Skip to main content
FEBS Open Bio logoLink to FEBS Open Bio
. 2016 Dec 12;7(1):4–24. doi: 10.1002/2211-5463.12163

The calcium‐dependent protein kinase (CDPK) and CDPK‐related kinase gene families in Hevea brasiliensis—comparison with five other plant species in structure, evolution, and expression

Xiao‐Hu Xiao 1,, Meng Yang 2,, Jin‐Lei Sui 1,3, Ji‐Yan Qi 1, Yong‐Jun Fang 1, Song‐Nian Hu 2, Chao‐Rong Tang 1,
PMCID: PMC5221434  PMID: 28097084

Abstract

Calcium‐dependent protein kinases (CDPKs or CPKs) play important roles in various physiological processes of plants, including growth and development, stress responses and hormone signaling. Although the CDPK gene family has been characterized in several model plants, little is known about this gene family in Hevea brasiliensis (the Para rubber tree). Here, we characterize the entire H. brasiliensis CDPK and CDPK‐related kinase (CRK) gene families comprising 30 CDPK genes (HbCPK1 to 30) and nine CRK genes (HbCRK1 to 9). Structure and phylogeny analyses of these CDPK and CRK genes demonstrate evolutionary conservation in these gene families across H. brasiliensis and other plant species. The expression of HbCPK and HbCRK genes was investigated via Solexa sequencing in a range of experimental conditions (different tissues, phases of leaf development, ethylene treatment, and various abiotic stresses). The results suggest that HbCPK and HbCRK genes are important components in growth, development, and stress responses of H. brasiliensis. Parallel studies on the CDPK and CRK gene families were also extended to five other plant species (Arabidopsis thaliana, Oryza sativa, Populus trichocarpa, Manihot esculenta, and Ricinus communis). The CDPK and CRK genes from different plant species that exhibit similar expression patterns tend to cluster together, suggesting a coevolution of gene structure and expression behavior in higher plants. The results serve as a foundation to further functional studies of these gene families in H. brasiliensis as well as in the whole plant kingdom.

Keywords: calcium‐dependent protein kinase, CDPK‐related kinase, gene expression, Hevea brasiliensis, structure and evolution


Abbreviations

CDPK/CPK

calcium‐dependent protein kinase

CRK

CDPK‐related kinase

QPCR

real‐time quantitative reverse transcription polymerase chain reaction

SRA

Sequence Read Archive

Plants have evolved a series of survival mechanisms to adapt to diverse environmental challenges, including drought, salinity, wounding, and low temperatures 1, 2, 3, 4. Calcium (Ca2+), functioning as a second messenger of plant cells, plays an essential role in various signaling transduction pathways 5, 6. The changes in Ca2+ concentration are sensed by several Ca2+ sensors or Ca2+‐binding proteins. To date, three major classes of Ca2+‐binding proteins, including calcium‐dependent protein kinases (CDPKs or CPKs), calmodulins (CaMs), and CaM‐like proteins (CMLs) and calcineurin B‐like proteins (CBLs), have been characterized in higher plants 7, 8. The CDPKs constitute one of the largest calcium‐sensing subfamilies of serine/threonine protein kinases that have been identified throughout the plant kingdom, from algae to angiosperms as well as in some protozoans, but not in animals 9. The CDPK proteins have four characterized domains: an N‐terminal variable region, a Ser/Thr kinase catalytic domain, an autoregulatory/autoinhibitory domain, and a calmodulin‐like domain containing EF‐hands for Ca2+ binding 10, 11, 12.

Accumulating evidence indicates that CDPKs participate in plant responses to a variety of abiotic and biotic stresses, as well as in plant development 13, 14, 15. In Arabidopsis thaliana, CPK10 participates in abscisic acid (ABA) and Ca2+‐mediated stomatal regulation in response to drought stress 16. Two homologs, AtCPK4 and AtCPK11, acting as positive regulators in ABA signaling pathways, are involved in seed germination, seedling growth, stomatal movement, and salt stress tolerance 17. Another CDPK gene, AtCPK12, has been characterized as a negative ABA‐signaling pathway regulator 18, while AtCPK6 demonstrates crucial roles in responses to drought and salt stresses 19. In Oryza sativa, transgenic plants overexpressing OsCDPK7/OsCPK13 show enhanced resistance to cold, drought, and salt stress 20. OsCDPK13/OsCPK7 and OsCPK21 are involved in responses to cold and salt stress, respectively 21, 22. In Nicotiana tabacum, two CDPK genes, NtCDPK2 and NtCDPK3, play an essential role in the defense response, and NtCDPK2 functions together with the stress‐induced MAPKs (mitogen‐activated protein kinases) to control response specificity to abiotic and biotic stresses 23, 24. In addition, genome‐wide expression patterns of CDPK genes have been characterized in O. sativa, Zea mays, Populus trichocarpa, and Brassica napus, and they point to important roles in the regulation of abiotic stresses, hormones, and the intrinsic developmental program in plant growth and development 25, 26, 27, 28.

Natural rubber (cis‐1,4‐polyisoprene, NR) is an important industrial raw material, and the sole commercial source of NR is Hevea brasiliensis (the Para rubber tree), a perennial tropical tree species 29. NR is synthesized and stored in the laticifer cells, which are differentiated from the cambium and arranged in concentric rings in the phloem region 29, 30. The bark of rubber tree is incised every 2–3 days to sever the laticifer rings and collect the latex, and this process is called tapping 29. At each tapping, several tens to a few hundred milliliters of latex per tree are expelled from the laticifers and harvested for sustainable rubber production. Application of ethylene gas or ethephon (2‐chloroethylphosphonic acid, an ethylene generator) to the trunk bark of the rubber tree increases rubber yield. However, the underlying mechanisms in ethylene stimulation are yet to be elucidated, although ethylene signaling and response are assumed to play critical roles 29. In a previous report, one CDPK gene (HbCDPK1) was shown to be induced by ethephon in H. brasiliensis 31. Both environmental and harvesting stresses affect rubber yield. For example in tapping, the moderate stresses generate a positive stimulatory effect on latex production in virgin (previously untapped) rubber trees, bringing the rubber yield from a meager exudation at the first tapping to more than a hundred milliliters after 7–10 consecutive tappings 32. However, excessive environmental and harvesting stresses, especially a combination of overtapping and overstimulation by ethylene or ethephon, lead to the occurrence of tapping panel dryness (TPD), a physiological disorder that can result in complete stoppage of latex flow in the rubber tree 29. In view of the importance of CDPK genes in stress responses and hormone signaling in other plants 6, it is worthwhile investigating the CDPK gene family in the rubber tree in relation to the regulation of latex production.

In this study, we performed a genome‐wide analysis of the CDPK and CRK gene families in H. brasiliensis and compared the results with those from five other plant species, i.e. Manihot esculenta, Ricinus communis, A. thaliana, O. sativa, and P. trichocarpa. The study encompassed a total of 161 CDPK and 45 CDPK‐related kinase (CRK) genes, the expression patterns of which were analyzed in different plant tissues in response to various treatments, and at several phases of tissue development. In addition, the gene structure and phylogeny of these genes were also compared, and all the results obtained will help further understanding of the roles of CDPK and CRK genes in the regulation of latex production and regeneration. Data on CDPK and CRK genes and their expression in six plant species would also contribute to the understanding of the structure of these gene families and the functions of their members in the plant kingdom.

Results and Discussion

Genome‐wide identification of CDPK and CRK gene families in H. brasiliensis and five other plant species

We identified all CDPK and CRK gene family members in six plant species (H. brasiliensis, A. thaliana, O. sativa, P. trichocarpa, M. esculenta, and R. communis) from their published genome sequences 33, 34, 35, 36, 37, 38, 39. The latest genome and protein sequences of these species were downloaded from Phytozome v10. Local blast searches of the genomes were performed by using the published CDPK and CRK sequences of three model plants of A. thaliana, O. sativa, and P. trichocarpa as queries 12, 26, 28, 40. This analysis identified a total of 161 CDPK genes and 45 CRK genes in the six plant species, including 39 H. brasiliensis CDPK and CRK genes (HbCPK1 to 30, and HbCRK1 to 9, Table 1a), 31 M. esculenta genes (MeCPK1 to 22, and MeCRK1 to 9, Table 1b), 21 R. communis genes (RcCPK1 to 16, and RcCRK1 to 5, Table 1c), 42 A. thaliana genes (AtCPK1 to 34, and AtCRK1 to 8, Table S1–4), 39 P. trichocarpa genes (PtCDPK1 to 30, and PtCRK1 to 9, Table S1–5), and 34 O. sativa genes (OsCPK1 to 29, and OsCRK1 to 5, Table S1–6). The gene numbers of CDPK and CRK families identified here for the three model plants agree well with those previously reported 12, 28, 41.

Table 1.

Characteristics of CDPK and CRK genes in three Euphorbiaceae members, Hevea brasiliensis, M. esculenta, and R. communis

a) H. brasiliensis
HbCDPKs or HbCRKs ID CDS length in bp Predicted protein No. of introns Group
Length (aa) Isoelectric point Mol Wt
HbCPK1 387072309 1764 588 5.22 65750.55 6 CPKI
HbCPK2 1602 534 5.4 59450.32 7 CPKII
HbCPK3 1704 568 6.29 64610.86 6 CPKIII
HbCPK4 387060177 1602 534 6.75 60132.81 7 CPKII
HbCPK5 387068553 1626 542 5.86 61341.08 6 CPKI
HbCPK6 387057753 1722 574 5.14 63872.63 6 CPKI
HbCPK7 1569 523 5.47 58217 7 CPKII
HbCPK8 1647 549 6.73 62648.76 6 CPKIII
HbCPK9 387061935 1590 530 6.13 59626.89 8 CPKII
HbCPK10 1305 435 5.17 49186.02 9 CPKIII
HbCPK11 387060219 1602 534 6.07 60196.74 7 CPKII
HbCPK12 387067377 1500 500 5.54 56598.5 6 CPKI
HbCPK13 387058668 1593 531 6.25 60383.85 7 CPKIII
HbCPK14 1584 528 6.11 59945.36 7 CPKII
HbCPK15 387059122 1683 561 5.54 62869.32 6 CPKI
HbCPK16 387063507 1551 517 5.36 58166.27 6 CPKI
HbCPK17 1590 530 6.09 59573.92 8 CPKII
HbCPK18 1581 527 5.91 59425.87 6 CPKIII
HbCPK19 387062498 1581 527 5.86 59368.88 6 CPKIII
HbCPK20 387059814 1695 565 8.97 63976.74 11 CPKIV
HbCPK21 387063125 1695 565 9.25 64073.67 11 CPKIV
HbCPK22 1653 551 5.68 62621.56 7 CPKIII
HbCPK23 387062143 1506 502 5.38 56753.76 6 CPKI
HbCPK24 1752 584 5.44 65647.88 6 CPKI
HbCPK25 1770 590 5.07 65770.61 6 CPKI
HbCPK26 1599 533 5.98 60567.48 7 CPKIII
HbCPK27 387059234 1683 561 5.62 62799.22 6 CPKI
HbCPK28 1893 631 5.47 70785.55 6 CPKI
HbCPK29 1602 534 6.49 60629.41 7 CPKIII
HbCPK30 EU581818 1671 556 5.15 66350.8 7 CPKIII
HbCRK1 387066783 1890 630 8.57 70199.19 10 CRK
HbCRK2 1875 625 8.69 69866.87 10 CRK
HbCRK3 387056042 1728 576 8.56 64518.92 10 CRK
HbCRK4 1803 601 9.03 66945.41 10 CRK
HbCRK5 1806 602 8.89 67117.41 10 CRK
HbCRK6 1713 571 8.53 63969.39 10 CRK
HbCRK7 1749 583 7.61 65483.01 10 CRK
HbCRK8 387060548 1782 594 8.99 66942.73 10 CRK
HbCRK9 1782 594 8.81 66864.31 10 CRK
b) M. esculenta
MeCPKs or MeCRKs PACID Chromosome /scaffold Coordinates (5′–3′) CDS length in bp Predicted protein No. of introns Group
Length (aa) Isoelectric point Mol Wt
MeCPK1 17994103 scaffold08542 688509–691868 1932 644 5.02 72133.41 6 CPKI
MeCPK2 17976152 scaffold12865 417463–425519 1722 574 5.08 64055.78 6 CPKI
MeCPK3 17971973 scaffold06582 497705–502368 1674 558 5.52 62573.99 6 CPKI
MeCPK4 17984594 scaffold02040 210153–214213 1674 558 5.53 62874.42 6 CPKI
MeCPK5 17969086 scaffold08359 2363266–2367666 1647 549 6.57 62586.62 6 CPKIII
MeCPK6 17971267 scaffold10963 249788–253275 1614 538 6.12 60531.19 7 CPKIII
MeCPK7 17968159 scaffold12121 105306–108270 1611 537 5.91 61183.21 8 CPKIII
MeCPK8 17966798 scaffold04681 369819–373312 1605 535 6.43 60124.83 7 CPKIII
MeCPK9 17975050 scaffold06278 662521–666044 1602 534 6.2 60172.73 7 CPKII
MeCPK10 17971020 scaffold05280 746256–751592 1596 532 6.05 59686.91 8 CPKII
MeCPK11 17987801 scaffold03241 233760–237133 1596 532 6.69 59901.47 7 CPKII
MeCPK12 17980235 scaffold04075 9032–12714 1593 531 7 60388.97 7 CPKIII
MeCPK13 17980210 scaffold02242 186503–191550 1593 531 5.85 60293.62 7 CPKIII
MeCPK14 17981799 scaffold06916 982685–986060 1587 529 5.24 58756.69 8 CPKII
MeCPK15 17967725 scaffold07991 65801–68074 1584 528 5.42 58744.47 7 CPKII
MeCPK16 17990251 scaffold06754 43023–46027 1584 528 5.53 60260.13 7 CPKIII
MeCPK17 17988164 scaffold06814 209569–213530 1533 511 5.61 57584 6 CPKI
MeCPK18 17967898 scaffold00853 48033–52009 1509 503 5.33 56559.32 6 CPKI
MeCPK19 17992600 scaffold02811 52985–57215 1506 502 5.4 56697.66 6 CPKI
MeCPK20 17971395 scaffold00467 131837–136151 1503 501 5.49 56753.78 6 CPKI
MeCPK21 17979246 scaffold07520 2142987–2147997 1746 582 8.97 66122.79 11 CPKIV
MeCPK22 17966476 scaffold06512 925585–931028 1704 568 8.99 64446.09 11 CPKIV
MeCRK1 17992954 scaffold03060 94515–100498 1890 630 8.81 70469.23 10 CRK
MeCRK2 17982960 scaffold08352 120824–127160 1890 630 8.89 70275.35 10 CRK
MeCRK3 17975749 scaffold03581 287483–294244 1809 603 9.02 67415.87 10 CRK
MeCRK4 17972581 scaffold03846 35776–42796 1809 603 8.96 67318.61 10 CRK
MeCRK5 17983969 scaffold06353 3656–9704 1794 598 7.58 67487.91 12 CRK
MeCRK6 17977726 scaffold11584 15400–22546 1773 591 9.06 66584.36 10 CRK
MeCRK7 17988236 scaffold02895 195081–201488 1752 584 8.61 65642.26 10 CRK
MeCRK8 17983077 scaffold04094 24034–29752 1728 576 8.23 64515.79 10 CRK
MeCRK9 17961210 scaffold09761 236897–241551 1290 430 6.61 48548.92 10 CRK
c) R. communis
RcCPKs or RcCRKs PACIDa Chromosome /scaffold Coordinates (5′–3′) CDS length in bp Predicted protein No. of introns Group
Length (aa) Isoelectric point Mol Wt
RcCPK1 16802692 29333 292448–295456 1923 641 5.98 72059.09 6 CPKI
RcCPK2 16802702 29333 380788–386245 1752 584 5.32 65395.33 6 CPKI
RcCPK3 16811562 29852 749078–754396 1734 578 5.39 64238.02 6 CPKI
RcCPK4 16817768 30100 635436–641118 1683 561 5.46 62880.09 6 CPKI
RcCPK5 16810728 29842 470020–473807 1653 551 6.2 62094.68 7 CPKII
RcCPK6 16820071 30147 4261059–4265373 1647 549 6.4 62372.39 6 CPKIII
RcCPK7 16819478 30142 206467–209308 1608 536 5.69 59521.44 7 CPKII
RcCPK8 16821242 30169 1209760–1213471 1608 536 6.49 60331.98 7 CPKIII
RcCPK9 16799163 27777 46786–50324 1599 533 6.28 60220.61 7 CPKII
RcCPK10 16812395 29896 35082–37969 1599 533 5.82 60477.19 7 CPKIII
RcCPK11 16808108 29761 124817–128087 1587 529 6.65 60101.64 7 CPKIII
RcCPK12 16822115 30170 3717810–3721220 1587 529 6.21 59735.14 7 CPKII
RcCPK13 16823697 30190 3182769–3187309 1584 528 6.09 59244.51 8 CPKII
RcCPK14 16800511 28308 38002–44802 1575 525 5.82 59384.75 6 CPKIII
RcCPK15 16806882 29728 126431–131585 1491 497 5.33 56030.04 6 CPKI
RcCPK16 16810129 29830 39047–45797 1725 575 9.04 65179.79 11 CPKIV
RcCRK1 16799638 27964 46400–53108 1806 602 8.96 67299.67 10 CRK
RcCRK2 16808369 29780 205986–212347 1794 598 9.15 67650.44 10 CRK
RcCRK3 16817534 30089 1472595–1478763 1767 589 8.98 66035.89 10 CRK
RcCRK4 16805369 29676 110174–114278 1401 467 7.67 51967.11 7 CRK
RcCRK5 16807073 29733 60296–65221 1536 512 7.32 57231.11 10 CRK

All the 161 CDPKs share conserved CDPK domains, including an N‐terminal variable domain, a protein kinase domain, an autoinhibitory domain, and Ca2+‐binding EF‐hands. While CRKs share degenerative Ca2+‐binding EF‐hands compared to CDPKs. The lengths of the CDPK‐ and CRK‐coding regions (CDS) were similar among the six plant species examined, ranging from 1305 to 1893 bp in H. brasiliensis, 1452 to 1938 bp in A. thaliana, 1359 to 1896 bp in O. sativa, 1431 to 1839 bp in P. trichocarpa, 1290 to 1932 bp in M. esculenta, and 1401 to 1923 bp in R. communis (Table 1, Table S1). The molecular weights of the predicted 206 CDPK and CRK proteins range from 48.5 to 72.3 kDa, while their isoelectric points (pI) fall between 5.02 and 9.36 (Table S1).

Phylogenetic analysis of the CDPK and CRK gene families

In order to establish the phylogenetic relationships in the CDPK and CRK gene families among H. brasiliensis and the five other plant species, we aligned the 206 plant CDPK and CRK protein sequences and constructed a phylogenetic tree as shown in Fig. 1. The plant CDPK and CRK proteins that clustered into five major groups with high bootstrap values are named CPKI, CPKII, CPKIII, CPKIV, and CRK. The proteins in three CPK groups (I–III) and the CRK group are further classified into a number of distinct subgroups consisting of both dicot and monocot proteins. The 39 H. brasiliensis genes are scattered among the five groups (CPKI, CPKII, CPKIII, CPKIV, and CRK) with 11, 8, 9, 2, and 9 isoforms, respectively. Similarly, the CDPK and CRK family genes in the five other species are also clustered into different groups (CRKI, II, III, and IV, and CRK): 10, 13, 8, 3, and 8 isoforms, respectively, in A. thaliana; 11, 8, 8, 2, and 5 in O. sativa; 11, 8, 9, 2, and 9 in P. trichocarpa; 8, 5, 7, 2, and 9 in M. esculenta; 5, 5, 5, 1, and 5 in R. communis (Table S1, Fig. 1). Unlike the five other plant species, A. thaliana has a smaller number of genes in the CPK I group than in the CPK II group, which is apparently due to the striking expansion of the subgroup of CPK IIe in A. thaliana (Fig. 1). In all six plant species, CPK IV has the smallest number of genes among the five CPK and CRK groups, and is most closely related to the CRK group rather than the other three CPK groups in the phylogenetic tree (Fig. 1), suggesting the divergence of CPK IV and CRK from a common ancestor comparatively recently. Generally, the HbCPK isoforms are more closely related to their putative CDPK orthologs in M. esculenta and R. communis, which are in the same family of Euphorbiaceae with H. brasiliensis, reflecting consistency in the evolution of CDPK isoforms and plant lineages.

Figure 1.

Figure 1

Phylogenetic analysis of the CDPK and CRK genes in H. brasiliensis and five other plant species. An unrooted phylogenetic tree of plant CDPK and CRK proteins was constructed using the NJ method with the MEGA 6.0 program. Plant species and their CDPK and CRK proteins are: H. brasiliensis, HbCPK1 to 30 and HbCRK1 to 9, marked with red dots; A. thaliana, AtCPK1 to 34 and AtCRK1 to 8; P. trichocarpa, PtCDPK1 to 30 and PtCRK1 to 9; O. sativa, OsCPK1 to 29 and OsCRK1 to 5; M. esculenta, MeCPK1 to 22 and MeCRK1 to 9, marked with green dots; R. communis, RcCPK1 to 16 and RcCRK1 to 5, marked with pink dots.

Phylogenetic analysis as well as amino acid sequence comparison revealed that with the exception of R. communis, universal existence of paralogous CDPK and CRK gene pairs were observed in the five other species. In H. brasiliensis, six such CDPK gene pairs (HbCPK1/25, HbCPK2/7, HbCPK5/12, HbCPK18/19, HbCPK22/26, HbCPK24/28) and one CRK gene pair (HbCRK3/6) were identified. In A. thaliana, there were nine CDPK gene pairs (AtCPK1/2, AtCPK4/11, AtCPK5/6, AtCPK17/34, AtCPK9/33, AtCPK10/30, AtCPK14/32, AtCPK7/8, AtCPK16/18), three CRK gene pairs (AtCRK4/6, AtCRK1/7 and AtCRK2/8), and one paralogous gene cluster in subgroup CPK IIe (AtCPK27, 31, 22, 15, 23 and 21). In M. esculenta, nine CDPK (MeCPK17/20, MeCPK18/19, MeCPK3/4, MeCPK9/11, MeCPK14/15, MeCPK16/7, MeCPK12/13, MeCPK6/8, and MeCPK22/21) and four CRK (MeCRK3/4, MeCRK8/9, MeCRK5/6, and MeCRK1/2) gene pairs were identified. However, in this species the two genes in each pair do not cluster together as closely as in the other plant species examined in this study (Fig. 1), suggesting an earlier divergence of the two genes. In P. trichocarpa, 14 CDPK and four CRK gene pairs were identified, and in O. sativa, 11 closely related CPK pairs and one CRK pair were identified, the results of which are consistent with those from previous studies 28, 41. Upon further examining the genomic locations, we found that some of the paralogous gene pairs were located adjacent to each other, such as PtCDPK10/11 and PtCDPK29/30, PtCDPK16/17 and PtCDPK1/4, AtCPK5/6 and AtCPK18/16, AtCPK17/34 and AtCPK7/8, OsCPK2/3 and OsCPK16/14 (Fig. 2A,B,D–F). These adjacent gene pairs might have evolved from a common ancestor that underwent tandem duplication prior to the segmental duplication. Interestingly, of the six genes in the paralogous cluster observed in A. thaliana, five are closely located in the same chromosome (Fig. 2C), and are apparently derived from tandem duplication events.

Figure 2.

Figure 2

Chromosomal locations and segmental duplication events of CDPK genes in A. thaliana, P. trichocarpa, and O. Sativa. In A. thaliana, the paralogous gene pairs of AtCPK5/6 and AtCPK18/16 are located on Chromosome IV and II (A), AtCPK17/34 and AtCPK7/8 on Chromosome V (B), and the paralogous AtCPK gene cluster on Chromosome IV (C). In P. trichocarpa, the paralogous gene pairs of PtCPK10/11 and PtCPK29/30 are located on Chromosome I and IX (D), and PtCPK16/17 and PtCPK1/4 on Chromosome VI and XVI (E). In O. sativa, the paralogous gene pairs of OsCPK2/14 and PtCPK3/16 are located on Chromosome I and V (F).

Structural organization of CDPK and CRK genes

The exon–intron structures of the 205 CDPK and CRK genes in six plant species were determined based on the predicted sequences. As shown in Fig. 3A, most H. brasiliensis CDPK members within the same groups share very similar gene structures in terms of intron number, domain localization, and exon length. Although the lengths vary, introns are inserted into nearly the same locations of the gene ORFs. There are 6, 7–8, 6–9, 10, and 11 introns in the CPK I, CPK II, CPK III, CPK IV, and CRK groups, respectively. The number of introns in different CPK and CRK groups is broadly similar in the five other plants examined (Fig. 3B–F), containing mainly 5–8 introns in CPK I to III groups, and 11–12 introns in CPK IV and CRK groups. The similar exon–intron structure shared by CPK IV and CRK genes reflects their close phylogenetic relationship. Most CDPK members contain two EF‐hand pairs, except for a few members, such as AtCPK25, which contains only one EF‐hand pair. It is noted that the EF‐pair domain in group CRK is a degenerative form of the EF‐hand domain that could be predicted with Gene3D but not with Pfam and ProSiteProfiles as used for the identification of the EF‐hand pairs in CPKs. In addition, the lengths of most AtCPK genes are shorter than those of the other plant CDPK genes, suggesting a correlation of the CDPK gene length with the genome size of its source species.

Figure 3.

Figure 3

Structural organization of CDPK and CRK genes from H. brasiliensis and five other plant species. (A–F), structural organization of CDPK and CRK genes in H. brasiliensis, M. esculenta, R. communis A. thaliana, P. trichocarpa, and O. sativa, respectively. Exons and introns are represented by boxes and black lines, respectively. The Ser/Thr kinase catalytic domain is represented by red boxes. The EF‐hand domains predicted by Pfam and ProSiteProfiles are represented by boxes of green, whereas the EF‐pair domains predicted by Gene3D are represented by boxes of purple, which were degenerative Ca2+‐binding EF‐hands. The sizes of exons and introns are proportional to their sequence lengths.

Expression analysis of CDPK and CRK genes in six plant species

Increasing evidence indicates that CDPKs are involved in various physiological adaptations 17, 19, 42. Such functions are indicated by the expression of CDPK genes in response to various stimuli, for example, hormones, salt, cold, drought, heat, and wounding. To understand the potential functions of specific members of CDPKs and CRKs in the six plant species, their expression patterns in different tissues, developmental stages, and under different stress treatments were analyzed. The Solexa sequencing data available at the NCBI Sequence Read Archive (SRA) database were used for the expression analysis of CDPK and CRK genes in five species, i.e. M. esculenta, R. communis A. thaliana, P. trichocarpa, and O. sativa. In the case of H. brasiliensis, two sets of Solexa sequencing data were used, one from the NCBI SRA database (http://www.ncbi.nlm.nih.gov/nuccore/448814761) and the other from our own data 38. As shown in Fig. 4A, transcripts of nine HbCPK genes (HbCPK1, 2, 3, 7, 14, 17, 22, 25, 26, and 28) and five HbCRK genes (HbCRK4, 5, 6, 7, and 8) were barely detectable in almost all the tissues and all the treatments examined. Such genes comprise a large portion (~ 1/3) of the total HbCPK and HbCRK gene family. This character seems to be shared by the CDPK and CRK gene families in other plant species. For example, similar expression patterns were observed for eight of 31 CDPK and CRK genes in M. esculenta (Fig. 4B), seven of 21 in R. communis (Fig. 4C), 15 of 42 in A. thaliana (Fig. 4D), 13 of 39 in P. trichocarpa (Fig. 4E), and 13 of 35 in O. sativa (Fig. 4F). This result suggests that the CDPK and CRK gene families in higher plants may have experienced an event of gene expansion followed by nonfunctionalization in the course of evolution 43. Due to the data limitation of the SRA database, some analyses may not be so accurate and need further verification. For example, AtCPK16 and AtCPK20 are highly expressed but only in pollen which has not been analyzed here 44. Among the expressed H. brasiliensis genes, HbCPK24 and HbCRK9 were special for their highly specific expression, which showed abundant expression in the leaf when exposed to low temperature and in the seed, respectively, but their expression were otherwise hardly detected in nearly all the tissues and treatments (Fig. 4A). In comparison, the remaining HbCPK and HbCRK genes were expressed in a wide range of tissues, showing dissimilar but partially overlapping patterns of expression. In the bark, where the rubber‐producing laticifers are located, 16 HbCPK genes were expressed more abundantly than in the other tissues (Table S1–1, Fig. 4A), and these genes may contain the key CDPK member s involved in signaling transduction in the rubber tree bark. HbCPK13 and 27 were abundantly expressed in latex, essentially the cytoplasm of laticifers, whereas HbCPK10 was mainly expressed in leaves (Table S1–1, Fig. 4A). To obtain further information on the HbCPK and HbCRK genes in leaf development, we examined their expression levels by RNA‐seq at four progressive stages of leaf development (bronze, color change, pale‐green, and mature). As shown in Fig. 4A and Table S1–1, most of the HbCPK and HbCRK genes were obviously down‐regulated during leaf development, and their expression was mainly restricted to the first three stages (bronze, color change, and pale‐green). This result is in agreement with the assay of CDPK activity in maize, in which expanding tissues such as rapidly growing tips, leaves, and coleoptiles have particularly high levels of CDPK activity, while mature leaves have much less activity 45. The involvement of CDPK genes in early developmental processes such as embryogenesis, seed development, and germination has been reported in sandalwood 46. Here, we reveal that one R. communis CDPK gene in subgroup CPK IIc, RcCPK12, was mainly expressed in the early stages of embryo development and the male developing flowers, suggesting a similar function. It is interesting that the other members of this subgroup were either expressed at a low level or they showed no expression.

Figure 4.

Figure 4

Expression analyses of the CDPK and CRK genes based on Solexa sequencing. (A), hierarchical clustering and differential expression analysis of the HbCPK and HbCRK genes in seven tissues (leaf, bark, latex, root, seed, female flower, male flower), at four developmental stages of leaves (bronze, color change, pale‐green, and mature), during ethephon treatment (0, 3, 12, and 24 h), Corynespora cassiicola tolerance (PRJNA179126), abiotic stress (drought and low temperature, PRJNA182078; and ethephon treatment, PRJNA182079), and tissues (leaf, bark, and latex, PRJNA201084); (B), hierarchical clustering and differential expression analysis of the MeCPK and MeCRK genes in different tissues (root, leaf, stem, PRJNA248260), infected by pathogenic Xanthomonas (PRJNA231851), CBSV virus (PRJNA243380), and bacterial blight pathogen (PRJNA257332); (C), hierarchical clustering and differential expression analysis of the RcCPK and RcCRK genes in different tissues (PRJEB2660) and during four oilseed development stages (PRJNA79463); (D), hierarchical clustering and differential expression analysis of the AtCPK and AtCRK genes in different tissues (floral bud, root, seeding, PRJNA231088), UV treatment (PRJNA272425), cold stress (PRJNA218632), salt stress (0, 50, 100, 150 mm, PRJNA217812); (E), hierarchical clustering and differential expression analysis of the PtCDPK and PtCRK genes under ABA stimulation (0, 1, 4, 8, 12, and 24 h, PRJNA232098), methyl jasmonate stimulation (PRJNA244820), chilling, freezing, and heat shock (PRJNA207974, PRJNA215888), salinity stress (0, 6, 12, 24, and 72 h, PRJNA230867); (F), hierarchical clustering and differential expression analysis of the OsCPK and OsCRK genes in different tissues (LE: leaf, RO: root, SH: shoot, PABF: panicle before flowering, PAAF: pannicle after flowering, CA: callus, SE: seed, PRJDA67119), salinity stress (PRJDA46487), high night temperature stress (PRJNA267031), abscisic acid (ABA), and gibberellic acid (GA) treatments (PRJNA213797).

Ethephon, an ethylene generator, is widely used in H. brasiliensis to stimulate rubber production, but the yield‐stimulating mechanisms are still poorly understood 29, 31. Ethylene‐mediated cross‐talk has been observed between CDPK and MAPK, indicative of signaling that controls stress responses in plants 23. In this study, we examined the expression levels of HbCPK and HbCRK genes in latex under ethephon treatment. As shown in Fig. 4A and Table S1–1, the expressions of two CPK genes, HbCPK9 and 15, were obviously up‐regulated by ethephon treatment, implicating them in the ethylene‐simulated latex production. Further studies on these genes would help to understand the underlying molecular mechanism. Although the expression of one HbCPK gene, HbCDPK1 (HbCPK30 in this study) has been reported to be markedly induced by ethephon 31, it was expressed mainly in the leaf and only marginally in latex in the present study (Fig. 4A). In P. trichocarpa, most of the CDPK and CRK genes were associated with ABA activity, but several genes were also affected by MeJa (methyl jasmonate), which apparently down‐regulated the expression of PtCDPK1, 4, and 11 (Fig. 4E, Table S1). In O. sativa, many CDPK genes were up‐regulated by treatment with ABA, GA (gibberellic acid), or ABA plus GA. In a previous study, AtCPK4 and AtCPK11 have been demonstrated to be involved in ABA signaling‐mediated regulation of seed germination, seedling growth, stomatal movement, and salt stress tolerance 17. Together, these results suggest that the CDPK and CRK gene families are implicated in the regulation of plant growth and development through participation in the signaling pathways of various plant hormones, especially ABA.

As low temperature is the major obstacle to the expansion of rubber planting areas in the subtropics, the studies of the low‐temperature response and adaptation in this species would be helpful in breeding rubber trees for cold tolerance. Recently, Ma et al. 47 found that low temperature sensing in rice was related to changes in Ca2+ influx during cold treatment, and the change in Ca2+ influx was controlled by COLD1, a regulator of G‐protein signaling. In this study, the expression levels of HbCPK and HbCRK genes (Ca2+ sensors) were examined under cold stress. Many HbCPK and HbCRK genes are regulated by cold stress, and most of them showed depressed expression after low‐temperature treatment (Fig. 4A, Table S1–1). In three of the other plants examined (A. thaliana, O. sativa, and P. trichocarpa), the expression of many CDPK and CRK genes was also regulated by low temperatures, but different expression patterns were displayed by respective genes (Fig. 4D–F; Table S1–4, 1–5 and 1–6). In addition, the expression data used in this study also show some discrepancies with other published studies. For example in rice, OsCPK9 and OsCPK21 have been reported to be induced by salt stress and ABA 22, 48, which is not observed in Fig. 4F. These differences may be due to different approaches, kinetics, or studied organs/ tissues.

The expression levels of CDPK and CRK genes in H. brasiliensis, A. thaliana, O. sativa, and P. trichocarpa were also examined under other kinds of stresses, including fungus infection, drought, and salt. The results showed that these treatments could also regulate the expression of many CDPK genes (Fig. 4A,D–F, Table S1). Under these stresses, the H. brasiliensis and P. trichocarpa CDPK and CRK genes were mainly down‐regulated, while the A. thaliana and O. sativa genes were mainly up‐regulated (Table S1). To verify the expression patterns of the RNA‐seq analyses, quantitative reverse transcriptase PCR (qPCR) expressional analyses were performed on HbCPK genes, which are among the isoforms somewhat regulated by ethephon treatment and leaf development, or tissue‐specific as revealed by RNA‐seq data (Fig. 4A; Table S1–1). First, qPCR expressional analyses were performed with the RNA samples from the same cultivated varieties as Solexa sequencing (our own data). As shown in Fig. 5, the results from sequencing‐based expression analyses were broadly similar to the qPCR results. Second, new RNA samples were used to further verify the expression patterns of HbCPK genes which are regulated by the ethephon treatment, the new RNA samples were different from the samples of Solexa sequencing and have three biological replicates. As shown in Fig. 6, the results from sequencing‐based expression analyses were broadly similar to the qPCR results at least one time point post treatment. The RNA‐seq data were also verified by our published analyses 38, 49. Above all, we can verify that the results of the RNA‐seq analyses on HbCPK genes are authentic.

Figure 5.

Figure 5

Expressional analyses of HbCPK and HbCRK genes by quantitative PCR and Solexa sequencing. (A) the expression patterns of six genes after ethephon treatment (0, 3, 12, and 24 h); (B) the expression patterns of six genes at four progressive stages of leaf development, that is, bronze (Br), color change (Cc), pale‐green (Pg), mature (Ma); C, the expression patterns of six genes in seven tissues, that is, leaf (Lf), bark (Ba), latex (Lt), root (Rt), seed (Sd), female flower (Ff), and male flower (Mf). For each gene, the RNA samples used for qPCR assays were the same as Solexa sequencing, the expression patterns were compared by using Solexa sequencing (upper panel) and quantitative PCR (lower panel). The results of quantitative PCR was shown as means ± STDEV of three technical replicates.

Figure 6.

Figure 6

Expression of six HbCPK genes in response to ethephon treatment as assayed by qPCR and Solexa sequencing. The expression of six HbCPK genes in the latex was analyzed after different intervals (0, 3, 12 and 24 h) from ethephon treatment with new samples, which were different from the samples of Solexa sequencing and have three biological replicates. For each gene, the expression patterns from Solexa sequencing (upper panel) and by qPCR (lower panel) are compared. qPCR results are means (n = 15) ± STDEV of three biological replicates. Each time point was compared with 0 h. Asterisks indicate significant differences (Student's t‐test, P < 0.05).

Expression analysis of CDPK and CRK genes based on structure and evolution

The two closely related genes in each of the CDPK and CRK paralogous gene pairs mentioned earlier may have similar cellular localization and similar roles, as reported for the A. thaliana AtCPK4 and AtCPK11 17. However, when the expression patterns of the H. brasiliensis paralogous gene pairs were analyzed (Fig. 4A), the two genes in the same gene pair displayed four different expression patterns. First, in the case of three gene pairs (HbCPK1/25, HbCPK2/7, and HbCPK22/26), both genes were expressed either at a low level or not at all in all the tissues and treatments examined. Second, in the gene pair of HbCPK5/12 and HbCPK18/19, both genes exhibited a similar pattern of universal expression across all tissues. Third, for the gene pair of HbCRK3/6, the two genes displayed dissimilar patterns of expression, with HbCRK3 showing universal expression but HbCRK6 being expressed at very low levels in all the tissues or treatments. Fourth, for the gene pair of HbCPK24/28, HbCPK28 was barely expressed in all the tissues or treatments, but the expression of HbCPK24 was only restricted in leaf when exposed to the low‐temperature treatment. We also investigated the expression patterns of the genes pairs or clusters that are closely located on chromosomes of A. thaliana, O. sativa, and P. trichocarpa (Fig. 2). The results showed that the two paralogous genes in most of the gene pairs shared similar expression except AtCPK5 and 6 (Fig. 4D–F). AtCPK5 was expressed at very high levels in all the samples examined, while AtCPK6 was mainly specifically expressed in the root. In the paralogous gene cluster of AtCPKs in subgroup CPK IIe, only AtCPK21 was expressed in all the tissues and treatments, whereas the other members (AtCPK22, 23, 27, and 31) were expressed at low levels or not at all in all the samples examined. Interestingly, the CDPK and CRK genes from different plant species that exhibited low or no expressions in nearly all the samples examined tended to cluster in the same subgroups, for example, CPK Ib and c, CPK IIa and c, CPK IIIa and CRK a (Figs 1 and 4). This kind of phenomenon can be extended to the universally expressed CDPK and CRK genes from different species. These findings suggest that the structures of some CDPK and CRK gene families coevolved with their expression patterns in higher plants.

Conclusion

In this study, we pioneered a genome‐wide analysis of two protein kinase subfamilies (CDPK and CRK) in H. brasiliensis, M. esculenta, and R. communis. In silico analysis of the H. brasiliensis genome database allowed the identification of 30 HbCPK and 9 HbCRK genes. The phylogenetic analysis of CDPKs and CRKs from H. brasiliensis and five other plant species (A. thaliana, O. sativa, P. trichocarpa, M. esculenta, and R. communis) showed the classification of these genes into five major groups. Members within each group might have recent common evolutionary origins, as they share common protein motifs and exon–intron structures. Solexa sequencing analyses revealed that most H. brasiliensis CDPK and CRK genes exhibit different patterns of expression under a number of experiments, suggesting their distinct roles in developmental and stress responses. Relevant studies of gene evolution and expression have been extended to the five other plant species. The results presented here provide a foundation for further functional investigation of the CDPK and CRK gene families in H. brasiliensis as well as the whole plant kingdom.

Materials and methods

Database search for CDPK and CRK genes in H. brasiliensis and five other plant species

Sequences of A. thaliana, P. trichocarpa, and O. sativa CDPKs and their closely related CRK genes were downloaded from the A. thaliana Information Resource (http://www.Arabidopsis.org/), the rice genome annotation database (http://rice.plantbiology.msu.edu/) and GenBank (http://www.ncbi.nlm.nih.gov/genbank), respectively. The genome and protein sequences of A. thaliana, O. sativa, P. trichocarpa, M. esculenta, and R. communis were downloaded from Phytozome v10 (http://www.phytozome.net/). The H. brasiliensis genome and transcriptome data were obtained from GenBank (http://www.ncbi.nlm.nih.gov/nuccore/448814761) and our own data 38. Local BLAST alignment was performed using published CDPK and CRK sequences form A. thaliana, P. trichocarpa, and O. sativa as queries to search against the deduced proteome of each species for the candidate CDPKs and CRKs from H. brasiliensis, A. thaliana, O. sativa, P. trichocarpa, M. esculenta, and R. communis. All putative candidates were manually verified with the InterProScan server (http://www.ebi.ac.uk/Tools/pfa/iprscan/) to confirm the presence of protein kinase and EF‐hand domains.

Phylogenetic and gene structure analyses

Multiple alignments of the amino acid sequences of CDPKs and CRKs from six species were performed using the clustal x (version 1.83, http://www.clustal.org/) program. The phylogenetic tree was constructed with mega6.0 (http://www.megasoftware.net/) by employing the Neighbor‐Joining (NJ) method with a bootstrap test for 1000 replicates. Exon–intron structures of the six species of CDPK and CRK genes were analyzed by comparing the cDNA and their genomic DNA sequences through the web server gsds 2.0 (http://gsds.cbi.pku.edu.cn/).

Expression analysis based on Solexa sequencing

For Solexa sequencing‐based expression analyses, SRA data were downloaded from the NCBI database. The sequences included those for H. brasiliensis (Corynespora cassiicola tolerance, PRJNA179126; abiotic stress, PRJNA182078 and PRJNA182079; tissues, PRJNA201084; tissues, leaf development, and ethephon treatment 38), M. esculenta (Xanthomonas tolerance, PRJNA231851; CBSV virus infected, PRJNA243380; tissue, PRJNA248260; bacterial blight pathogen infected, PRJNA257332), R. communis (tissue, PRJEB2660; developing oilseeds, PRJNA79463), A. thaliana (salt stress, PRJNA217812; tissues, PRJNA231088; UV treatment, PRJNA272425; cold stress, PRJNA218632), O. sativa (high night temperature stress, PRJNA267031; salinity stress, PRJDA46487; tissues, PRJDA67119; ABA and giberellic acid treatments, PRJNA213797), and P. trichocarpa (ABA stimulation, PRJNA232098; methyl jasmonate treatment, PRJNA244820; chilling, freezing and heat shock, PRJNA207974 PRJNA215888; salinity stress, PRJNA230867) (Table S2). For H. brasiliensis samples, additional datasets were used for expression analysis as described previously 38, 49. These sets included data for seven different tissues (latex, bark, leaf, root, seed, female flower, and male flower), leaves of four developmental stages (bronze, color change, pale‐green, and mature), and latex collected at 0, 3, 12, and 24 h after ethephon stimulation.

Quantitative reverse transcriptase PCR (qPCR)

To verify the data obtained by Solexa sequencing, quantitative RT‐PCR (qPCR) was performed as describe previously 32. The RNA samples used for qPCR assays were the same as described previously 49. The reaction was conducted on the Light Cycler 2.0 system (Roche Diagnostics, Mannheim, Germany) by using the SYBR‐Green premix kit (TaKaRa) according to the manufacturer's protocol. The primer pairs used for the HbCPK and HbCRK genes were 5′‐AGATAGAGAGGGTCAACTCTG GAC‐3′ (F) and 5′‐GCTTGTCTTTGTTTTTTGTATGTG‐3′ (R) (HbCPK5), 5′‐TAGTTTCAGCATTG GATTTAGAGA‐3′ (F) and 5′‐AGTTATAAAGGTCTGCCTGCTTCT‐3′ (R) (HbCPK6), 5′‐TTCTTCC CTTTTGTTTTTTCTCTC‐3′ (F) and 5′‐CTTCTTCTTGCGTCTGTGATTTGT‐3′ (R) (HbCPK8), 5′‐C AAGTTCCCAACATTTAACCTTCT‐3′ (F) and 5′‐GAAGAGTCAGCGGCGTTAGC‐3′ (R) (HbCP K9), 5′‐AGAGAAAGATTCAATAGTCTGAGCT‐3′ (F) and 5′‐ACTTGTGATGTATTTACAACCACA TA‐3′ (R) (HbCPK10), 5′‐GGGTATCATCTGAATCTGCTTCTG‐3′ (F) and 5′‐GCAGTATCATTGTA GAGCCGTGG‐3′ (R) (HbCPK11), 5′‐CCATTAACACAAGCAGGTCAAGTC‐3′ (F) and 5′‐CGGTA AGGAAGAACCCA TTTG‐3′ (R) (HbCPK12), 5′‐GAT GGGTCATTAGAACTGAACAGT‐3′ (F) and 5′‐AACCAGGGCTCACATCCTATTTA‐3′ (R) (HbCPK13), 5′‐CTGCAACTCACAGATCATTCCCT C‐3′ (F) and 5′‐AAAGTTTTGCTCACGGCCTTC‐3′ (R) (HbCPK15), 5′‐ACCAACCACTGCTACCA ACG‐3′ (F) and 5′‐TACTTCCAAGACTGAGCAAAAGAT‐3′ (R) (HbCPK16), 5′‐CATTCAACGAT GAGGAAGACGAG‐3′ (F) and 5′‐TTTTTAAAGTGCAAATTTCGTCCC‐3′ (R) (HbCPK19), 5′‐GG AGACAAGTGAGAGAGTTACAGAA‐3′ (F) and 5′‐CATCCTATGGGGAATCCTACC‐3′ (R) (HbCP K21), 5′‐ATTCTTTCAGGTAAGCATGTATGC‐3′ (F) and 5′‐AGAAATTAAAAAGGGTTGTAAT CC‐3′ (R) (HbCPK27), 5′‐GGCACACTGATGGAAAGTTGAGT‐3′ (F) and 5′‐TTTTGGAGCTTCTG CATTAGTTTA‐3′ (R) (HbCRK2), and 5′‐CTGTGAAGAGTGCTGCAAGTTAAA‐3′ (F) and 5′‐GG TAAGAACAAAGAGGAAAAACAT‐3′ (R) (HbCRK3). The H. brasiliensis UBC2b and UBC4 gene were used as internal controls as described previously 50. The details for experimental manipulations and data analysis were as described by Tang et al. 32.

Author contributions

CRT conceived and designed the experiments; XHX, MY, JLS, and JYQ performed the experiments; XHX, MY, and YJF analyzed the data; XHX, MY, SNH, and CRT wrote the paper. All authors read and approved the final manuscript.

Supporting information

Table S1. Characteristics of CDPK and CRK genes in six plant species (H. brasiliensis, A. thaliana, P. trichocarpa, and O. sativa).

Table S2. Basic information for the Solexa sequencing data of Hevea brasiliensis and five other plant species.

Acknowledgements

This work was supported by National Natural Science Foundation of China [Grant numbers 31400565], the 863 Program [2013AA102605], the earmarked fund for Modern Agro‐industry Technology Research System [CARS‐34‐GW2].

References

  • 1. Kiep V, Vadassery J, Lattke J, Maass JP, Boland W, Peiter E and Mithofer A (2015) Systemic cytosolic Ca elevation is activated upon wounding and herbivory in Arabidopsis. New Phytol 207, 996–1004. [DOI] [PubMed] [Google Scholar]
  • 2. Xiong L, Schumaker KS and Zhu JK (2002) Cell signaling during cold, drought, and salt stress. Plant Cell 14 (Suppl), S165–S183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Zhu JK (2001) Plant salt tolerance. Trends Plant Sci 6, 66–71. [DOI] [PubMed] [Google Scholar]
  • 4. Zhu JK (2002) Salt and drought stress signal transduction in plants. Annu Rev Plant Biol 53, 247–273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Evans NH, McAinsh MR and Hetherington AM (2001) Calcium oscillations in higher plants. Curr Opin Plant Biol 4, 415–420. [DOI] [PubMed] [Google Scholar]
  • 6. Tuteja N and Mahajan S (2007) Calcium signaling network in plants: an overview. Plant Signal Behav 2, 79–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Luan S (2009) The CBL‐CIPK network in plant calcium signaling. Trends Plant Sci 14, 37–42. [DOI] [PubMed] [Google Scholar]
  • 8. McCormack E, Tsai YC and Braam J (2005) Handling calcium signaling: Arabidopsis CaMs and CMLs. Trends Plant Sci 10, 383–389. [DOI] [PubMed] [Google Scholar]
  • 9. Ludwig AA, Romeis T and Jones JD (2004) CDPK‐mediated signalling pathways: specificity and cross‐talk. J Exp Bot 55, 181–188. [DOI] [PubMed] [Google Scholar]
  • 10. Harmon AC, Gribskov M and Harper JF (2000) CDPKs – a kinase for every Ca2+ signal? Trends Plant Sci 5, 154–159. [DOI] [PubMed] [Google Scholar]
  • 11. Harper JF, Sussman MR, Schaller GE, Putnam‐Evans C, Charbonneau H and Harmon AC (1991) A calcium‐dependent protein kinase with a regulatory domain similar to calmodulin. Science 252, 951–954. [DOI] [PubMed] [Google Scholar]
  • 12. Hrabak EM, Chan CW, Gribskov M, Harper JF, Choi JH, Halford N, Kudla J, Luan S, Nimmo HG, Sussman MR et al (2003) The Arabidopsis CDPK‐SnRK superfamily of protein kinases. Plant Physiol 132, 666–680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Schulz P, Herde M and Romeis T (2013) Calcium‐dependent protein kinases: hubs in plant stress signaling and development. Plant Physiol 163, 523–530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Boudsocq M and Sheen J (2013) Cdpks in immune and stress signaling. Trends Plant Sci 18, 30–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Simeunovic A, Mair A, Wurzinger B and Teige M (2016) Know where your clients are: subcellular localization and targets of calcium‐dependent protein kinases. J Exp Bot 67, 3855–3872. [DOI] [PubMed] [Google Scholar]
  • 16. Zou JJ, Wei FJ, Wang C, Wu JJ, Ratnasekera D, Liu WX and Wu WH (2010) Arabidopsis calcium‐dependent protein kinase CPK10 functions in abscisic acid‐ and Ca2+‐mediated stomatal regulation in response to drought stress. Plant Physiol 154, 1232–1243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Zhu SY, Yu XC, Wang XJ, Zhao R, Li Y, Fan RC, Shang Y, Du SY, Wang XF, Wu FQ et al (2007) Two calcium‐dependent protein kinases, CPK4 and CPK11, regulate abscisic acid signal transduction in Arabidopsis. Plant Cell 19, 3019–3036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Zhao R, Sun HL, Mei C, Wang XJ, Yan L, Liu R, Zhang XF, Wang XF and Zhang DP (2011) The Arabidopsis Ca2+‐dependent protein kinase CPK12 negatively regulates abscisic acid signaling in seed germination and post‐germination growth. New Phytol 192, 61–73. [DOI] [PubMed] [Google Scholar]
  • 19. Xu J, Tian YS, Peng RH, Xiong AS, Zhu B, Jin XF, Gao F, Fu XY, Hou XL and Yao QH (2010) AtCPK6, a functionally redundant and positive regulator involved in salt/drought stress tolerance in Arabidopsis. Planta 231, 1251–1260. [DOI] [PubMed] [Google Scholar]
  • 20. Saijo Y, Hata S, Kyozuka J, Shimamoto K and Izui K (2000) Over‐expression of a single Ca2+‐dependent protein kinase confers both cold and salt/drought tolerance on rice plants. Plant J 23, 319–327. [DOI] [PubMed] [Google Scholar]
  • 21. Abbasi F, Onodera H, Toki S, Tanaka H and Komatsu S (2004) OsCDPK13, a calcium‐dependent protein kinase gene from rice, is induced by cold and gibberellin in rice leaf sheath. Plant Mol Biol 55, 541–552. [DOI] [PubMed] [Google Scholar]
  • 22. Asano T, Hakata M, Nakamura H, Aoki N, Komatsu S, Ichikawa H, Hirochika H and Ohsugi R (2011) Functional characterisation of OsCPK21, a calcium‐dependent protein kinase that confers salt tolerance in rice. Plant Mol Biol 75, 179–191. [DOI] [PubMed] [Google Scholar]
  • 23. Ludwig AA, Saitoh H, Felix G, Freymark G, Miersch O, Wasternack C, Boller T, Jones JD and Romeis T (2005) Ethylene‐mediated cross‐talk between calcium‐dependent protein kinase and MAPK signaling controls stress responses in plants. Proc Natl Acad Sci USA 102, 10736–10741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Romeis T, Ludwig AA, Martin R and Jones JD (2001) Calcium‐dependent protein kinases play an essential role in a plant defence response. EMBO J 20, 5556–5567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Kong X, Lv W, Jiang S, Zhang D, Cai G, Pan J and Li D (2013) Genome‐wide identification and expression analysis of calcium‐dependent protein kinase in maize. BMC Genom 14, 433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Ray S, Agarwal P, Arora R, Kapoor S and Tyagi AK (2007) Expression analysis of calcium‐dependent protein kinase gene family during reproductive development and abiotic stress conditions in rice (Oryza sativa L. ssp. indica). Mol Genet Genomics 278, 493–505. [DOI] [PubMed] [Google Scholar]
  • 27. Zhang H, Liu WZ, Zhang Y, Deng M, Niu F, Yang B, Wang X, Wang B, Liang W, Deyholos MK et al (2014) Identification, expression and interaction analyses of calcium‐dependent protein kinase (CPK) genes in canola (Brassica napus L.). BMC Genom 15, 211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Zuo R, Hu R, Chai G, Xu M, Qi G, Kong Y and Zhou G (2013) Genome‐wide identification, classification, and expression analysis of CDPK and its closely related gene families in poplar (Populus trichocarpa). Mol Biol Rep 40, 2645–2662. [DOI] [PubMed] [Google Scholar]
  • 29. d'Auzac J, Jacob JL, Prévôt JC, Clément A, Gallois R, Crestin H, Lacote R, Pujade‐Renaud V and Gohet E (1997) The regulation of cis‐polyisoprene production (natural rubber) from Hevea brasiliensis Recent Research Developments in Plant Physiology (Pandalai SG, ed), pp. 273–332. Research Singpost, Trivandrum, India. [Google Scholar]
  • 30. Hao BZ and Wu JL (2000) Laticifer differentiation in Hevea brasiliensis: induction by exogenous jasmonic acid and linolenic acid. Ann Bot 85, 37–43. [Google Scholar]
  • 31. Zhu JH, Chen X, Chang WJ, Tian WM and Zhang ZL (2010) Molecular characterization of HbCDPK1, an ethephon‐induced calcium‐dependent protein kinase gene of Hevea brasiliensis . Biosci Biotech Biochem 74, 2183–2188. [DOI] [PubMed] [Google Scholar]
  • 32. Tang CR, Huang DB, Yang JH, Liu SJ, Sakr S, Li HP, Zhou YH and Qin YX (2010) The sucrose transporter HbSUT3 plays an active role in sucrose loading to laticifer and rubber productivity in exploited trees of Hevea brasiliensis (Para rubber tree). Plant, Cell Environ 33, 1708–1720. [DOI] [PubMed] [Google Scholar]
  • 33. Walbot V (2000) Arabidopsis thaliana genome. A green chapter in the book of life. Nature 408, 794–795. [DOI] [PubMed] [Google Scholar]
  • 34. Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A et al (2006) The genome of black cottonwood, Populus trichocarpa (Torr.&Gray). Science 313, 1596–1604. [DOI] [PubMed] [Google Scholar]
  • 35. Yu J, Hu S, Wang J, Wong GK, Li S, Liu B, Deng Y, Dai L, Zhou Y, Zhang X et al (2002) A draft sequence of the rice genome (Oryza sativa L. ssp. indica). Science 296, 79–92. [DOI] [PubMed] [Google Scholar]
  • 36. Wang W, Feng B, Xiao J, Xia Z, Zhou X, Li P, Zhang W, Wang Y, Møller BL, Zhang P et al (2014) Cassava genome from a wild ancestor to cultivated varieties. Nat Commun 5, 5110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Chan AP, Crabtree J, Zhao Q, Lorenzi H, Orvis J, Puiu D, Zhang W, Wang Y, Møller BL, Zhang P et al (2010) Draft genome sequence of the oilseed species Ricinus communis . Nat Biotechnol 8, 951–956. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Tang C, Yang M, Fang Y, Luo Y, Gao S, Xiao X, An Z, Zhou B, Zhang B, Tan X et al (2016) The rubber tree genome reveals new insights into rubber production and species adaptation. Nat Plants 2, 16073. [DOI] [PubMed] [Google Scholar]
  • 39. Mohanta TK, Nibedita M, Mohanta YK and Hanhong B (2015) Genome‐wide identification of calcium dependent protein kinase gene family in plant lineage shows presence of novel D‐x‐D and D‐E‐L motifs in EF‐hand domain. Front Plant Sci 6, 1146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Cheng SH, Willmann MR, Chen HC and Sheen J (2002) Calcium signaling through protein kinases. The Arabidopsis calcium‐dependent protein kinase gene family. Plant Physiol 129, 469–485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Asano T, Tanaka N, Yang G, Hayashi N and Komatsu S (2005) Genome‐wide identification of the rice calcium‐dependent protein kinase and its closely related kinase gene families: comprehensive analysis of the CDPKs gene family in rice. Plant Cell Physiol 46, 356–366. [DOI] [PubMed] [Google Scholar]
  • 42. Klimecka M and Muszynska G (2007) Structure and functions of plant calcium‐dependent protein kinases. Acta Biochim Pol 54, 219–233. [PubMed] [Google Scholar]
  • 43. Lynch M and Conery JS (2000) The evolutionary fate and consequences of duplicate genes. Science 290, 1151–1155. [DOI] [PubMed] [Google Scholar]
  • 44. Harper JF, Breton G and Harmon A (2004) Decoding Ca2+ signals through plant protein kinases. Annu Rev Plant Biol 55, 263–288. [DOI] [PubMed] [Google Scholar]
  • 45. Barker L, Templeton M and Ferguson I (1998) A 67‐kDa plasma‐membrane‐bound Ca2+‐stimulated protein kinase active in sink tissue of higher plants. Planta 205, 197. [Google Scholar]
  • 46. Anil VS and Rao KS (2000) Calcium‐mediated signaling during sandalwood somatic embryogenesis. Role for exogenous calcium as second messenger. Plant Physiol 123, 1301–1312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Ma Y, Dai X, Xu Y, Luo W, Zheng X, Zeng D, Pan Y, Lin X, Liu H, Zhang D et al (2015) COLD1 confers chilling tolerance in rice. Cell 160, 1209–1221. [DOI] [PubMed] [Google Scholar]
  • 48. Wei S, Hu W, Deng X, Zhang Y, Liu X, Zhao X, Luo Q, Jin Z, Li Y, Zhou S et al (2014) A rice calcium‐dependent protein kinase oscpk9 positively regulates drought stress tolerance and spikelet fertility. BMC Plant Biol 14, 133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Xiao X, Tang C, Fang Y, Yang M, Zhou B, Qi J and Zhang Y (2014) Structure and expression profile of the sucrose synthase gene family in the rubber tree: indicative of roles in stress response and sucrose utilization in the laticifers. FEBS J 281, 291–305. [DOI] [PubMed] [Google Scholar]
  • 50. Li HP, Qin YX, Xiao XH and Tang CR (2011) Screening of valid reference genes for real‐time RT‐PCR data normalization in Hevea brasiliensis and expression validation of a sucrose transporter gene HbSUT3. Plant Sci 181, 132–139. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1. Characteristics of CDPK and CRK genes in six plant species (H. brasiliensis, A. thaliana, P. trichocarpa, and O. sativa).

Table S2. Basic information for the Solexa sequencing data of Hevea brasiliensis and five other plant species.


Articles from FEBS Open Bio are provided here courtesy of Wiley

RESOURCES