Abstract
Background
Heterogeneous nuclear ribonucleoprotein A2B1 (HNRNPA2B1) is closely related to tumour occurrence and development, oncogene expression, apoptosis inhibition and invasion and metastasis capacities. However, its function in the epithelial–mesenchymal transition (EMT) of pancreatic cancer is not fully understood.
Methods
By comparing various wild-type pancreatic cancer cell lines, we determined which have a higher expression level of HNRNPA2B1 accompanied by the higher expression of N-cadherin and vimentin and lower expression of E-cadherin. Therefore, to elucidate the role of HNRNPA2B1 in EMT, we generated models of HNRNPA2B1 knockdown and overexpression in different types of pancreatic cancer cell lines (MIA Paca-2, PANC-1 and Patu-8988) and examined changes in expression of EMT-related factors, including CDH1, CDH2, vimentin and snail.
Results
The results show that HNRNPA2B1 promotes EMT development by down-regulating E-cadherin and up-regulating N-cadherin and vimentin, and also stimulates the invasion capacity and inhibits viability in human pancreatic cancer cell lines, the similar results in vivo experiments. Moreover, we found that HNRNPA2B1 likely regulates EMT progression in pancreatic carcinoma via the ERK/snail signalling pathway.
Conclusions
The results of this work suggest that HNRNPA2B1 inhibition has potential antitumour effects, which warrants in-depth investigation.
Keywords: Epithelial–mesenchymal transition, HNRNPA2B1, ERK/snail, Pancreatic cancer
Background
Pancreatic carcinoma, which is nearly almost always fatal, is the fourth leading cause of cancer-related death worldwide, with fewer than 7% of patients surviving more than 5 years [1]. Chemotherapy (mainly based on gemcitabine and capecitabine) and radiation therapy remain the mainstay of treatment for pancreatic cancer, with poor efficacy in terms of extending patient survival [2, 3]. Additionally, although the curative effect is better, only 15% of patients who undergo surgery survive more than 5 years [4, 5]. In view of this dismal outcome, to enable treatment of this deadly disease with new druggable targets, there is an urgent need to thoroughly understand the molecular mechanisms of pancreatic cancer pathophysiology and development.
Recent studies have shown that heterogeneous nuclear ribonucleoproteins A2B1 (HNRNPA2B1), two structurally homologous proteins belonging to the hnRNP family, play important roles in normal development as well as in cancer processes in eukaryotic cells [6]. Indeed, elevated HNRNPA2B1 levels in tumours accelerate pre-mRNA processing via RNA binding, indicating the critical role of HNRNPA2B1 in the development of carcinoma. Recent work shows that the epithelial–mesenchymal transition (EMT), a process in which epithelial cells transform into cells with mesenchymal phenotypes, may be regulated by HNRNPA2B1. During EMT in tumour cells, up-regulation of vimentin and N-cadherin and down-regulation of E-cadherin (cell–cell adhesion molecules) promote cell invasion and metastasis in various cancers, including pancreatic cancer [7–10]. Other factors also directly or indirectly trigger EMT, including claudins, occludin, fibronectin, twist1, ZEB2 and snail [11–15]. Zhou et al. [16] indicated that HNRNPAB induces EMT and promotes metastasis of hepatocellular carcinoma by transcriptionally activating snail [16], and Barcelo et al. [17] showed that HNRNPA2B1 plays a key role in Kras-mutation associated pancreatic cancer [17]. Based on these findings, HNRNPA2B1 might play an important role in EMT during tumour development.
To date, however, no study has reported on the role of HNRNPA2B1 in EMT in pancreatic cancer. Thus, we aimed to determine the roles and potential application of HNRNPA2B1 in the EMT of pancreatic cancer by exploring the impact of HNRNPA2B1 knockdown and overexpression on EMT and the subsequent invasion and metastasis of pancreatic cancer cells. Furthermore, we here demonstrate the possibility that HNRNPA2B1 regulates and controls EMT in pancreatic cancer cells through the ERK/snail pathway. In conclusion, we conclude that HNRNPA2B1 plays a critical role in pancreatic carcinoma EMT.
Methods
Cell culture
The human pancreatic cancer cell lines used in this study include Patu-8988, MIA Paca-2 and PANC-1. The MIA Paca-2 and PANC-1 lines were obtained from the Institute of Biochemistry and Cell Biology, the Chinese Academy of Science (Shanghai, People’s Republic of China), and Patu-8988 cells were provided by Genechem (Shanghai, China). Patu-8988 cells were cultured in RPMI-1640 medium, and MIA Paca-2 and PANC-1 cells were cultured in DMEM. All media contained 10% foetal bovine serum, penicillin (100 U/mL), and streptomycin (100 μg/mL), and the cells were incubated at 37 °C with 5% CO2. Cell were harvested and passaged at approximately 80–100% confluence using phosphate-buffered saline (PBS) with 0.25% trypsin and 0.01% EDTA.
Reagents and antibodies
Antibodies against HNRNPA2B1, E-cadherin, vimentin, N-cadherin, MMP7, MMP9, ERK1/2 and phosphorylated proteins were purchased from Abcam (Cambridge, USA). An antibody against β-actin was purchased from Bio-world Technology (St Louis Park, MN, USA). An antibody against snail was purchased from Cell Signaling Technology (Danvers, USA). Foetal bovine serum (FBS) was purchased from Sigma Chemical (St Louis, MO, USA). Roswell Park Memorial Institute (RPMI)-1640 medium, Dulbecco’s Modified Eagle’s Medium (DMEM), and trypsin were purchased from GIBCO (Grand Island, NY, USA). ERK-inhibitor (GSK2656157) was purchased from MedChem Express (New Jersey, USA) and gemcitabine was purchased from Jkchem (Shanghai, China).
Knockdown and overexpression of HNRNPA2B1
A lentivirus plasmid containing a short hairpin RNA (shRNA) for HNRNPA2B1(KH)and its negative control (NKH) and a lentivirus plasmid containing HNRNPA2B1 driven by the CMV promoter (OH) and its negative control (NOH) were designed and produced by Genechem (Shanghai, China). For transfection, MIA Paca-2, PANC-1 and Patu-8988 cells were seeded in 6-well plates at 5 × 104 cells and allowed to attach until nearly 30–40% confluent. After removal of the culture medium, the plates were washed three times with PBS, and lentivirus and 50 μg/mL polybrene was added to each plat. After 12 h of transfection, the transfection medium was replaced with standard medium. Cells were harvested for passaging or testing when they occupied 80% of the plate. All procedures were performed using biohazard safety equipment.
Western blot analysis
Protein was extracted by adding RIPA buffer (Beyotime, Shanghai, China) with protease inhibitor (Beyotime, Shanghai, China) and phosphatase inhibitor (Roche Diagnostics GmbH, Mannheim, Germany). The final protein lysate was centrifuged, and the supernatant was collected. BCA (Beyotime, Shanghai, China) was used to measure the protein concentration. After denaturing, the protein mixture was separated using a 10% polyacrylamide gel; a prestained protein marker was included. The separated proteins were transferred to polyvinylidene difluoride (PVDF) membranes, which were blocked with 5% skim milk in Tris-buffered saline (10 mmol/L Tris–HCl, pH 8.0, containing 150 mmol/L NaCl and 0.1% Tween-20) for 2 h at room temperature before being incubated at 4 °C overnight with primary antibodies diluted in First Ab Dilute. The membranes were then incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Bio-world Technology, MN, USA) for 2 h at room temperature after washing with TBST. The densities of the protein bands were recorded and measured by AlphaEaseFC (STandalone).
RNA extraction and quantitative real-time PCR analysis
When the cells were approximately 90% confluent, total RNA was extracted using TRzol Reagent (Ambion, Carlsbad, California, USA) according to the manufacturer’s instructions. To obtain cDNA, reverse transcription was performed with RevertAid First Strand cDNA Synthesis Kit(Thermo, Manassas, USA). qRT-PCR was performed with SYBR Green Master (Biosystems, Foster City, CA, USA) using a 7500 Real-Time PCR System (Applied Biosystems, Foster City, USA). β-Actin was amplified as an internal standard, and ΔCt values were used for analysis of the quantitative real-time PCR data. Polymerase chain reaction (PCR) primers were purchased from Synbio Tech (Jiangsu, People’s Republic of China); the sequences are listed in Table 1.
Table 1.
The sequences of the primers used for quantitative real-time PCR
| Gene | Forward primer | Reverse primer |
|---|---|---|
| β-actin | GACATCCGCAAAGACCTG | GGAAGGTGGACAGCGAG |
| HNRNPA2B1 | ATGGCTGCAAGACCTCATTC | TAATTCCGCCAACAAACAGC |
| E-cadherin | GACCGAGAGAGTTTCCCTAC | GGTGGGATTGAAGATCGGAG |
| N-cadherin | GTGACCGATAAGGATCAACC | TTGACCACGGTGACTAACCC |
| Vimentin | GGATGTTGACAATGCGTCTC | CTCCTGGATTTCCTCTTCGT |
| Mmp7 | TGAGGATGAACGCTGGACG | CACTGCATTAGGATCAGAGGAA |
| Mmp9 | AGTCCACCCTTGTGCTCTTC | GCCACCCGAGTGTAACCAT |
| ERK | ATCCCCATCACAAGAAGA | GCTTTGGAGTCAGCATTT |
| Snail | CTTCTCCTCTACTTCAGTCTCTTCC | TGAGGTATTCCTTGTTGCAGTATTT |
Cell viability assay
The different cell models were plated into 96-well plates containing 1 mL 10% FBS medium at a density of 10,000 cells per well and incubated for 24 h. The cells were starved in FBS-free medium for 12 h when the cells in each well reached 70% confluence. The medium was discarded, and the cells were washed once with PBS before; 100 μL FBS-free medium containing 10 μL Cell Counting Kit 8 (CCK8; Dojindo, Kuma-moto, Japan) solution was added to each well and incubated for 1–2 h. Cell viability is expressed as the fold change in absorbance at 490 nm for each well, as measured using a microplate reader (BioTek, Winooski, VT, USA).
Cell invasion assay
Transwell Permeable Supports (Costar, Kennebunk, USA) with matrigel Basement Membrane Matrix (Corning, Franklin Lake, NJ, USA) bedding were used with an 8 μm porosity polyethylene terephthalate membrane. Cells (5 × 104) were starved overnight and added to the upper chamber in 200 μL FBS-free medium; 500 μL RPMI-1640 (for Patu-8988 cells) or DMEM (for PANC-1 and MIA Paca-2 cells) with 10% FBS was added to the lower compartment as a chemoattractant. The cells were incubated for 24 h, and the filters were washed three times with PBS, fixed with 4% paraformaldehyde for 30 min, stained with 4 g/L crystal violet for 15 min and washed twice with PBS. The cells on the upper surface of the filter were gently scraped off. The stained cells in randomly selected fields were observed and counted using a 200× inverted microscope.
Cell cycle analysis
The cell cycle analysis was measured using the Propidium iodide Kit for Flow Cytometry (Multiscience, Hangzhou, Zhejiang, China), according to the manufacturer’s instructions. After the treatments, cell cycle analysis was measured using a Thermo Attune and analyzed using the ModFit LT2.0 software (Coulter, Miami, FL).
Establishment of the xenografted tumor model in nude mice
Athymic nude mice (BALB/C-nu/nu, 6–8 weeks old, female) were gained from the Animal Center of Chinese Academy of Science (Shanghai, China) and fed under specific pathogen-free conditions in the laboratory animal center of Wenzhou Medical University (Wenzhou, Zhejiang, China). We established a pancreatic xenografted tumor model through subcutaneous injection of 1 × 107 pancreatic cancer cells per mouse. After the treatments, we observe the growth rate of tumor volume and the change of weight on each mice. All researches involving animals were approved by the Animal Ethics Committee of Wenzhou Medical University.
Statistical analysis
Data are expressed as the mean ± standard error of the mean (SEM) for at least three independent experiments. Analysis of variance was utilised to distinguish differences in each group. A value of P < 0.05 was considered to be statistically significant. All analyses were performed using SPSS 16.0 software (IBM, USA).
Results
HNRNPA2B1 expression was associated with the mesenchymal phenotype in pancreatic cancer cell lines
We first explored the relationship between HNRNPA2B1 and EMT in wild-type human pancreatic cancer cell lines (Patu-8988, MIA Paca-2 and PANC-1) by qRT-PCR and Western blotting and we found highest N-cadherin and HNRNPA2B1 expression and lowest E-cadherin in the Patu-8988 cell line compared to the Panc-1 and MIA Paca-2 cell line. The expression levels of HNRNPA2B1 in the different cells was directly correlated to the levels of N-cadherin and vimentin and inversely correlated to the levels of E-cadherin (P < 0.05; Fig. 1a, b).
Fig. 1.

HNRNPA2B1 improves cell viability, and its expression was associated with EMT markers in pancreatic cancer cell lines. The mRNA expression levels of HNRNPA2B1 and EMT representative markers (E-cadherin and N-cadherin) in Panc-1 and Patu-8988 pancreatic cancer cells are presented as a histogram (a); HNRNPA2B1, E-cadherin, N-cadherin and vimentin were visualised by Western blotting (b); data represent the mean ± SEM, n = 3, *denotes P < 0.05 vs Patu-8988 groups. Fold change in cell viability of Patu-8988, PANC-1 and MIA Paca-2 cells (c); data represent the mean ± SEM, n = 3, *denotes P < 0.05 vs NC groups, **denotes P < 0.05 vs Patu-8988 cells, ***denotes P < 0.05 vs Panc-1 cells, #means P > 0.05 vs NC groups
HNRNPA2B1 regulated cell viability and EMT in pancreatic cancer cell lines
We then generated cell models of HNRNPA2B1 knockdown and overexpression and examined accompanying changes in cell viability. All cell lines were treated with trypsinisation, and the cells in suspension were assayed using CCK8 after 24 h of incubation. Non-transfected pancreatic carcinoma cell lines were used as controls. The notable linearity of the graph revealed the lowest viability for the HNRNPA2B1 knockdown cells. Moreover, the non-transfected cells and the HNRNPA2B1 lentivirus negative control cells showed viability between the knockdown and overexpressing cells, with no statistical significance between them (P > 0.05; Fig. 1c). The level of HNRNPA2B1 expression was correlated with cell viability. To investigate if the cell cycle analysis is conforming to the consequence of CCK8 in the pancreatic cancer cell lines with HNRNPA2B1 knockdown or overexpression were generated by lentiviral gene delivery system. We were able to detect the G0G1 cell cycle arrest of Patu-8988-KH, Panc-1-KH and MIA Paca-2-KH cells and the S-Phase cell cycle increased of Patu-8988-OH, Panc-1-OH and MIA Paca-2-OH cells, but no significance difference was found in the G2M cell cycle of those cells (Fig. 2). So we concluded that HNRNPA2B1 could promote the proliferation of pancreatic cancer cells.
Fig. 2.

HNRNPA2B1 changes cell cycle in pancreatic cancer cell lines. The cell cycle of normal pancreatic cancer cell lines (Patu-8988, MIA Paca-2 and PANC-1) and its treated cells were visualised by flow cytometry (a). And a histogram of the proportion for cell cycle were drew in b. Data represent the mean ± SEM, n = 3, *denotes P < 0.05 vs NC groups, #denotes P > 0.05 vs NC groups
We then sought insight into the relationship between HNRNPA2B1 and EMT. In addition to HNRNPA2B1, we also analysed EMT markers (E-cadherin, N-cadherin and vimentin). Western blotting assays showed that the protein levels of HNRNPA2B1 were decreased to 66% in Patu-8988, 52% in MIA Paca-2 and 50% in PANC-1 cells with knockdown but were increased to 1000% in Patu-8988, 246% in MIA Paca-2 and 160% in PANC-1 with overexpression. A similar pattern was observed by qRT-PCR (Fig. 3a). When HNRNPA2B1 was knocked down, the messenger RNA (mRNA) and protein levels of CDH1 (E-cadherin) increased, whereas these levels were decreased when HNRNPA2B1 was overexpressed (Fig. 3b). As expected, N-cadherin (Fig. 3c) and vimentin (Fig. 3d) showed trends opposite to that of E-cadherin. Furthermore, we confirmed that lower HNRNPA2B1 expression corresponded with higher E-cadherin expression and lower N-cadherin and vimentin expression in pancreatic cancer cells.
Fig. 3.

HNRNPA2B1 increases EMT in pancreatic cancer cell lines. HNRNPA2B1 (a), E-cadherin (b), N-cadherin (c) and vimentin (d) were visualised by qRT-PCR and Western blotting (histograms of mRNA expression on pictures of protein levels). β-Actin was used as an internal control. Data represent the mean ± SEM, n = 3, *denotes P < 0.05 vs NC groups, #denotes P > 0.05 vs NC groups
What’s more, we treated Patu-8988 cells with gemcitabine in 40, 80 and 160 µmol/L tentatively, and found the inhibiting effect of 160 μmol/L group is the strongest (Fig. 7a). Then, we respectively treated Patu-8988-OH, Panc-1-OH and MIA Paca-2-OH cells with gemcitabine in 160 μmol/L and discovered gemcitabine could inhibite EMT similar to HNRNPA2B1 (Fig. 7b, e). In conclusion, HNRNPA2B1 could regulated cell viability, EMT and the pharmacal sensitivity.
Fig. 7.

ERK inhibitor and gemcitabine inhibite HNRNPA2B1 and EMT in pancreatic cancer cell lines. The expression of HNRNPA2B1 in Patu-8988 cells treated with gemcitabine in 40, 80 and 160 μmol/L were visualised by Western blotting (a). The expression of HNRNPA2B1, E-cadherin, N-cadherin, Vimentin, ERK1/2, p-ERK1/2 and snail in Patu-8988-OH, Panc-1-OH and MIA Paca-2-OH cells treated with gemcitabine in 160 μmol/L were visualised by qRT-PCR (e) and Western blotting (b). The expression of HNRNPA2B1, E-cadherin, N-cadherin, Vimentin, ERK1/2, p-ERK1/2 and snail in Patu-8988-OH, Panc-1-OH and MIA Paca-2-OH cells treated with ERK inhibitor were visualised by qRT-PCR (c, d) and Western blotting (f). β-Actin was used as an internal control. Data represent the mean ± SEM, n = 3, *denotes P < 0.05 vs control groups
HNRNPA2B1 promoted invasion in pancreatic carcinoma cell lines
Because of the biological phenotype resulting from EMT, we evaluated the capacity of cells to invade to confirm whether HNRNPA2B1 is directly or indirectly associated with EMT. As shown by Fig. 4c and d, transwell invasion assays indicated a decrease in the invasion rate of KH cells but an increase in the invasion rate of OH cell. According to the results, HNRNPA2B1 could stimulate cell invasion after accelerating the development of EMT.
Fig. 4.

HNRNPA2B1 enhances cell invasion and expression of MMPs in pancreatic cancer cell lines. Mmp7 (a) and Mmp9 (b) were visualised by qRT-PCR and Western blotting (histograms of mRNA expression on pictures of protein levels). β-Actin was used as an internal control. The cell invasion ability c was evaluated in normal cells, cells transfected with a negative lentivirus control and cells transfected with a lentivirus. Cells were counted in 3 randomised 200× fields for invasion (d). Data represent the mean ± SEM, n = 3, *denotes P < 0.05 vs NC groups, #denotes P > 0.05 vs NC groups
We also tested expression of MMPs under different conditions because MMPs enhance cell invasion by degrading the extracellular matrix. qRT-PCR and Western blotting showed significant decreases in the cellular levels of Mmp7 (Fig. 4a) and Mmp9 (Fig. 4b) after HNRNPA2B1 knockdown and increases after HNRNPA2B1 overexpression. These results are consistent with the invasion results.
Furthermore, we established xenografted tumor in nude mouse via subcutaneous injection of 1 × 107 PANC-1, PANC-1-KH and PANC-1-OH cells per mouse severally. As shown by Fig. 5a–c, we observed that the largest tumor volume and the thinnest in the PANC-1-OH-mice but an antipodal phenomenon in the PANC-1-KH-mice. Also, we found the tumor inhibitory rate of the PANC-1-KH group is the highest by using the PANC-1-OH group as a reference substance due to its highest expression of HNRNPA2B1 (Fig. 5d). These data are consistent with that HNRNPA2B1 could stimulate the growth and invasion in pancreatic cancer.
Fig. 5.

HNRNPA2B1 promotes the growth rate of xenografted tumor and decreases the weight in vivo. 1 × 107 Panc-1, Panc-1-OH and Panc-1-KH cells were injected in subcutaneous tissues per athymic nude mouse. Mouse were put in the blue drape for photograph on day 0, day 10 and day 25 severally (a). The body weight (b) and tumor volume (c) of each mouse was measured and visualized as line graphs. Tumor inhibitory rate was calculated by using the Panc-1-OH group as a reference substance (d). Data represent the mean ± SEM, n = 3, *denotes P < 0.05 vs NC groups, **denotes P < 0.05 vs Panc-1-OH group
HNRNPA2B1 regulated EMT progression via the ERK/snail pathway in pancreatic cancer cell lines
Splicing factor hnRNP A2 has been shown to activate the RAS-MAPK-ERK pathway by integrating A-RAF splicing signalling [18]. In addition, ERK activation markedly up-regulates expression of snail, one of the main transcription factors influencing EMT [19–25]. When HNRNPA2B1 was knocked down, snail expression was decreased according to both qRT-PCR and Western blotting (Fig. 6c), and that p-ERK1/2 expression was decreased according to Western blotting (Fig. 6b). In contrast, nonphosphorylated ERK1/2 remained at a higher level (Fig. 6a). The results obtained when HNRNPA2B1 was overexpressed were opposite to the results obtained when HNRNPA2B1 was knocked down. And then we respectively treated Patu-8988-OH, Panc-1-OH and MIA Paca-2-OH cells with ERK inhibitor, we observed that EMT was inhibited in the treated groups comparing with control groups (Fig. 7c, d, f). Therefore, we tentatively conclude that HNRNPA2B1 regulates EMT progression via the ERK/snail pathway in pancreatic cancer cell lines.
Fig. 6.

HNRNPA2B1promotes EMT via ERK/snail signalling in pancreatic cancer cell lines. Nonphosphorylated ERK1/2 (a), phospho-ERK1/2 (b) and snail (c) were visualised by qRT-PCR and Western blotting (histograms of mRNA expression on pictures of protein levels). β-Actin was used as an internal control. Data represent the mean ± SEM, n = 3, *denotes P < 0.05 vs NC groups, #denotes P > 0.05 vs NC groups
Discussion
Pancreatic cancer, which currently has the worst prognosis, is the most common malignant tumour of the digestive system and among the top ten malignant tumours in our country [26]. Although surgery is the only radical treatment presently available, the curative rate of pancreatic cancer remains very low because surgery is often no longer an option at the time of diagnosis [27]. Accordingly, biotherapy treatments have become more popular over the past few years. Encouraging results have been reported by recent studies showing that pancreatic carcinoma could be inhibited by controlling several biomarkers such as SMAD4, CXCR2, ABCG2 and Kras [28–34]. In addition, Barcelo et al. showed that HNRNPA2B1 interacts with and regulates oncogenic Kras in pancreatic ductal adenocarcinoma cells, and Tauler et al. indicated that HNRNPA2B1 modulates EMT in lung cancer cell lines [17, 35]. However, a clear relationship between HNRNPA2B1 and EMT in pancreatic cancer and the signalling pathway involved remain elusive.
We previously discovered that the level of HNRNPA2B1 expression is higher in pancreatic cancer than in non-lesion tissue, as are other cancers, such as lung cancer [36], hepatocellular carcinoma [16] and glioblastoma [37]. Based on our study, we chose several pancreatic carcinoma cell lines to simulate different types of pancreatic cancers and generated models of HNRNPA2B1 depletion and overexpression using Crispr/Cas9 genetic technology. Unsurprisingly, conforming to the manifestation of an oncogene, both the mRNA and protein levels of HNRNPA2B1 were closely related with EMT, which plays an important role in the invasion and metastasis of cancer cells [38, 39]. Moreover, we found that the ERK/snail signalling pathway, regulated by HNRNPA2B1, plays a crucial role in pancreatic carcinoma.
EMT has a vital function in the process of phenotypic conversion [15, 40–42]. Accumulating experimental evidence suggests that many pancreatic cancer cell lines express higher levels of mesenchymal biomarkers, such as vimentin and N-cadherin, and lower levels of epithelial biomarkers, such as E-cadherin, than normal pancreatic cell lines. In our study, we found that the cell lines expressing higher levels of HNRNPA2B1 had enhanced invasive and migration capacities as well as lower expression of E-cadherin and higher expression of vimentin and N-cadherin than the others cells. Moreover, we detected levels of MMP7 and MMP9 expression and found that HNRNPA2B1 promoted expression of these MMPs, with a correlated change in of MMP expressions and EMT development. In addition, transwell invasiveness assays showed a greater number of cells passing through the membrane when MMP levels were higher due to extracellular matrix degradation. What’s more, vivo study showed that the cells with higher expression of HNRNPA2B1 could induce bigger xenografted tumor in mice. Therefore, we speculate that HNRNPA2B1 may be a potent inducer of EMT in pancreatic carcinoma. Meanwhile, snail, an important transcription factor up-regulation in EMT, is noteworthy because snail triggers EMT by coordinating the induction of mesenchymal biomarkers and the repression of epithelial biomarkers, which could induce EMT and promote metastasis of hepatocellular carcinoma. We found that the expression level of snail mRNA and protein consistently increased when HNRNPA2B1 was overexpressed. However, the concrete mechanism by which this occurs in pancreatic cancer requires further investigation.
As one of the most important intracellular pathways, RAS/RAF/MEK/ERK signalling causes multiple changes in the expression of various genes, transmitting signals from receptors to regulate gene expression and prevent apoptosis [43–46]. Recent studies have shown that activation of the ERK pathway, not only by growth factors but also by mutations occurring in cancer cells in the genes encoding RAS or RAF, contributes to EMT. RAS and RAF signalling also activate expression of snail1 and/or snail2, therefore promoting cell motility and invasive behaviour in cancer-associated EMT [13]. Moreover, Hsu et al. showed that snail promotes cell motility and invasive behaviour in cancer-associated EMT by activating the ERK signalling [22], HNRNPA2B1, a member of a heterogeneous group of nuclear ribonucleoproteins, has been shown to contribute to ERK activation by controlling A-RAF splicing [18]. We explored the relationship between snail and the ERK pathway and found that the expression level of snail was notably decreased with attenuation of ERK phosphorylation caused by HNRNPA2B1 knockdown. Futher more, when we inhibited the activation of ERK1/2, both of HNRNPA2B1 and EMT were decreased. Therefore, we tentatively conclude that HNRNPA2B1 promotes EMT by activating the ERK/snail pathway in pancreatic cancer, revealing a potential connection between HNRNPA2B1 and EMT. Nonetheless, the mechanism of specific subunit by which HNRNPA2B1 affects the intracellular RAS/RAF/MEK/ERK cascade is still unknown, and the mechanism by which HNRNPA2B1 transfers a signal to various pathways and which subunits are involved requires further investigation.
Conclusion
In summary, our study shows that via ERK/snail pathway, HNRNPA2B1 might increase invasion ability by activating EMT phenotypes in pancreatic cancer. Our results not only provide a basis for establishing HNRNPA2B1-targeted molecular therapy in pancreatic cancer but also enrich the current understanding of HNRNPA2B1’s regulation of EMT and its potential signalling pathway.
Authors’ contributions
DSJ carried out the molecular genetic studies, participated in the Western blot analysis and drafted the manuscript. ZJ, LB and HXC carried out the cell viability assay and cell invasion assay. HSH and YTT participated in the design of the study and performed the statistical analysis. FBB performed the study in vivo experiment. ZMT and CBC conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.
Acknowledgements
This study is supported by the technology innovation team of diagnosis and treatment of abdominal surgery of Wenzhou, Zhejiang Province, China (C20150003).
Competing interests
The authors declare that they have no competing interests.
Availability of data and materials
The datasets analysed during the current study available from the corresponding author on reasonable request.
Funding
The technology innovation team of diagnosis and treatment of abdominal surgery of Wenzhou, Zhejiang Province, China (C20150003).
Abbreviations
- EMT
epithelial–mesenchymal transition
- NC
normal control
- KH
cells transfected with HNRNPA2B1 shRNA lentivirus
- NKH
cells transfected with HNRNPA2B1 knockdown negative control lentivirus
- OH
cells transfected with HNRNPA2B1 overexpression lentivirus
- NOH
cells transfected with HNRNPA2B1 overexpression negative control lentivirus
- SEM
standard error of the mean
- MMPs
matrix metalloproteinases
Footnotes
Mengtao Zhou, Bicheng Chen and Shengjie Dai contributed equally to this work
Contributor Information
Shengjie Dai, Email: 249289592@qq.com.
Jie Zhang, Email: 895325300@qq.com.
Shihao Huang, Email: 243815050@qq.com.
Bin Lou, Email: 398959490@qq.com.
Binbo Fang, Email: 649482454@qq.com.
Tingting Ye, Email: 410041466@qq.com.
Xince Huang, Email: huang-xin-ce@163.com.
Bicheng Chen, Phone: 86-577-55579220, Email: chenbicheng@hotmail.com.
Mengtao Zhou, Phone: 86-577-55579220, Email: zmt0417@hotmail.com.
References
- 1.Siegel RL, Miller KD, Jemal A. Cancer statistics, 2015. CA Cancer J Clin. 2015;65(1):5–29. doi: 10.3322/caac.21254. [DOI] [PubMed] [Google Scholar]
- 2.Diener MK, Combs SE, Büchler MW. Chemoradiotherapy for locally advanced pancreatic cancer. Lancet Oncol. 2013;14(4):269–270. doi: 10.1016/S1470-2045(13)70091-3. [DOI] [PubMed] [Google Scholar]
- 3.Ko AH. Progress in the treatment of metastatic pancreatic cancer and the search for next opportunities. J Clin Oncol. 2015;33(16):1779–1786. doi: 10.1200/JCO.2014.59.7625. [DOI] [PubMed] [Google Scholar]
- 4.Hartwig W, Werner J, Jäger D, Debus J, Büchler MW. Improvement of surgical results for pancreatic cancer. Lancet Oncol. 2013;14(11):e476–e485. doi: 10.1016/S1470-2045(13)70172-4. [DOI] [PubMed] [Google Scholar]
- 5.Ferrone CR, Brennan MF, Gonen M, Coit DG, Fong Y, Chung S, Tang L, Klimstra D, Allen PJ. Pancreatic adenocarcinoma: the actual 5-year survivors. J Gastrointest Surg. 2008;12(4):701–706. doi: 10.1007/s11605-007-0384-8. [DOI] [PubMed] [Google Scholar]
- 6.Dreyfuss G, Matunis MJ, Pinol-Roma S, Burd CG. hnRNP proteins and the biogenesis of mRNA. Annu Rev Biochem. 1993;62:289–321. doi: 10.1146/annurev.bi.62.070193.001445. [DOI] [PubMed] [Google Scholar]
- 7.Chaffer CL, Marjanovic ND, Lee T, Bell G, Kleer CG, Reinhardt F, D’Alessio AC, Young RA, Weinberg RA. Poised chromatin at the ZEB1 promoter enables breast cancer cell plasticity and enhances tumorigenicity. Cell. 2013;154(1):61–74. doi: 10.1016/j.cell.2013.06.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Gos M, Miloszewska J, Przybyszewska M. Epithelial–mesenchymal transition in cancer progression. Postepy Biochem. 2009;55(2):121–128. [PubMed] [Google Scholar]
- 9.Huang RY, Guilford P, Thiery JP. Early events in cell adhesion and polarity during epithelial–mesenchymal transition. J Cell Sci. 2012;125(Pt 19):4417–4422. doi: 10.1242/jcs.099697. [DOI] [PubMed] [Google Scholar]
- 10.Rhim AD, Mirek ET, Aiello NM, Maitra A, Bailey JM, McAllister F, Reichert M, Beatty GL, Rustgi AK, Vonderheide RH, et al. EMT and dissemination precede pancreatic tumor formation. Cell. 2012;148(1–2):349–361. doi: 10.1016/j.cell.2011.11.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Andreolas C, Kalogeropoulou M, Voulgari A, Pintzas A. Fra-1 regulates vimentin during Ha-RAS-induced epithelial mesenchymal transition in human colon carcinoma cells. Int J Cancer. 2008;122(8):1745–1756. doi: 10.1002/ijc.23309. [DOI] [PubMed] [Google Scholar]
- 12.Briegel KJ. Embryonic transcription factors in human breast cancer. IUBMB Life. 2006;58(3):123–132. doi: 10.1080/15216540600686870. [DOI] [PubMed] [Google Scholar]
- 13.Lamouille S, Xu J, Derynck R. Molecular mechanisms of epithelial–mesenchymal transition. Nat Rev Mol Cell Biol. 2014;15(3):178–196. doi: 10.1038/nrm3758. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Puisieux A, Brabletz T, Caramel J. Oncogenic roles of EMT-inducing transcription factors. Nat Cell Biol. 2014;16(6):488–494. doi: 10.1038/ncb2976. [DOI] [PubMed] [Google Scholar]
- 15.Shaul YD, Freinkman E, Comb WC, Cantor JR, Tam WL, Thiru P, Kim D, Kanarek N, Pacold ME, Chen WW, et al. Dihydropyrimidine accumulation is required for the epithelial–mesenchymal transition. Cell. 2014;158(5):1094–1109. doi: 10.1016/j.cell.2014.07.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Zhou ZJ, Dai Z, Zhou SL, Hu ZQ, Chen Q, Zhao YM, Shi YH, Gao Q, Wu WZ, Qiu SJ, et al. HNRNPAB induces epithelial–mesenchymal transition and promotes metastasis of hepatocellular carcinoma by transcriptionally activating SNAIL. Cancer Res. 2014;74(10):2750–2762. doi: 10.1158/0008-5472.CAN-13-2509. [DOI] [PubMed] [Google Scholar]
- 17.Barcelo C, Etchin J, Mansour MR, Sanda T, Ginesta MM, Sanchez-Arevalo Lobo VJ, Real FX, Capella G, Estanyol JM, Jaumot M, et al. Ribonucleoprotein HNRNPA2B1 interacts with and regulates oncogenic KRAS in pancreatic ductal adenocarcinoma cells. Gastroenterology. 2014;147(4):882–892. doi: 10.1053/j.gastro.2014.06.041. [DOI] [PubMed] [Google Scholar]
- 18.Shilo A, Ben Hur V, Denichenko P, Stein I, Pikarsky E, Rauch J, Kolch W, Zender L, Karni R. Splicing factor hnRNP A2 activates the Ras-MAPK-ERK pathway by controlling A-Raf splicing in hepatocellular carcinoma development. RNA. 2014;20(4):505–515. doi: 10.1261/rna.042259.113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Barbera MJ, Puig I, Dominguez D, Julien-Grille S, Guaita-Esteruelas S, Peiro S, Baulida J, Franci C, Dedhar S, Larue L, et al. Regulation of snail transcription during epithelial to mesenchymal transition of tumor cells. Oncogene. 2004;23(44):7345–7354. doi: 10.1038/sj.onc.1207990. [DOI] [PubMed] [Google Scholar]
- 20.Batlle E, Sancho E, Franci C, Dominguez D, Monfar M, Baulida J, De Herreros AG. The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat Cell Biol. 2000;2(2):84–89. doi: 10.1038/35000034. [DOI] [PubMed] [Google Scholar]
- 21.Eger A, Aigner K, Sonderegger S, Dampier B, Oehler S, Schreiber M, Berx G, Cano A, Beug H, Foisner R. DeltaEF1 is a transcriptional repressor of E-cadherin and regulates epithelial plasticity in breast cancer cells. Oncogene. 2005;24(14):2375–2385. doi: 10.1038/sj.onc.1208429. [DOI] [PubMed] [Google Scholar]
- 22.Hsu YL, Hou MF, Kuo PL, Huang YF, Tsai EM. Breast tumor-associated osteoblast-derived CXCL5 increases cancer progression by ERK/MSK1/Elk-1/snail signaling pathway. Oncogene. 2013;32(37):4436–4447. doi: 10.1038/onc.2012.444. [DOI] [PubMed] [Google Scholar]
- 23.Kong C, Wang C, Wang L, Ma M, Niu C, Sun X, Du J, Dong Z, Zhu S, Lu J, et al. NEDD9 is a positive regulator of epithelial–mesenchymal transition and promotes invasion in aggressive breast cancer. PLoS ONE. 2011;6(7):e22666. doi: 10.1371/journal.pone.0022666. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Makrodouli E, Oikonomou E, Koc M, Andera L, Sasazuki T, Shirasawa S, Pintzas A. BRAF and RAS oncogenes regulate Rho GTPase pathways to mediate migration and invasion properties in human colon cancer cells: a comparative study. Mol Cancer. 2011;10:118. doi: 10.1186/1476-4598-10-118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Yang J, Mani SA, Donaher JL, Ramaswamy S, Itzykson RA, Come C, Savagner P, Gitelman I, Richardson A, Weinberg RA. Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell. 2004;117(7):927–939. doi: 10.1016/j.cell.2004.06.006. [DOI] [PubMed] [Google Scholar]
- 26.Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, Jemal A, Yu XQ, He J. Cancer statistics in China, 2015. CA Cancer J Clin. 2016;66(2):115–132. doi: 10.3322/caac.21338. [DOI] [PubMed] [Google Scholar]
- 27.Lim JE, Chien MW, Earle CC. Prognostic factors following curative resection for pancreatic adenocarcinoma: a population-based, linked database analysis of 396 patients. Ann Surg. 2003;237(1):74–85. doi: 10.1097/00000658-200301000-00011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Wang J, Xin B, Wang H, He X, Wei W, Zhang T, Shen X. Gastrin regulates ABCG2 to promote the migration, invasion and side populations in pancreatic cancer cells via activation of NF-kappaB signaling. Exp Cell Res. 2016;346(1):74–84. doi: 10.1016/j.yexcr.2016.06.001. [DOI] [PubMed] [Google Scholar]
- 29.He X, Wang J, Wei W, Shi M, Xin B, Zhang T, Shen X. Hypoxia regulates ABCG2 activity through the activivation of ERK1/2/HIF-1alpha and contributes to chemoresistance in pancreatic cancer cells. Cancer Biol Ther. 2016;17(2):188–198. doi: 10.1080/15384047.2016.1139228. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Roberts JK, Birg AV, Lin T, Daryani VM, Panetta JC, Broniscer A, Robinson GW, Gajjar AJ, Stewart CF. Population pharmacokinetics of oral topotecan in infants and very young children with brain tumors demonstrates a role of ABCG2 rs4148157 on the absorption rate constant. Drug Metab Dispos. 2016;44(7):1116–1122. doi: 10.1124/dmd.115.068676. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Kraege S, Stefan K, Juvale K, Ross T, Willmes T, Wiese M. The combination of quinazoline and chalcone moieties leads to novel potent heterodimeric modulators of breast cancer resistance protein (BCRP/ABCG2) Eur J Med Chem. 2016;117:212–229. doi: 10.1016/j.ejmech.2016.03.067. [DOI] [PubMed] [Google Scholar]
- 32.Chen H, Tu H, Meng ZQ, Chen Z, Wang P, Liu LM. K-ras mutational status predicts poor prognosis in unresectable pancreatic cancer. Eur J Surg Oncol. 2010;36(7):657–662. doi: 10.1016/j.ejso.2010.05.014. [DOI] [PubMed] [Google Scholar]
- 33.Blackford A, Serrano OK, Wolfgang CL, Parmigiani G, Jones S, Zhang X, Parsons DW, Lin JC, Leary RJ, Eshleman JR, et al. SMAD4 gene mutations are associated with poor prognosis in pancreatic cancer. Clin Cancer Res. 2009;15(14):4674–4679. doi: 10.1158/1078-0432.CCR-09-0227. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Steele CW, Karim SA, Leach JD, Bailey P, Upstill-Goddard R, Rishi L, Foth M, Bryson S, McDaid K, Wilson Z, et al. CXCR2 inhibition profoundly suppresses metastases and augments immunotherapy in pancreatic ductal adenocarcinoma. Cancer Cell. 2016;29(6):832–845. doi: 10.1016/j.ccell.2016.04.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Tauler J, Zudaire E, Liu H, Shih J, Mulshine JL. hnRNP A2/B1 modulates epithelial–mesenchymal transition in lung cancer cell lines. Cancer Res. 2010;70(18):7137–7147. doi: 10.1158/0008-5472.CAN-10-0860. [DOI] [PubMed] [Google Scholar]
- 36.Dowling P, Pollard D, Larkin A, Henry M, Meleady P, Gately K, O’Byrne K, Barr MP, Lynch V, Ballot J, et al. Abnormal levels of heterogeneous nuclear ribonucleoprotein A2B1 (hnRNPA2B1) in tumour tissue and blood samples from patients diagnosed with lung cancer. Mol BioSyst. 2015;11(3):743–752. doi: 10.1039/C4MB00384E. [DOI] [PubMed] [Google Scholar]
- 37.Deng J, Chen S, Wang F, Zhao H, Xie Z, Xu Z, Zhang Q, Liang P, Zhai X, Cheng Y. Effects of hnRNP A2/B1 knockdown on inhibition of glioblastoma cell invasion growth and survival. Mol Neurobiol. 2016;53(2):1132–1144. doi: 10.1007/s12035-014-9080-3. [DOI] [PubMed] [Google Scholar]
- 38.Yilmaz M, Christofori G. EMT, the cytoskeleton, and cancer cell invasion. Cancer Metastasis Rev. 2009;28(1–2):15–33. doi: 10.1007/s10555-008-9169-0. [DOI] [PubMed] [Google Scholar]
- 39.Polyak K, Weinberg RA. Transitions between epithelial and mesenchymal states: acquisition of malignant and stem cell traits. Nat Rev Cancer. 2009;9(4):265–273. doi: 10.1038/nrc2620. [DOI] [PubMed] [Google Scholar]
- 40.Sleeman JP, Thiery JP. SnapShot: the epithelial–mesenchymal transition. Cell. 2011;145(1):162.e161. doi: 10.1016/j.cell.2011.03.029. [DOI] [PubMed] [Google Scholar]
- 41.Radisky DC, LaBarge MA. Epithelial–mesenchymal transition and the stem cell phenotype. Cell Stem Cell. 2008;2(6):511–512. doi: 10.1016/j.stem.2008.05.007. [DOI] [PubMed] [Google Scholar]
- 42.Wicki A, Lehembre F, Wick N, Hantusch B, Kerjaschki D, Christofori G. Tumor invasion in the absence of epithelial–mesenchymal transition: podoplanin-mediated remodeling of the actin cytoskeleton. Cancer Cell. 2006;9(4):261–272. doi: 10.1016/j.ccr.2006.03.010. [DOI] [PubMed] [Google Scholar]
- 43.Steelman LS, Franklin RA, Abrams SL, Chappell W, Kempf CR, Basecke J, Stivala F, Donia M, Fagone P, Nicoletti F, et al. Roles of the Ras/Raf/MEK/ERK pathway in leukemia therapy. Leukemia. 2011;25(7):1080–1094. doi: 10.1038/leu.2011.66. [DOI] [PubMed] [Google Scholar]
- 44.Steelman LS, Abrams SL, Whelan J, Bertrand FE, Ludwig DE, Basecke J, Libra M, Stivala F, Milella M, Tafuri A, et al. Contributions of the Raf/MEK/ERK, PI3K/PTEN/Akt/mTOR and Jak/STAT pathways to leukemia. Leukemia. 2008;22(4):686–707. doi: 10.1038/leu.2008.26. [DOI] [PubMed] [Google Scholar]
- 45.Steelman LS, Pohnert SC, Shelton JG, Franklin RA, Bertrand FE, McCubrey JA. JAK/STAT, Raf/MEK/ERK, PI3K/Akt and BCR-ABL in cell cycle progression and leukemogenesis. Leukemia. 2004;18(2):189–218. doi: 10.1038/sj.leu.2403241. [DOI] [PubMed] [Google Scholar]
- 46.Lee JT, Jr, McCubrey JA. The Raf/MEK/ERK signal transduction cascade as a target for chemotherapeutic intervention in leukemia. Leukemia. 2002;16(4):486–507. doi: 10.1038/sj.leu.2402460. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The datasets analysed during the current study available from the corresponding author on reasonable request.
