± 0.40b 2.62 ± 0.38b 4.60 ± 0.27a 7.70 ± 0.04b 12.01 ± 0.47a 14.65 ± 1.24a
C18:3n-3 0.30 ± 0.03b 1.14 ± 0.26a 0.95 ± 0.09a 0.27 ± 0.06c 0.66 ± 0.03b 1.21 ±  ± 0.11a 0.54 ± 0.22b 4.59 ± 0.59a 5.76 ± 1.51a
C20:5n-3 0.82 ± 0.10a 0.47 ± 0.05b 0.12 ± 0.00c 0.64 ± 0.05a 0.44 ± 0.04b 0.18 ± 0.01c 2.58 ± 0.26a 0.84 ± 0.06b 0.15 ± 0.02c
C22:6n-3 5.24 ± 0.32a 4.59 ± 0.21a 1.10 ± 0.10b 2.28 ± 0.06a 1.65 ± 0.11b 0.82 ± 0.06c 5.25 ± 0.40a 2.05 ± 0.21b 0.64 ± 0.11c
∑n-3 PUFA13 6.36 ± 0.45a 6.20 ± 0.28a 2.18 ± 0.18b 3.18 ± 0.05a 2.75 ± 0.13a 2.22 ± 0.15b 8.38 ± 0.44 7.47 ± 0.87 6.54 ± 1.62
∑n-3/∑n-6 PUFA 2.39 ± 0.26a 1.13 ± 0.09b 0.81 ± 0.03b 1.65 ± 0.36a 1.10 ± 0.19ab 0.48 ± 0.01b 1.09 ± 0.06a 0.62 ± 0.05b 0.45 ± 0.09b
∑n-3 LC-PUFA 6.06 ± 0.42a 5.06 ± 0.25a 1.23 ± 0.10b 2.91 ± 0.11a 2.09 ± 0.15b 1.01 ± 0.06c 7.84 ± 0.66a 2.89 ± 0.28b 0.79 ± 0.13c
Total fatty acids 21.58 ± 1.55a 26.36 ± 1.97a 14.43 ± 0.68b 14.29 ± 0.68 12.86 ± 0.71 14.63 ± 0.81 41.10 ± 1.63 39.99 ± 2.38 39.42 ± 3.76
Open in a new tab

*Values in the same row with no common superscript letters are significantly different (P < 0.05). Some fatty acids that were present in only minor or trace amounts or that were not detected, such as C22:0, C24:0, C14:1, C20:2n-6 and C20:3n-6, are not listed in the table.

1RFO: 100% Fish oil as lipid source (control) in rainbow trout.

2RFV: Vegetable oil blend (linseed oil: soya bean oil = 1:1) replacing 50% of fish oil in rainbow trout.

3RVO: 100% Vegetable oil blend as lipid source in rainbow trout.

4JFO: 100% Fish oil as lipid source (control) in Japanese seabass.

5JFV: Vegetable oil blend (linseed oil: soya bean oil = 1:1) replacing 50% of fish oil in Japanese seabass.

6JVO: 100% Vegetable oil blend as lipid source in Japanese seabass.

7LFO: 100% Fish oil as lipid source (control) in large yellow croaker.

8LFV: Vegetable oil blend (linseed oil: soya bean oil = 1:1) replacing 50% of fish oil in large yellow croaker.

9LVO: 100% Vegetable oil blend as lipid source in large yellow croaker.

10SFA: Saturated fatty acid.

11MUFA: Monounsaturated fatty acid.

12n-6 PUFA: n-6 poly-unsaturated fatty acid.

13n-3 PUFA: n-3 poly-unsaturated fatty acid.

Table 3. Liver fatty acid contents of three fish fed the experimental diets with vegetable oil instead of fish oil1 (mg/g, Mean ± SEM)*.

Fatty acid RFO1 RFV2 RVO3 JFO4 JFV5 JVO6 LFO7 LFV8 LVO9
C14:0 0.49 ± 0.09a 0.27 ± 0.00b 0.20 ± 0.00b 1.42 ± 0.17 1.56 ± 0.03 1.70 ± 0.06 1.56 ± 0.19a 0.97 ± 0.02b 0.77 ± 0.07b
C16:0 8.66 ± 0.10a 6.61 ± 0.15b 6.70 ± 0.23b 8.57 ± 0.04b 8.42 ± 0.33b 10.36 ± 0.37a 17.43 ± 0.79a 18.61 ± 0.71a 14.16 ± 0.32b
C18:0 5.23 ± 0.11 5.45 ± 0.08 4.66 ± 0.32 4.25 ± 0.11b 4.65 ± 0.23b 6.81 ± 0.17a 10.44 ± 0.36c 14.35 ± 0.35a 12.59 ± 0.17b
∑SFA10 14.38 ± 0.19a 12.33 ± 0.13b 11.56 ± 0.30b 14.25 ± 0.32b 14.64 ± 0.56b 18.87 ± 0.48a 29.01 ± 1.01b 33.93 ± 0.61a 27.52 ± 0.22b
C16:1 1.63 ± 0.27a 0.62 ± 0.01b 0.38 ± 0.06b 2.33 ± 0.18 2.35 ± 0.07 2.30 ± 0.13 5.59 ± 0.33a 4.98 ± 0.19ab 3.85 ± 0.35b
C18:1 6.99 ± 0.45b 5.73 ± 0.25b 10.48 ± 0.71a 10.41 ± 0.31c 123.23 ± 0.15b 32.08 ± 0.61a 24.55 ± 0.89c 28.81 ± 0.34b 32.30 ± 0.09a
∑MUFA11 8.63 ± 0.40b 6.35 ± 0.24c 10.86 ± 0.77a 12.74 ± 0.49c 25.58 ± 0.22b 34.27 ± 0.68a 30.13 ± 1.10b 33.79 ± 0.53a 36.15 ± 0.27a
C18:2n-6 3.04 ± 0.45b 3.42 ± 0.11b 6.18 ± 0.21a 3.33 ± 0.29b 2.66 ± 0.35b 5.40 ± 0.39a 6.80 ± 0.40c 15.28 ± 0.29b 34.64 ± 0.26a
C20:4n-6 1.87 ± 0.16b 1.74 ± 0.34b 2.29 ± 0.41a 0.10 ± 0.00a 0.06 ± 0.01b 0.03 ± 0.00c 0.24 ± 0.02a 0.15 ± 0.01b 0.05 ± 0.02c
∑n-6 PUFA12 4.91 ± 0.54b 5.16 ± 0.15b 8.48 ± 0.23a 3.43 ± 0.29b 2.71 ± 0.36b 5.45 ± 0.38a 7.04 ± 0.39c 15.43 ± 0.30b 34.69 ± 0.27a
C18:3n-3 0.53 ± 0.09b 0.51 ± 0.02b 1.09 ± 0.03a 0.48 ± 0.08b 0.70 ± 0.08ab 0.84 ± 0.06a 1.49 ± 0.12c 4.36 ± 0.30b 6.74 ± 0.06a
C20:5n-3 1.29 ± 0.13a 0.72 ± 0.02b 0.78 ± 0.08b 0.20 ± 0.01a 0.06 ± 0.01b 0.03 ± 0.00c 1.34 ± 0.08a 0.71 ± 0.06b 0.14 ± 0.00c
C22:6n-3 18.60 ± 1.37a 13.38 ± 0.15b 11.89 ± 1.64b 0.65 ± 0.03a 0.16 ± 0.03b 0.07 ± 0.01b 2.64 ± 0.08a 1.21 ± 0.07b 0.27 ± 0.04c
∑n-3 PUFA13 20.42 ± 1.60a 14.61 ± 0.15b 13.76 ± 1.73b 1.33 ± 0.12a 1.34 ± 0.22a 0.94 ± 0.05b 5.47 ± 0.04b 6.27 ± 0.41ab 7.16 ± 0.01a
∑n-3/∑n-6 PUFA 4.21 ± 0.31a 2.84 ± 0.05b 1.62 ± 0.18c 0.39 ± 0.00a 0.34 ± 0.03a 0.17 ± 0.02b 0.78 ± 0.04a 0.41 ± 0.02b 0.21 ± 0.00c
∑n-3 LC-PUFA 19.89 ± 1.50a 14.10 ± 0.14b 12.67 ± 1.72b 0.85 ± 0.03a 0.22 ± 0.04b 0.10 ± 0.01b 3.98 ± 0.15a 1.92 ± 0.13b 0.42 ± 0.05c
Total fatty acids 43.35 ± 0.16 42.59 ± 1.61 45.28 ± 1.55 34.05 ± 1.37c 47.37 ± 1.30b 62.20 ± 0.91a 79.85 ± 3.15c 90.13 ± 3.51ab 104.86 ± 4.87a
Open in a new tab

*Values in the same row with no common superscript letters are significantly different (P < 0.05). Some fatty acids that were present in only minor or trace amounts or that were not detected, such as C22:0, C24:0, C14:1, C20:2n-6 and C20:3n-6, are not listed in the table.

1RFO: 100% Fish oil as lipid source (control) in rainbow trout.

2RFV: Vegetable oil blend (linseed oil: soya bean oil = 1:1) replacing 50% of fish oil in rainbow trout.

3RVO: 100% Vegetable oil blend as lipid source in rainbow trout.

4JFO: 100% Fish oil as lipid source (control) in Japanese seabass.

5JFV: Vegetable oil blend (linseed oil: soya bean oil = 1:1) replacing 50% of fish oil in Japanese seabass.

6JVO: 100% Vegetable oil blend as lipid source in Japanese seabass.

7LFO: 100% Fish oil as lipid source (control) in large yellow croaker.

8LFV: Vegetable oil blend (linseed oil: soya bean oil = 1:1) replacing 50% of fish oil in large yellow croaker.

9LVO: 100% Vegetable oil blend as lipid source in large yellow croaker.

10SFA: Saturated fatty acid.

11MUFA: Monounsaturated fatty acid.

12n-6 PUFA: n-6 poly-unsaturated fatty acid.

13n-3 PUFA: n-3 poly-unsaturated fatty acid.

Cloning and characterization of the promoter and cDNA

The upstream sequences adjacent to the translation start codon of FADS2 in rainbow trout and large yellow croaker were cloned by genome walking, and the fragments were 1479 bp and 996 bp in length, respectively. The promoter sequence of Japanese seabass was published in our previous study24. Alignment analysis showed that the FADS2 promoters of rainbow trout, Japanese seabass and large yellow croaker possess transcription factor binding elements including those for nuclear factor Y (NF-Y) and SRE, as in European sea bass and Atlantic salmon, but they lack Sp1 elements (Fig. 1).

Figure 1. Alignment of FADS2 promoter fragments among fish.

Figure 1

Open in a new tab

The numbers indicate sequence position relative to the translation initiation site (ATG). Binding sites are indicated based on previous work from Zheng36 and Geay56.

The full lengths of the putative SREBP-1 cDNAs from rainbow trout (GenBank accession number: KP342261) and large yellow croaker (GenBank accession number: KP342262) were 4220 bp and 3750 bp in length, respectively, each encoding a protein with high identity to mammalian SREBP-1. The deduced amino acid sequence displayed the typical structure of SREBP, i.e., the bHLH-Zip domain. Alignment analysis of the N-terminal protein sequence showed that SREBP-1 in fish was more similar in length to human SREBP-1a than to SREBP-1c (Fig. S1). The phylogenetic tree showed that fish species clustered together and formed a sister group to the branch for mammals and chicken (Fig. S2).

In the present study, a new putative PPAR-α cDNA (GenBank accession number: KP342260, named PPAR-α2 here) from rainbow trout was cloned that differed from the previously reported one (GenBank accession number: NM_001197211, named PPAR-α1 here) (Fig. S3). The deduced protein sequences of PPAR-α2 from rainbow trout displayed the typical structure of PPAR, i.e., contained a C4-type zinc finger and a ligand-binding domain (Fig. S3). The phylogenetic tree of PPAR-α was obviously divided into two branches, each harbouring one PPAR-α isoform for the fish possessing two sequences, except for rainbow trout (Fig. 2).

Figure 2. Phylogenetic relationship of the amino acid sequences of PPAR-α from vertebrates and invertebrates.

Figure 2

Open in a new tab

Gene expression in response to dietary fatty acids

The FADS2 transcript showed significantly higher expression in the livers of the fish fed vegetable oil than in those of the fish fed fish oil. The SREBP-1 transcript also showed higher expression in the fish fed vegetable oil compared with the fish fed fish oil. For PPAR-α, replacement of fish oil with vegetable oil significantly up-regulated its expression in the liver of rainbow trout but significantly down-regulated its expression in the liver of Japanese seabass. In large yellow croaker, however, no significant differences between groups were detected. These results showed that among these fishes, the levels of transcription of SREBP-1 and PPAR-α in the liver respond differently to dietary vegetable oil.

Promoter activity in cells

To determine the promoter activity of FADS2 and the roles of SREBP-1 and PPAR-α in regulating FADS2 promoter activity in the three fishes, HEK293T cells were co-transfected with the FADS2- promoter luciferase reporter plasmid and the SREBP-1 or PPAR-α expression plasmid, using PGL3-Basic and PCS2+ as controls in the dual-luciferase reporter assay.

In HEK293T cells, the promoter activity of FADS2 in rainbow trout was significantly higher than those in Japanese seabass and large yellow croaker, whereas no significant difference was observed between Japanese seabass and large yellow croaker (groups R, J and Y) (Fig. 3). The transcription factor SREBP-1 up-regulated the promoter activity of FADS2 by 1.58-fold, 4.57-fold and 1.59-fold in rainbow trout, Japanese seabass and large yellow croaker, respectively. The transcription factor PPAR-α up-regulated the promoter activity of FADS2 in rainbow trout and Japanese seabass but not in large yellow croaker. Interestingly, only the newly cloned PPAR-α gene of rainbow trout, i.e., PPAR-α2, showed regulatory activity on the promoter of FADS2 in HEK293T cells (Fig. 3).

Figure 3.

Figure 3

Open in a new tab

Relative gene transcription levels in the livers of experimental fishes (A–C) and dual-luciferase detection results (D–F). Gene transcription levels and luciferase activity are presented as the mean ± SEM (n = 3). The plasmid transfection groups are as follows: NIC: PGL3-Basic + PCS2+ + PRL-CMV; R: PGL-RF + PCS2+ + PRL-CMV; R-S: PGL-RF + PCS-RS + PRL-CMV; R-P1: PGL-RF + PCS-RP1 + PRL-CMV; R-P2: PGL-FR + PCS-RP2 + PRL-CMV; J: PGL-JF + PCS2+ + PRL-CMV; J-S: PGL-JF + PCS-JS + PRL-CMV; J-P1: PGL-JF + PCS-JP1 + PRL-CMV; J-P2: PGL-JF + PCS-JP2 + PRL-CMV; Y: PGL-YF + PCS2+ + PRL-CMV; Y-S: PGL-YF + PCS-YS + PRL-CMV; Y-P: PGL-YF + PCS-YP + PRL-CMV. Different letters above the bars denote significant differences between diet groups at the P < 0.05 level.

Discussion

The vegetable oils, soybean oil and linseed oil, are relatively rich in 18-carbon fatty acids but have low levels of LC-PUFAs in comparison with fish oil. LC-PUFAs are essential fatty acids for marine fish, and they may lack or have less ability to transform 18-carbon fatty acids into LC-PUFAs. Thus, replacement of fish oil with vegetable oil can negatively affect the growth and survival of marine fishes. The results of this study showed that full replacement did not affect the SGR, FER, FI and SR in rainbow trout (freshwater) but substantially reduced the growth and survival in Japanese seabass (euryhaline) and large yellow croaker (marine). Correspondingly, fishes fed vegetable oil (50% or 100%) had high levels of C18:3n-3 and C18:2n-6 but low levels of n-3 LC-PUFAs in their muscles and liver, and this was especially pronounced in the large yellow croaker. Previous studies have demonstrated that marine fish species show less ability to synthesize LC-PUFAs from C18:3n-3 and C18:2n-68,9,22,38,39,40. However, the mechanisms involved in the dietary regulation of LC-PUFA synthesis have rarely been studied in fish to date. FADS2 is a key enzyme catalysing the first rate-limiting step in the biosynthesis of LC-PUFA from C18:3n-3 and C18:2n-6 and thus is commonly used as an indicator of LC-PUFA biosynthesis16,24,26, but the underlying mechanism in fish has been poorly understood.

Both SREBP-1 and PPAR-α are major regulators of fatty acid metabolic genes including those involved in LC-PUFA synthesis. Two forms of mammalian SREBP-1 have been characterized, SREBP-1a and -1c. However, to date, only a single form of the SREBP-1 gene has been characterized in fish33,37,41, with no exception for the three fishes investigated in the present study. The alignment analysis of the deduced amino acid sequences showed that the SREBP-1 genes from fish were more similar to human SREBP-1a than to human SREBP-1c, indicating that fish SREBP-1 genes likely only possess functions similar to those of human SREBP-1a transcripts33,37. Unlike in mammals, two forms of the PPAR-α gene were characterized in rainbow trout, which was consistent with Japanese seabass, fugu, zebrafish, Japanese medaka, turbot and grass carp33,42,43. However, only a single orthologue was found in large yellow croaker, as observed in the olive flounder44. The phylogenetic analysis revealed that except in rainbow trout, fish PPAR-α1 and PPAR-α2 were on different branches. It has been hypothesized that gene duplication might have occurred during the evolution of PPAR-α, resulting in two orthologues with divergent functions in some fishes33,45.

Although not always attaining statistical significance, several studies have shown that replacing fish oil with vegetable oil consistently results in increased FADS2 transcription in fish1,26,39,46,47,48,49,50,51,52,53. In the present study, the transcript level of FADS2 was significantly higher in the livers of the fish fed vegetable oil than in those of the fish fed fish oil. Moreover, replacement with vegetable oil significantly up-regulated the transcription level of SREBP-1 in most cases, consistent with previous studies33,54. Interestingly, in Japanese seabass fed vegetable oil, the two isotypes of PPAR-α showed different responses, which may indicate that functional differentiation has occurred since the gene duplication33,55. In addition, the transcription level of PPAR-α was not significantly influenced by the dietary fatty acids in large yellow croaker. Given that PPAR-α plays important regulatory roles in LC-PUFA biosynthesis in mammals, the different responses of PPAR-α to dietary fatty acids might be responsible for the different LC-PUFA biosynthesis abilities among fishes.

Previous studies suggested that the lack of binding sites for the transcription factor Sp1 may explain the lower activity of the FADS2 promoter in Atlantic cod than in Atlantic salmon36,56. Although the FADS2 promoter of rainbow trout showed significantly higher activity than those of the Japanese seabass and large yellow croaker in HEK293T cells, no Sp1 binding site was identified in the promoter region of rainbow trout. Thus, there must be other transcription factors regulating the transcription activity of FADS2. In mammals, transcription of FADS2 is dually regulated by SREBP-1 and PPAR-α, two reciprocal transcription factors for fatty acid metabolism27,57,58. In vitro analysis showed that as in mammals, the transcription factor SREBP-1 up-regulated the promoter activity of FADS2 to varying degrees in the three fishes. Moreover, both PPAR-α1 and PPAR-α2 were demonstrated to up-regulate the promoter activity of FADS2 in Japanese seabass, but no such regulatory activity was detected in large yellow croaker. In contrast, in rainbow trout, only PPAR-α2 showed regulatory activity, although both PPAR-α1 and PPAR-α2 were on the same evolutionary branch. Given that the salmonids are still in the process of reverting to a stable diploid state after a genome duplication event59, the structural similarity and functional differentiation of the two isotypes of PPAR-α in rainbow trout might suggest that the duplicated PPAR-α gene is still in the process of accumulating mutations.

In conclusion, the present study suggests that two transcription factors, SREBP-1 and PPAR-α, are involved in fatty acid biosynthesis via regulating FADS2 and that the differences in their regulatory activity may be responsible for differential LC-PUFA biosynthesis abilities among fishes that have adapted to different ambient salinity.

Materials and Methods

Ethics statement

The present experimental procedures were carried out in strict accordance with the recommendations in the Guide for the Use of Experimental Animals of Ocean University of China. All animal care and use procedures were approved by the Institutional Animal Care and Use Committee of Ocean University of China (Permit Number: 20001001). Before handling and sacrifice, experimental fish were anesthetized with MS-222 (250 mg/L, Sigma), and all efforts were made to minimize suffering.

Feeding trial

Three isoprotein (41% crude protein) and isolipidic (12% crude lipid) diets were formulated to contain graded levels of vegetable oil blend (0, 50 and 100%) by supplementation of soybean oil and linseed oil (Tables 4 and 5). The three artificial diets were designated FO (control), FV and VO.

Table 4. Formulation and proximate composition of the experimental diets (% of dry matter).

Ingredients FO1 FV2 VO3
Defatted white fish meal4 15 15 15
Soybean meal 32 32 32
Casein5 11 11 11
Wheat meal 26 26 26
Mineral premix6 2 2 2
Vitamin premix7 2 2 2
Attractant8 0.3 0.3 0.3
Mould inhibitor9 0.1 0.1 0.1
Lecithin 2.6 2.6 2.6
Fish oil 9 4.5 0
Soybean oil 0 2.5 4.5
Linseed oil 0 2.5 4.5
Total 100 100 100
Proximate composition
 Crude protein 41.67 41.74 41.71
 Crude lipid 12.85 12.70 12.76
Open in a new tab

1FO: 100% Fish oil as lipid source (control).

2FV: Vegetable oil blend (linseed oil: soya bean oil = 1:1) replacing 50% of fish oil.

3VO: 100% Vegetable oil blend as lipid source.

4Defatted fish meal: 72.1% Crude protein and 1.4% crude lipid; white fish meal were defatted with ethanol (fish meal: ethanol = 1:2, w:v) at 37 °C three times.

5Casein: 88% Crude protein and 1.3% crude lipid, Alfa Aesar, Avocado Research Chemicals Ltd, UK.

6Mineral premix (mg or g kg-1 diet): CuSO4·5H2O 10 mg; Na2SeO3 (1%) 25 mg; ZnSO4·H2O, 50 mg; CoCl2·6H2O (1%) 50 mg; MnSO4·H2O 60 mg; FeSO4·H2O 80 mg Ca (IO3)2 180 mg; MgSO4·7H2O 1200 mg; zeolite 18.35 g.

7Vitamin premix (mg or g kg−1 diet): Vitamin D 5 mg; vitamin K 10 mg vitamin B12 10 mg vitamin B6 20 mg; folic acid 20 mg; vitamin B1 25 mg; vitamin A 32 mg; vitamin B2 45 mg; pantothenic acid 60 mg; biotin 60 mg; niacin acid 200 mg; α-tocopherol 240 mg; inositol 800 mg; ascorbic acid 2000 mg; microcrystalline cellulose 16.47 g.

8Phagostimulant: Glycine: betaine = 1:3.

9Preservative: Fumarate: calcium propionate = 1:1.

Table 5. The contents of various fatty acids in the experimental diets (mg/g)1.

Fatty acid FO FV VO
C14:0 0.76 0.42 0.10
C16:0 4.51 3.96 3.13
C18:0 1.63 1.72 1.71
∑SFA2 6.90 6.10 4.94
C16:1 1.08 0.53 0.06
C18:1 3.59 4.58 5.47
∑MUFA3 4.67 5.11 5.53
C18:2n-6 4.35 8.85 12.66
C20:4n-6 0.12 0.07 0.04
∑n-6 PUFA4 4.47 8.93 12.70
C18:3n-3 0.43 3.32 6.98
C20:5n-3 1.25 0.62 0.06
C22:6n-3 1.85 0.88 0.08
∑n-3 PUFA5 3.53 4.82 7.12
∑n-3/∑n-6 PUFA 0.79 0.54 0.56
∑n-3 LC-PUFA 3.10 1.49 0.14
Total fatty acids 21.18 26.82 31.09
Open in a new tab

1Some fatty acids that were present in only minor or trace amounts or that were not detected, such as C22:0, C24:0, C14:1, C20:2n-6 and C20:3n-6, are not listed in the table.

2SFA: Saturated fatty acid.

3MUFA: Monounsaturated fatty acid.

4n-6 PUFA: n-6 poly-unsaturated fatty acid.

5n-3 PUFA: n-3 poly-unsaturated fatty acid.

Rainbow trout was obtained from a commercial farm in Weifang, Shandong, China. Fish similar in size were randomly sorted into tanks that were supplied with a continuous flow of freshwater with continuous aeration. During the entire experiment, the water temperature was kept at 18 ± 3 °C, with dissolved oxygen at approximately 7–8 mg/L. Large yellow croaker and Japanese seabass were purchased from a local fish farm in Xiangshan Bay, Zhejiang, China. Prior to the beginning of the experiment, fish of similar sizes were randomly grouped and reared in floating sea cages for one week. During the experiment, all environmental parameters were the same as in the practical cultivation environment; i.e., the temperature was 24–29 °C, the salinity was 29–32‰, and the dissolved oxygen was approximately 6–7 mg/L.

Each diet was randomly assigned to triplicate tanks or cages. To prevent wasting of dietary pellets, the fish were slowly hand-fed little by little until apparent satiation on the basis of visual observation. The fish were fed twice daily, at 08:00 and 17:00, for 10 weeks.

Assay of fatty acid composition

The fatty acid composition was determined via gas chromatography–mass spectrometry (GC–MS) using a Thermo TRACE 1310 GC-ISQ QD MS mass spectrometer equipped with an Agilent 7890AGC-5975CMS gas chromatograph.

RNA extraction, cDNA synthesis and quantitative real-time PCR

Total RNA was extracted from the liver using RNAiso Plus (TaKaRa Bio, Dalian, China) according to the manufacturer’s protocol. Then, 1 μg of total RNA was subjected to PrimeScript®RT reagent Kit with gDNA Eraser (TaKaRa Bio) in a 20 μl volume for reverse transcription and DNA removal.

Real-time PCR was conducted in a quantitative thermal cycler (Eppendorf, Hamburg, Germany). The amplification was performed in a total volume of 25 ml, containing 1 μl of each primer (10 mM), 1 μl of the diluted first strand cDNA product, 12.5 μl of 2 × SYBR Premix Ex Taq II (TaKaRa Bio) and 9.5 μl of sterilized double-distilled water. The primer sequences for β-actin, FADS2, SREBP-1, PPAR-α1 and PPAR-α2 were designed using Primer Premier 5.0 (Table 6). Each sample was run in triplicate. For each run, PCR controls were assayed and PCR efficiency was measured by the slope of a standard curve using serial dilutions of cDNA. PCR amplification efficiency values ranged between 0.90 and 1.10 in all cases. The gene expression levels of putative FADS2, SREBP-1, PPAR-α1, and PPAR-α2 were determined using the 2−ΔΔCT method60.

Table 6. Primers used in real-time PCR.

Species Gene Primer Sequence (5′-3′)
Rainbow trout SREBP-1 RS-F CAAGCTGCCCATCAACCGTA
RS-R GGCCACCAGGTCTTTAAGCTC
PPAR-α1 RP1-F TCCCCCAGTCCATCGACGGTGACA
RP1-R GAGAACTCCTCCAGCCCTGCAGCT
PPAR-α2 RP2-F CAGTCGAGTAACTGCTCTGGCT
RP2-R ACAGGCGTGAACTCCATAGTGGT
FADS2 RFADS2-F GTCCGTGCTTTGTGTGAGAA
RFADS2-R TCAGAGACCCGACAACATCA
β-actin R-β-actin-F TCCTTCCTCGGTATGGAGTCT
R-β-actin-R TTACGGATGTCCACGTCACAC
Japanese seabass SREBP-1 JS-F TGCTATCGGTTCTAACATGGCTAC
JS-R AGTGCTCAACAGTCAGATACAGTC
PPAR-α1 JP1-F AAGACCAGCACCCCTCCTTTCGT
JP1-R CCGAACTTCTGCCTCCCTGTCCT
PPAR-α2 JP2-F TTCCAGCTGGCAGAGAGGACGC
JP2-R CACCCCACAGCCGGAACCACCT
FADS2 JFADS2-F CCGTCGCGACTGGGTGGATATG
JFADS2-R CAGTCCCGGTGCTTCTCGTGG
β-actin J-β-actin-F CAACTGGGATGACATGGAGAAG
J-β-actin-R TTGGCTTTGGGGTTCAGG
Large yellow croaker SREBP-1 YS-F TCTCCTTGCAGTCTGAGCCAAC
YS-R TCAGCCCTTGGATATGAGCCT
PPAR-α1 YP-F AAGTGCCTCTCTGTGGGAATGT
YP-R TCACCTCTTTCTCCACCATCT
FADS2 YFADS2-F TTCGCTTCCTCTGCTGCTATG
YFADS2-R CCAGTCACGGTGCTTCTCG
β-actin Y-β-actin-F CTACGAGGGTTATGCCCTGCC
Y-β-actin-R TGAAGGAGTAACCGCGCTCTGT
Open in a new tab

Luciferase Reporter Assay

The genome-walking experiment was conducted to isolate the promoter sequences of FADS2 of rainbow trout, Japanese seabass and large yellow croaker. Briefly, genomic DNAs were extracted from the liver tissue using the SQ Tissue DNA Kit (Omega Bio-Tek, Norcross, America), and specific reverse primers were designed for each species (Table S1) based on the sequences of rainbow trout (NM_001124287.1), Japanese seabass (JX678842.1) and large yellow croaker (NM_001303363). Three rounds of genome walking were conducted for each species, using the forward primer AP4 supplied in the kit (Takara Bio) according to the manufacturer’s instructions.

For cloning the cDNAs of SREBP and PPAR-α, degenerate primers were designed based on highly conserved regions of the genes from other fishes available in the GenBank database. Then, gene-specific primers were further designed (Table S2) to clone the 3′ and 5′ ends by rapid amplification of cDNA ends (RACE) technology using the SMARTerTM RACE cDNA Amplification Kit (Clontech, Mountain View, America). PCR products were cloned into the pEASY-T1 simple cloning vector (TransGen, Beijing, China) and sequenced by Sangon Biotech (Shanghai, China).

Similar searches of the cloned cDNA sequences were conducted using Blastn against the NCBI database (www.ncbi.nlm.nih.gov/blast/). Multiple-sequence alignment was carried out using ClustalW, followed by the construction of phylogenetic trees by using the neighbour-joining method in MEGA version 4.0.

For functional analysis, coding sequences of SREBP-1 and PPAR-α from rainbow trout, Japanese seabass and large yellow croaker were sub-cloned into the PCS2+ expression vectors, named PCS-RS, PCS-RP1, PCS-RP2, PCS-JS, PCS-JP1, PCS-JP2, PCS-YS, and PCS-YP. The FADS2 promoters from the three fishes were sub-cloned into the PGL3-Basic vector (Promega, Beijing, China), which does not include a promoter but contains a luciferase reporter gene, and named PGL-RF, PGL-JF and PGL-YF. All recombinant constructs were sequenced to verify the orientation before in vitro experiments in HEK293T cells. (Table S3).

HEK293T cells were maintained in DMEM supplied with 10% foetal bovine serum. Cells were seeded into 24-well plates. When they reached 60–70% confluence, the plasmids were transfected into duplicate wells using the Lipofectamine 2000 system (Invitrogen, Carlsbad, America). For each experiment, 600 ng of PCS plasmid, 200 ng of PGL3 plasmid, and 20 ng of the Renilla luciferase reporter plasmid PRL-CMV (Promega) were mixed and transfected at 26 °C.

The cells were cultured for 6 hours, followed by replacement of the transfection medium with fresh medium and further incubation. Luciferase activities were measured 24 h after the transfection using a dual-luciferase assay kit (Promega). The relative luciferase activities of the promoters were normalized to the control reporter. The final data were from three independent experiments, and each experiment was performed in triplicate.

Calculations and statistical methods

graphic file with name srep40024-m1.jpg
graphic file with name srep40024-m2.jpg
graphic file with name srep40024-m3.jpg
graphic file with name srep40024-m4.jpg

Wt and W0 are the final and initial body weights, respectively, and t is the duration of the experiment in days.

Differences in the fatty acid composition and gene expression due to the different diets were determined by one-way ANOVA using SPSS 18.0 (SPSS Inc., Chicago, America), and Duncan’s multiple range test was used to assess differences among groups. If unequal variance was determined using Levene’s test, data were log-transformed before statistical analysis. Data are expressed as the means ± SEM, and P values of less than 0.05 were considered statistically significant.

Additional Information

How to cite this article: Dong, X. et al. Regulation of FADS2 transcription by SREBP-1 and PPAR-α influences LC-PUFA biosynthesis in fish. Sci. Rep. 7, 40024; doi: 10.1038/srep40024 (2017).

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Material

Supplementary Information
srep40024-s1.pdf (1.3MB, pdf)

Acknowledgments

We thank Xuedi Du, Yahui Wang, Tianjiao Wang, Jingwei Liu, Yuhui Yuan, Songlin Li, Zhen Wang, Zhuoyi Tang, Kun Cui, Yanjiao Zhang, Huihui Zhou, Wei Xu, and Jifang Li for their assistance in the study. The present study was supported by the National Science Fund for Distinguished Young Scholars of China (31525024), the National Natural Foundation of China (31372541) and the National Basic Research Program of China (2014CB138600).

Footnotes

Author Contributions X.J.D., H.G.X., R.T.Z., Q.H.A. and K.S.M. designed the research; X.J.D., P.T., Z.N.C., H.L.X., J.Q.L., W.R. and J.F.Z. conducted the research; X.J.D. and H.G.X. analysed the data and wrote the paper. All authors read and approved the final manuscript.

References

  1. Bell J. G. et al. Replacement of fish oil with rapeseed oil in diets of Atlantic salmon (Salmo salar) affects tissue lipid compositions and hepatocyte fatty acid metabolism. J. Nutr. 131, 1535–1543 (2001). [DOI] [PubMed] [Google Scholar]
  2. Rosenlund G., Obach A., Sandberg M., Standal H. & Tveit K. Effect of alternative lipid sources on long‐term growth performance and quality of Atlantic salmon (Salmo salar L.). Aquac. Res. 32, 323–328 (2001). [Google Scholar]
  3. Caballero M. et al. Impact of different dietary lipid sources on growth, lipid digestibility, tissue fatty acid composition and histology of rainbow trout, Oncorhynchus mykiss. Aquaculture 214, 253–271 (2002). [Google Scholar]
  4. Bell J. G., Tocher D. R., Henderson R. J., Dick J. R. & Crampton V. O. Altered fatty acid compositions in Atlantic salmon (Salmo salar) fed diets containing linseed and rapeseed oils can be partially restored by a subsequent fish oil finishing diet. J. Nutr. 133, 2793–2801 (2003). [DOI] [PubMed] [Google Scholar]
  5. Bransden M. P., Carter C. G. & Nichols P. D. Replacement of fish oil with sunflower oil in feeds for Atlantic salmon (Salmo salar L.): effect on growth performance, tissue fatty acid composition and disease resistance. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 135, 611–625 (2003). [DOI] [PubMed] [Google Scholar]
  6. Menoyo D., Lopez-Bote C., Obach A. & Bautista J. Effect of dietary fish oil substitution with linseed oil on the performance, tissue fatty acid profile, metabolism, and oxidative stability of Atlantic salmon. J. Anim. Sci. 83, 2853–2862 (2005). [DOI] [PubMed] [Google Scholar]
  7. Hixson S. M., Parrish C. C. & Anderson D. M. Changes in tissue lipid and fatty acid composition of farmed rainbow trout in response to dietary camelina oil as a replacement of fish oil. Lipids 49, 97–111 (2014). [DOI] [PubMed] [Google Scholar]
  8. Ghioni C., Tocher D. R., Bell M. V., Dick J. R. & Sargent J. R. Low C18 to C20 fatty acid elongase activity and limited conversion of tearidonic acid, 18:4(n-3), to eicosapentaenoic acid, 20:5(n-3), in a cell line from the turbot, Scophthalmus maximus. Biochim. Biophys. Acta 1437, 170–181 (1999). [DOI] [PubMed] [Google Scholar]
  9. Tocher D. R. & Ghioni C. Fatty acid metabolism in marine fish: low activity of fatty acyl Δ5 desaturation in gilthead sea bream (Sparus aurata) cells. Lipids 34, 433–440 (1999). [DOI] [PubMed] [Google Scholar]
  10. Fonseca-Madrigal J., Bell J. G. & Tocher D. R. Nutritional and environmental regulation of the synthesis of highly unsaturated fatty acids and of fatty-acid oxidation in Atlantic salmon (Salmo salar L.) enterocytes and hepatocytes. Fish Physiol. Biochem. 32, 317–328 (2006). [Google Scholar]
  11. Li Y. Y. et al. The effects of dietary fatty acids on liver fatty acid composition and Delta(6)-desaturase expression differ with ambient salinities in Siganus canaliculatus. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 151, 183–190, doi: 10.1016/j.cbpb.2008.06.013 (2008). [DOI] [PubMed] [Google Scholar]
  12. Codabaccus B. M., Bridle A. R., Nichols P. D. & Carter C. G. An extended feeding history with a stearidonic acid enriched diet from parr to smolt increases n-3 long-chain polyunsaturated fatty acids biosynthesis in white muscle and liver of Atlantic salmon (Salmo salar L.). Aquaculture 322, 65–73, doi: 10.1016/j.aquaculture.2011.09.014 (2011). [DOI] [Google Scholar]
  13. Marquardt A., Stöhr H., White K. & Weber B. H. cDNA cloning, genomic structure, and chromosomal localization of three members of the human fatty acid desaturase family. Genomics 66, 175–183 (2000). [DOI] [PubMed] [Google Scholar]
  14. Innis S. M. Perinatal biochemistry and physiology of long-chain polyunsaturated fatty acids. J. Pediatr. 143, 1–8 (2003). [DOI] [PubMed] [Google Scholar]
  15. Monroig O. et al. Multiple genes for functional 6 fatty acyl desaturases (Fad) in Atlantic salmon (Salmo salar L.): gene and cDNA characterization, functional expression, tissue distribution and nutritional regulation. Biochim. Biophys. Acta 1801, 1072–1081, doi: 10.1016/j.bbalip.2010.04.007 (2010). [DOI] [PubMed] [Google Scholar]
  16. Tocher D. R. et al. Highly unsaturated fatty acid synthesis in marine fish: cloning, functional characterization, and nutritional regulation of fatty acyl Δ6 desaturase of Atlantic cod (Gadus morhua L.). Lipids 41, 1003–1016 (2006). [DOI] [PubMed] [Google Scholar]
  17. Monroig O., Tocher D. R., Hontoria F. & Navarro J. C. Functional characterisation of a Fads2 fatty acyl desaturase with Δ6/Δ8 activity and an Elovl5 with C16, C18 and C20 elongase activity in the anadromous teleost meagre (Argyrosomus regius). Aquaculture 412, 14–22 (2013). [Google Scholar]
  18. Mohd-Yusof N. Y., Monroig O., Mohd-Adnan A., Wan K. L. & Tocher D. R. Investigation of highly unsaturated fatty acid metabolism in the Asian sea bass, Lates calcarifer. Fish Physiol. Biochem. 36, 827–843, doi: 10.1007/s10695-010-9409-4 (2010). [DOI] [PubMed] [Google Scholar]
  19. Morais S., Mourente G., Ortega A., Tocher J. A. & Tocher D. R. Expression of fatty acyl desaturase and elongase genes, and evolution of DHA: EPA ratio during development of unfed larvae of Atlantic bluefin tuna (Thunnus thynnus L.). Aquaculture 313, 129–139 (2011). [Google Scholar]
  20. Zheng X. et al. Physiological roles of fatty acyl desaturases and elongases in marine fish: Characterisation of cDNAs of fatty acyl Δ6 desaturase and elovl5 elongase of cobia (Rachycentron canadum). Aquaculture 290, 122–131, doi: 10.1016/j.aquaculture.2009.02.010 (2009). [DOI] [Google Scholar]
  21. González-Rovira A., Mourente G., Zheng X., Tocher D. R. & Pendón C. Molecular and functional characterization and expression analysis of a Δ6 fatty acyl desaturase cDNA of European Sea Bass (Dicentrarchus labrax L.). Aquaculture 298, 90–100, doi: 10.1016/j.aquaculture.2009.10.012 (2009). [DOI] [Google Scholar]
  22. Almaida-Pagán P. F. et al. Effects of total replacement of fish oil by vegetable oils on n-3 and n-6 polyunsaturated fatty acid desaturation and elongation in sharpsnout seabream (Diplodus puntazzo) hepatocytes and enterocytes. Aquaculture 272, 589–598, doi: 10.1016/j.aquaculture.2007.08.017 (2007). [DOI] [Google Scholar]
  23. Miller M. R., Nichols P. D. & Carter C. G. Replacement of dietary fish oil for Atlantic salmon parr (Salmo salar L.) with a stearidonic acid containing oil has no effect on omega-3 long-chain polyunsaturated fatty acid concentrations. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 146, 197–206, doi: 10.1016/j.cbpb.2006.10.099 (2007). [DOI] [PubMed] [Google Scholar]
  24. Xu H. et al. Regulation of Tissue LC-PUFA Contents, Δ6 Fatty Acyl Desaturase (FADS2) Gene Expression and the Methylation of the Putative FADS2 Gene Promoter by Different Dietary Fatty Acid Profiles in Japanese Seabass (Lateolabrax japonicus). PLoS One 9, e87726 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Xu L. et al. Betaine alleviates hepatic lipid accumulation via enhancing hepatic lipid export and fatty acid oxidation in rats fed with a high-fat diet. British Journal of Nutrition 113, 1835–1843, doi: 10.1017/s0007114515001130 (2015). [DOI] [PubMed] [Google Scholar]
  26. Geay F. et al. Regulation of FADS2 expression and activity in European sea bass (Dicentrarchus labrax, L.) fed a vegetable diet. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 156, 237–243, doi: 10.1016/j.cbpb.2010.03.008 (2010). [DOI] [PubMed] [Google Scholar]
  27. Matsuzaka T. et al. Dual regulation of mouse Δ5-and Δ6-desaturase gene expression by SREBP-1 and PPARα. J. Lipid Res. 43, 107–114 (2002). [PubMed] [Google Scholar]
  28. Kumadaki S. et al. Mouse Elovl-6 promoter is an SREBP target. Biochem. Biophys. Res. Commun. 368, 261–266 (2008). [DOI] [PubMed] [Google Scholar]
  29. Qin Y., Dalen K. T., Gustafsson J. A. & Nebb H. I. Regulation of hepatic fatty acid elongase 5 by LXRalpha-SREBP-1c. Biochim. Biophys. Acta 1791, 140–147, doi: 10.1016/j.bbalip.2008.12.003 (2009). [DOI] [PubMed] [Google Scholar]
  30. Muoio D. M. et al. Fatty acid homeostasis and induction of lipid regulatory genes in skeletal muscles of peroxisome proliferator-activated receptor (PPAR) alpha knock-out mice. Evidence for compensatory regulation by PPAR delta. J. Biol. Inorg. Chem. 277, 26089–26097, doi: 10.1074/jbc.M203997200 (2002). [DOI] [PubMed] [Google Scholar]
  31. Mandard S., Muller M. & Kersten S. Peroxisome proliferator-activated receptor alpha target genes. Cell Mol Life Sci 61, 393–416, doi: 10.1007/s00018-003-3216-3 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Oosterveer M. H. et al. Fenofibrate simultaneously induces hepatic fatty acid oxidation, synthesis, and elongation in mice. J. Biol. Chem. 284, 34036–34044 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Dong X. et al. Cloning and characterization of SREBP-1 and PPAR-alpha in Japanese seabass Lateolabrax japonicus, and their gene expressions in response to different dietary fatty acid profiles. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 180, 48–56, doi: 10.1016/j.cbpb.2014.10.001 (2015). [DOI] [PubMed] [Google Scholar]
  34. Kim J. B. et al. Dual DNA binding specificity of ADD1/SREBP1 controlled by a single amino acid in the basic helix-loop-helix domain. Mol. Cell. Biol. 15, 2582–2588 (1995). [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Desvergne B. & Wahli W. Peroxisome proliferator-activated receptors: nuclear control of metabolism 1. Endocr. Rev. 20, 649–688 (1999). [DOI] [PubMed] [Google Scholar]
  36. Zheng X., Leaver M. J. & Tocher D. R. Long-chain polyunsaturated fatty acid synthesis in fish: Comparative analysis of Atlantic salmon (Salmo salar L.) and Atlantic cod (Gadus morhua L.) Δ6 fatty acyl desaturase gene promoters. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 154, 255–263 (2009). [DOI] [PubMed] [Google Scholar]
  37. Minghetti M., Leaver M. J. & Tocher D. R. Transcriptional control mechanisms of genes of lipid and fatty acid metabolism in the Atlantic salmon (Salmo salar L.) established cell line, SHK-1. Biochim. Biophys. Acta 1811, 194–202, doi: 10.1016/j.bbalip.2010.12.008 (2011). [DOI] [PubMed] [Google Scholar]
  38. Mourente G., Dick J. R., Bell J. & Tocher D. R. Effect of partial substitution of dietary fish oil by vegetable oils on desaturation and β-oxidation of [1-14C]18:3n-3 (LNA) and [1-14C]20:5n−3 (EPA) in hepatocytes and enterocytes of European sea bass (Dicentrarchus labrax L.). Aquaculture 248, 173–186 (2005). [Google Scholar]
  39. Vagner M. & Santigosa E. Characterization and modulation of gene expression and enzymatic activity of delta-6 desaturase in teleosts: A review. Aquaculture 315, 131–143, doi: 10.1016/j.aquaculture.2010.11.031 (2010). [DOI] [Google Scholar]
  40. Tocher D. R. Metabolism and functions of lipids and fatty acids in teleost fish. Rev. Fish. Sci. 11, 107–184 (2003b). [Google Scholar]
  41. Thomas J. K., Wiseman S., Giesy J. P. & Janz D. M. Effects of chronic dietary selenomethionine exposure on repeat swimming performance, aerobic metabolism and methionine catabolism in adult zebrafish (Danio rerio). Aquat. Toxicol. 130, 112–122 (2013). [DOI] [PubMed] [Google Scholar]
  42. Robinson-Rechavi M. et al. Euteleost fish genomes are characterized by expansion of gene families. Genome research 11, 781–788, doi: 10.1101/gr.165601 (2001). [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Maglich J. M. et al. The first completed genome sequence from a teleost fish (Fugu rubripes) adds significant diversity to the nuclear receptor superfamily. Nucleic Acids Res. 31, 4051–4058 (2003). [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Cho H. K., Kong H. J., Kim H. Y. & Cheong J. Characterization of Paralichthys olivaceus peroxisome proliferator-activated receptor-alpha gene as a master regulator of flounder lipid metabolism. Gen. Comp. Endocr. 175, 39–47, doi: 10.1016/j.ygcen.2011.08.026 (2012). [DOI] [PubMed] [Google Scholar]
  45. Jaillon O. et al. Genome duplication in the teleost fish Tetraodon nigroviridis reveals the early vertebrate proto-karyotype. Nature 431, 946–957 (2004). [DOI] [PubMed] [Google Scholar]
  46. Bell J. G. et al. Substituting fish oil with crude palm oil in the diet of Atlantic salmon (Salmo salar) affects muscle fatty acid composition and hepatic fatty acid metabolism. J. Nutr. 132, 222–230 (2002). [DOI] [PubMed] [Google Scholar]
  47. Tocher D. R. et al. Polyunsaturated fatty acid metabolism in Atlantic salmon (Salmo salar) undergoing parr-smolt transformation and the effects of dietary linseed and rapeseed oils. Fish Physiol. Biochem. 23, 59–73 (2000). [Google Scholar]
  48. Tocher D. R., Bell J., MacGlaughlin P., McGhee F. & Dick J. R. Hepatocyte fatty acid desaturation and polyunsaturated fatty acid composition of liver in salmonids: effects of dietary vegetable oil. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 130, 257–270 (2001). [DOI] [PubMed] [Google Scholar]
  49. Tocher D. R. et al. Effects of diets containing linseed oil on fatty acid desaturation and oxidation in hepatocytes and intestinal enterocytes in Atlantic salmon (Salmo salar). Fish Physiol. Biochem. 26, 157–170 (2002). [Google Scholar]
  50. Tocher D. R., Bell J., McGhee F., Dick J. R. & Fonseca-Madrigal J. Effects of dietary lipid level and vegetable oil on fatty acid metabolism in Atlantic salmon (Salmo salar L.) over the whole production cycle. Fish Physiol. Biochem. 29, 193–209 (2003). [Google Scholar]
  51. Tocher D. R., Dick J. R., MacGlaughlin P. & Bell J. G. Effect of diets enriched in Δ6 desaturated fatty acids (18:3n-6 and 18:4n-3), on growth, fatty acid composition and highly unsaturated fatty acid synthesis in two populations of Arctic charr (Salvelinus alpinus L.). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 144, 245–253 (2006). [DOI] [PubMed] [Google Scholar]
  52. Zheng X., Tocher D. R., Dickson C. A., Bell J. G. & Teale A. J. Highly unsaturated fatty acid synthesis in vertebrates: new insights with the cloning and characterization of a Δ6 desaturase of Atlantic salmon. Lipids 40, 13–24 (2005). [DOI] [PubMed] [Google Scholar]
  53. Zheng X. et al. Environmental and dietary influences on highly unsaturated fatty acid biosynthesis and expression of fatty acyl desaturase and elongase genes in liver of Atlantic salmon (Salmo salar). Biochim. Biophys. Acta 1734, 13–24 (2005). [DOI] [PubMed] [Google Scholar]
  54. Vestergren A. S. et al. The effect of combining linseed oil and sesamin on the fatty acid composition in white muscle and on expression of lipid-related genes in white muscle and liver of rainbow trout (Oncorhynchus mykiss). Aquacult. Int. 21, 843–859 (2013). [Google Scholar]
  55. Cunha I. et al. Dynamics of PPARs, fatty acid metabolism genes and lipid classes in eggs and early larvae of a teleost. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 164, 247–258, doi: 10.1016/j.cbpb.2013.01.003 (2013). [DOI] [PubMed] [Google Scholar]
  56. Geay F. et al. Characteristics of fads2 gene expression and putative promoter in European sea bass(Dicentrarchus labrax): Comparison with salmonid species and analysis of CpG methylation. Mar. Genom. 5, 7–13 (2012). [DOI] [PubMed] [Google Scholar]
  57. Nakamura M. & Nara T. Gene regulation of mammalian dasaturases. Biochem. Soc. Trans. 30, 1076–1079 (2002). [DOI] [PubMed] [Google Scholar]
  58. Nakamura M. & Nara T. Essential fatty acid synthesis and its regulation in mammals. Prostag. Leukotr. Ess. 68, 145–150 (2003). [DOI] [PubMed] [Google Scholar]
  59. Allendorf F. W. & Thorgaard G. H. Tetraploidy and the evolution of salmonid fishes In Evolutionary Genetics of Fishes (ed Turner B. J.) 1–53 (Plenum Press, 1984). [Google Scholar]
  60. Livak K. J. & Schmittgen T. D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 25, 402–408 (2001). [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Information
srep40024-s1.pdf (1.3MB, pdf)

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES