Abstract
Premise of the study:
Microsatellite primers were developed to characterize and evaluate patterns of genetic diversity and structure in the endangered Mediterranean shrub Ziziphus lotus (Rhamnaceae).
Methods and Results:
Twenty microsatellite primers were developed for Z. lotus, of which 14 were polymorphic. We evaluated microsatellite polymorphism in 97 specimens from 18 Spanish and seven Moroccan populations. Between two and eight alleles were found per locus, and the average number of alleles was 5.54. Observed heterozygosity and expected heterozygosity ranged from 0.08 to 0.90 and from 0.08 to 0.82, respectively. Nine of these primers also amplified microsatellite loci in Z. jujuba.
Conclusions:
The microsatellite markers described here will be useful in studies on genetic variation, population genetic structure, and gene flow in the fragmented habitat of this species. These markers are a valuable resource for designing appropriate conservation measures for the species in the Mediterranean range.
Keywords: habitat fragmentation, keystone species, microsatellites, Rhamnaceae, southeastern Spain, Ziziphus lotus
Ziziphus Mill. (Rhamnaceae) is a pantropical and paraphyletic genus comprising approximately 170 species, 150 of them native to tropical and subtropical regions of Europe, the Middle East, Africa, India, and Asia (Islam and Simmons, 2006). The genus includes two economically important tree species, Z. jujuba Mill. (Chinese jujube) and Z. mauritiana Lam. (Indian jujube), that are cultivated for their fruit (Huang et al., 2015). Ziziphus lotus (L.) Lam. is a diploid (2n = 20; Pérez-Latorre and Cabezudo, 2009), hermaphrodite, sclerophyllous thorny shrub species occurring across the Mediterranean Basin, North Africa and the Sahara, and the Arabian Peninsula. In Europe, Z. lotus is restricted to some semiarid localities in the southeast of the Iberian Peninsula (Pérez-Latorre and Cabezudo, 2009) and the island of Sicily. Ziziphus lotus blooms from May to July, and flowers are pollinated primarily by bees. The fruit ripening period occurs in September, and fruits (drupes) are dispersed by foxes and other mammals. It is a keystone species in those semiarid ecosystems (Tirado, 2009). Since 1992, Z. lotus habitats have been included in the Habitats Directive of the European Commission (Council Directive 92/43/EEC 1992, namely Arborescent “matorral” with Ziziphus: habitat 5220; Council of the European Union, 2007), which lists Europe’s most endangered and vulnerable habitats. Population size ranges from 10 to thousands (typically less than 100) of individuals depending on the alteration status. In fact, European Z. lotus populations are seriously threatened by severe habitat destruction and fragmentation due to agriculture intensification and land-use change (Mota et al., 1996; Tirado, 2009; Mendoza-Fernández et al., 2015).
Microsatellite (simple sequence repeat [SSR]) markers have been recently developed for Z. jujuba (Huang et al., 2015); however, transferability of jujube SSR primers to Z. lotus has not been shown. Here, we characterized 20 microsatellite markers (14 polymorphic) developed specifically for Z. lotus, which will be subsequently used to evaluate the impact of land-use change and fragmentation on the genetic diversity of the species. We also amplified polymorphic markers in 10 North African individuals of Z. lotus (from Morocco) to assess genetic variation, diversity levels, and population genetic structure across the region for conservation purposes. Finally, cross-amplification was tested in Z. jujuba samples, the other Ziziphus species with a presence in the Iberian Peninsula.
METHODS AND RESULTS
Total genomic DNA was extracted from frozen young leaves following a slightly modified cetyltrimethylammonium bromide (CTAB) protocol (Doyle, 1987). We used 0.7 volumes of cold isopropanol to precipitate nucleic acid, a wash buffer with 70% EtOH (without ammonium acetate), and mixed RNase with distilled water to resuspend the nucleic acid pellet; the samples were then incubated for 60 min at 37°C. The last dilution step was removed from the protocol. Leaves were collected from seven individuals across seven distinct populations covering the range of distribution of Z. lotus in southern Spain. Microsatellite isolation was performed by Genetic Marker Services (Brighton, United Kingdom). Briefly, microsatellite isolation was based on the production of an enriched library, using a hybridization capture protocol. Enrichment involved incubating adapter-ligated, restricted DNA, with filter-bonded synthetic repeat motifs: (AG)17, (AC)17, (AAC)10, (CCG)10, (CTG)10, and (AAT)10. The library was transformed into Escherichia coli JM109 and plated onto Luria–Bertani agar/ampicillin plates. The motif-positive clones were screened, isolated, and sequenced. Primers were designed using the online primer design software Primer3 (Rozen and Skaletsky, 1999). The amplifying products were 100–250 bp long, to help minimize later multiloading overlap ambiguities during sequencer genotyping. The GC content of the designed primers is given in Table 1. To test the effectiveness of primer amplification, we used a touchdown PCR protocol. PCR amplification was performed in a 25-μL reaction volume that contained 7 pmol of each primer, 1.5 mM of MgCl2, 0.2 mM of each dNTPs, 1× PCR buffer, 0.8 μg/μL bovine serum albumin (BSA), 0.5 units of Taq polymerase (AmpliTaq Gold polymerase; Applied Biosystems, Carlsbad, California, USA), and 1.5 μL of DNA 1:20 diluted. PCR amplification of the template was performed according to the following protocol (32 cycles): 95°C for 60 s for initial denaturation; annealing for 60 s as two cycles each 64–59°C, 10 cycles 58°C, 10 cycles 57°C; elongation at 72°C for 60 s; and a final extension at 72°C for 5 min using a MyCycler Thermal Cycler (Bio-Rad Laboratories, Hercules, California, USA). All PCR products were checked for specificity, active polymorphism, and null alleles on high-resolution agarose gels (4% MetaPhor; Lonza, Basel, Switzerland) in a TAE buffer system. Fourteen out of 20 loci showed clear and specific bands displaying size variation among the seven individuals assayed. These 14 loci were then selected for fluorescent labeling (Table 1).
Table 1.
Characteristics of 20 microsatellite loci developed in Ziziphus lotus.
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | Ta (°C) | Fluorescent dye | Mix groups | GenBank accession no. |
| zlo60§ | F: GTTCATCAATTTCACCATGC | (CT)15 | 205–234 | 50 | — | — | KU530111 |
| R: CCTATGGATTACTCCTATAAGCTG | |||||||
| zlo61§ | F: GCAACTTTCCCAACCAAGAA | (CT)24 | 364–411 | 53.5 | — | — | KU255442 |
| R: CCAAATTTTCGTTACACCATGT | |||||||
| zlo64* | F: TTGGATAAAAAGAGGTTAGCACA | (CT)15 | 61–90 | 52 | 5-HEX | A | KU530112 |
| R: CCAAACAGCTTAGGGACCAA | |||||||
| zlo65* | F: ATTGTCCCACCTTCCAACAC | (TC)10/ACTCC/(CT)5 | 332–366 | 55 | 5-HEX | A | KU255443 |
| R: AACTCCACCTGAAACCTTGC | |||||||
| zlo66* | F: TAAAGAGCGTAAGCGGGAAA | (AG)15 | 321–350 | 54 | 56-FAM | E | KU255444 |
| R: GCGCGCAGTAGATAGACACC | |||||||
| zlo67* | F: GATCTGAACACCGTGCGTTT | (CT)19 | 139–176 | 53 | 5-HEX | D | KU255445 |
| R: AAACCAACGAAACCAACGAA | |||||||
| zlo68* | F: TGACGTTAGGAAAGAAGATTCAAA | (TG)9(AG)14 | 289–334 | 52.5 | 5-HEX | E | KU255446 |
| R: GGCATCCTTAATGCAAGAGG | |||||||
| zlo69§ | F: AGCTTGGTCTCTCCAACGAA | (CT)6/CC/(CT)11 | 54–89 | 56 | — | — | KU255447 |
| R: GCAAAACCCTAGGTGGCTTA | |||||||
| zlo71* | F: CCGAGGTGAGGTATGTCTTT | (CT)20 | 57–96 | 51.5 | 56-FAM | C | KU255448 |
| R: TCCCCAAGAAGCAAATATCA | |||||||
| zlo73* | F: GGACTGTGTATTTCAGCAAGG | (TC)21 | 429–470 | 51 | 56-FAM | A | KU255449 |
| R: AAAGTTGTGCCAATCTTGTTT | |||||||
| zlo76* | F: ACAACGTTTGCTGTCCTCTC | (CT)16 | 108–139 | 55 | 56-FAM | C | KU255450 |
| R: TAAACCCACAAGAGGGAATG | |||||||
| zlo77* | F: CGCCATGTAAAATGGTGTTG | (GA)12 | 217–240 | 52.5 | 56-FAM | D | KU235551 |
| R: CCACTTCCCAGGAGATCCAT | |||||||
| zlo79* | F: TATAATCTCTTTCCAGATTCCTAGAA | (CT)19 | 311–348 | 51 | 56-FAM | B | KU235552 |
| R: CTTGTGTCATCCCAAAACCA | |||||||
| zlo80* | F: TTTCACGGTATTGCAACCAG | (GT)10 | 377–396 | 53.5 | 5-HEX | C | KU255451 |
| R: CACCTGAGGCACAACAAAGTT | |||||||
| zlo84§ | F: CGTTTTCTGTTTGGAGACCA | (AG)18 | 216–251 | 53 | — | — | KU255452 |
| R: AATCAATTCCTTCCCAAGCA | |||||||
| zlo85§ | F: TGGCATTTAATTGTGTCATCAGA | (AG)14 | 136–163 | 53 | — | — | KU255453 |
| R: CCATACTGTCCCTTTCCAGTC | |||||||
| zlo86* | F: TTTGAGATTGATGGCTCCTT | (AC)10 | 233–252 | 51.5 | 56-FAM | E | KU255454 |
| R: GCAGTTTCCGTTGTTGTTTT | |||||||
| zlo87* | F: CAGCTCGTCCTCTTCGAGAT | (TC)16 | 134–164 | 56 | 56-FAM | B | KU255455 |
| R: GGACAATTTGGAATTTCAGTTTC | |||||||
| zlo88* | F: TTCATAACAGCACGTCAAACT | (AG)21 | 409–450 | 52.5 | 56-FAM | B | KU255456 |
| R: TATGGAGTGGGTTCATTTCC | |||||||
| zlo89§ | F: TGGTCTTAATTCACCAAGCTCA | (GA)14/GG/(GA)10 | 158–207 | 54 | — | — | KU255457 |
| R: GCTTGTCAGTTGTATGTGAAGTGA |
Note: Ta = annealing temperature.
*Tested for polymorphism.
§Monomorphic markers.
We tested the efficiency and functionality of the 14 selected microsatellites in 97 samples from 18 Iberian and seven Moroccan populations corresponding to the three main population centers of this species in the western Mediterranean (Appendix 1). The larger populations are located in Almeria; the populations in Murcia and Morocco are basically relicts where scattered individuals occur, often growing at the margin of cultivated fields.
Multiplex PCRs were performed in 11.11-μL volumes containing 7 pmol of each primer (labeled with the fluorescent dye 5-HEX or 56-FAM; Table 1), 1.5 mM of MgCl2, 0.2 mM of dNTPs mix, 1× PCR buffer, 0.5 units AmpliTaq Gold polymerase (Applied Biosystems), and 10 ng/μL of DNA. Touchdown PCR conditions (32 cycles) comprised an initial heat step at 95°C for 4 min; followed by 10 cycles at 95°C for denaturation for 1 min, annealing at 64°C for 1 min (decreasing 1°C for each of two cycles), elongation at 72°C for 1 min; followed by 11 cycles with denaturation at 95°C for 1 min, annealing at 58°C for 1 min, elongation at 72°C for 1 min; followed by 11 cycles with denaturation at 95°C for 1 min, annealing at 57°C for 1 min, elongation at 72°C for 1 min; with a final extension of 5 min at 72°C. Mix A (Table 1) was best amplified and optimized with a common PCR protocol for SSR (Ghaffari and Hasnaoui, 2013), which comprised an initial heat step at 95°C for 3 min, followed by 40 cycles with denaturation at 95°C for 20 s, annealing at 55°C for 1 min, elongation at 72°C for 1 min, and a final extension at 72°C for 6 min. Fluorescently labeled PCR products were analyzed on an ABI 3500 Genetic Analyzer sequencer (Applied Biosystems) using GeneScan 600 LIZ Size Standard (Applied Biosystems) in the automated genotyping. GeneMapper software version 4.1 (Applied Biosystems) was used for the assignment of alleles and fragment analysis.
We used the package pegas (Paradis, 2010) of R software version 3.2.2 (R Core Team, 2015) to estimate the number of alleles, observed heterozygosity (Ho), expected heterozygosity (He), and Hardy–Weinberg equilibrium (HWE). The presence of null alleles was checked using MICRO-CHECKER 2.2.3 (van Oosterhout et al., 2004), and their statistical significance was assessed using Bonferroni corrected P values. Linkage disequilibrium was estimated using GENEPOP software (Rousset, 2008).
The number of alleles ranged from two to eight per locus, depending on the population (Table 2). Ho varied from 0.08 to 0.90, and He varied from 0.08 to 0.82. Overall, it is shown that Ho is lower than He in the three study areas (Almeria, Murcia, and Morocco; Table 2), likely as a result of nonrandom mating and/or genetic drift. Two loci (zlo71 and zlo86) showed a significant deviation from HWE in Murcia populations, while two other loci (zlo64 and zlo71) showed deviation from HWE in Moroccan populations. Null alleles were present in six loci (Table 2) concordant in some cases with deviation from HWE, which may be caused by the intensive fragmentation of Z. lotus habitat in those populations. The presence of microsatellite null alleles is reported frequently in PCR primer characterization, and it should be taken into account when estimating population differentiation (Chapuis and Estoup, 2007). Significant linkage disequilibrium was detected only for zlo76/zlo80 loci after pairwise Bonferroni correction. Cross-amplification in Z. jujuba showed fragments of the expected size in nine of the 14 microsatellite loci (Table 3).
Table 2.
Genetic characterization of 14 newly developed polymorphic microsatellites of Ziziphus lotus.a
| Almeria, Spain (n = 50) | Murcia, Spain (n = 37) | Morocco (n = 10) | ||||||||||
| Locus | A | Ho | He | HWE | A | Ho | He | HWE | A | Ho | He | HWE |
| zlo64§ | 8 | 0.72 | 0.79 | 0.011 | 8 | 0.62 | 0.78 | 0.006 | 5 | 0.20 | 0.72 | 0.000* |
| zlo65 | 8 | 0.74 | 0.74 | 0.005 | 6 | 0.62 | 0.72 | 0.015 | 7 | 0.80 | 0.80 | 0.346 |
| zlo66 | 6 | 0.76 | 0.72 | 0.784 | 6 | 0.30 | 0.39 | 0.016 | 6 | 0.60 | 0.73 | 0.172 |
| zlo67 | 6 | 0.58 | 0.67 | 0.231 | 4 | 0.43 | 0.44 | 0.199 | 8 | 0.70 | 0.80 | 0.021 |
| zlo68 | 5 | 0.66 | 0.67 | 0.872 | 6 | 0.73 | 0.73 | 0.520 | 4 | 0.40 | 0.68 | 0.066 |
| zlo71§ | 6 | 0.54 | 0.57 | 0.228 | 5 | 0.41 | 0.59 | 0.000* | 7 | 0.20 | 0.70 | 0.000* |
| zlo73§ | 4 | 0.46 | 0.62 | 0.014 | 5 | 0.51 | 0.65 | 0.020 | 5 | 0.40 | 0.74 | 0.015 |
| zlo76§ | 5 | 0.44 | 0.56 | 0.046 | 3 | 0.43 | 0.46 | 0.098 | 6 | 0.60 | 0.76 | 0.424 |
| zlo77 | 3 | 0.18 | 0.17 | 1.000 | 2 | 0.08 | 0.08 | 1.000 | 3 | 0.60 | 0.55 | 0.587 |
| zlo79§ | 6 | 0.74 | 0.72 | 0.249 | 5 | 0.49 | 0.65 | 0.046 | 7 | 0.70 | 0.82 | 0.079 |
| zlo80§ | 6 | 0.68 | 0.72 | 0.203 | 6 | 0.59 | 0.74 | 0.020 | 4 | 0.50 | 0.66 | 0.131 |
| zlo86 | 5 | 0.50 | 0.50 | 0.562 | 6 | 0.57 | 0.66 | 0.000* | 8 | 0.60 | 0.71 | 0.011 |
| zlo87 | 5 | 0.56 | 0.56 | 0.161 | 5 | 0.38 | 0.47 | 0.030 | 5 | 0.90 | 0.78 | 0.082 |
| zlo88 | 7 | 0.50 | 0.55 | 0.078 | 6 | 0.46 | 0.55 | 0.015 | 5 | 0.50 | 0.72 | 0.238 |
| Mean | 5.71 | 0.58 | 0.61 | — | 5.21 | 0.47 | 0.57 | — | 5.71 | 0.55 | 0.73 | — |
Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; HWE = P values of the exact test of Hardy–Weinberg equilibrium; n = number of individuals sampled.
See Appendix 1 for geographic locations of all populations sampled.
*Locus showed significant deviations from Hardy–Weinberg equilibrium, after Bonferroni correction (P < 0.001).
§Significant presence of null alleles (zlo73 and zlo76 from Almeria; zlo64, zlo71, zlo73, zlo79, and zlo80 from Murcia; zlo64, zlo71, and zlo73 from Morocco).
Table 3.
Genetic properties of the microsatellite loci developed for Ziziphus lotus in single populationsa of Z. jujuba (n = 5).
| Locus | A | Allele size range (bp) | Ho | He |
| zlo64 | — | — | — | — |
| zlo65 | — | — | — | — |
| zlo66 | 3 | 172–178 | 0.4 | 0.62 |
| zlo67 | 1 | 156 | 0 | 0 |
| zlo68 | 5 | 158–176 | 1 | 0.74 |
| zlo71 | — | — | — | — |
| zlo73 | — | — | — | — |
| zlo76 | 1 | 125 | 0 | 0 |
| zlo77 | 1 | 136 | 0 | 0 |
| zlo79 | 1 | 142 | 0 | 0 |
| zlo80 | 2 | 142–155 | 1 | 0.5 |
| zlo86 | 1 | 112 | 0 | 0 |
| zlo87 | 1 | 114 | 0 | 0 |
| zlo88 | — | — | — | — |
Note: — = not amplified; A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; n = number of individuals sampled.
See Appendix 1 for geographic locations of all populations sampled.
CONCLUSIONS
These 20 microsatellite markers are the first markers developed specifically for Z. lotus, and will be a useful tool for studies on genetic variation, diversity, population genetic structure, and gene flow in the fragmented habitat of this species. These markers are thus a valuable resource for designing appropriate conservation measures for the species in the Mediterranean range.
Appendix 1.
Voucher and location information for Ziziphus lotus and Z. jujuba populations used in this study.
| Species | Vouchera | Population | Locality | Country of origin | Geographic coordinatesb | n |
| Ziziphus lotus (L.) Lam. | GDA62533 | El Ejido | Almería | Spain | 36°45′40″N, 2°47′59″W | 5 |
| GDA62534 | Santa María del Águila | Almería | Spain | 36°47′38″N, 2°46′16″W | 5 | |
| GDA62535 | Sierra Alhamilla | Almería | Spain | 36°56′55″N, 2°24′34″W | 5 | |
| GDA62541 | El Toyo | Almería | Spain | 36°50′51″N, 2°19′58″W | 5 | |
| GDA62540 | Torregarcia | Almería | Spain | 36°49′37″N, 2°17′22″W | 5 | |
| GDA62539 | El Playazo | Almería | Spain | 36°51′10″N, 2°01′05″W | 5 | |
| GDA62538 | Campohermoso | Almería | Spain | 36°56′44″N, 2°08′30″W | 5 | |
| GDA62537 | Nijar | Almería | Spain | 36°56′20″N, 2°13′10″W | 5 | |
| GDA62536 | Autovia | Almería | Spain | 36°52′11″N, 2°15′48″W | 5 | |
| GDA62542 | Guazamara | Almería | Spain | 37°20′53″N, 1°46′24″W | 5 | |
| GDA62543 | Cantera Puerto Lumbreras | Murcia | Spain | 37°31′51″N, 1°48′01″W | 5 | |
| GDA62544 | Bejar-Torrecilla | Murcia | Spain | 37°36′51″N, 1°45′17″W | 5 | |
| GDA62545 | Purias | Murcia | Spain | 37°35′28″N, 1°39′27″W | 5 | |
| GDA62546 | Tercia | Murcia | Spain | 37°42′57″N, 1°35′14″W | 5 | |
| GDA62548 | Peñas Blancas | Murcia | Spain | 37°40′52″N, 1°08′52″W | 5 | |
| GDA62549 | Palas | Murcia | Spain | 37°40′28″N, 1°13′48″W | 5 | |
| GDA62550 | Los Garres | Murcia | Spain | 37°56′14″N, 1°07′42″W | 4 | |
| GDA62547 | Fuente Álamo | Murcia | Spain | 37°42′12″N, 1°09′16″W | 3 | |
| GDA62551 | Agadir | Agadir | Morocco | 30°23′43″N, 9°34′52″W | 2 | |
| GDA62557 | Ouazzane | Ouazzane | Morocco | 34°34′48″N, 5°32′01″W | 1 | |
| GDA62556 | Taza | Taza | Morocco | 34°06′23″N, 4°27′13″W | 2 | |
| GDA62555 | Fez | Fez | Morocco | 33°56′21″N, 5°00′05″W | 2 | |
| GDA62552 | Tiznit | Tiznit | Morocco | 29°39′45″N, 9°51′53″W | 1 | |
| GDA62554 | Zag | Assa-Zag | Morocco | 27°58′47″N, 9°43′0″W | 1 | |
| GDA62553 | Tistguezzemtz | Tistguezzemtz | Morocco | 28°24′36″N, 9°10′48″W | 1 | |
| Ziziphus jujuba Mill. | GDA62558 | Pinos del Valle | Granada | Spain | 36°53′29″N, 3°32′29″W | 1 |
| GDA62559 | Puente Tablas | Jaén | Spain | 37°47′31″N, 3°45′11″W | 1 | |
| GDA62560 | Las Yucas | Jaén | Spain | 37°45′15″N, 3°41′02″W | 2 | |
| GDA62561 | Algeciras | Cádiz | Spain | 36°09′08″N, 5°27′20″W | 1 |
Note: n = number of individuals (samples) per locality.
Voucher specimens deposited at the Universidad de Granada Herbarium (GDA), Universidad de Granada, Granada, Spain.
Datum: World Geodetic System 1984 (WGS84).
LITERATURE CITED
- Chapuis M. P., Estoup A. 2007. Microsatellite null alleles and estimation of population differentiation. Molecular Biology and Evolution 24: 621–631. [DOI] [PubMed] [Google Scholar]
- Council of the European Union. 2007. Council Directive 92/43/EEC of 21 May 1992 on the conservation of natural habitats and of wild fauna and flora. Website http://data.europa.eu/eli/dir/1992/43/2007-01-01 [accessed 19 December 2015].
- Doyle J. J. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15. [Google Scholar]
- Ghaffari S., Hasnaoui N. 2013. Microsatellite amplification in plants: Optimization procedure of major PCR components. In S. K. Kantartzi , Methods in molecular biology, vol. 1006: Microsatellites: Methods and protocols, 139–146. Springer, New York, New York, USA. [DOI] [PubMed] [Google Scholar]
- Huang J., Yang X., Zhang C., Yin X., Liu S., Li X. 2015. Development of chloroplast microsatellite markers and analysis of chloroplast diversity in Chinese jujube (Ziziphus jujuba Mill.) and wild jujube (Ziziphus acidojujuba Mill.). PLoS ONE 10: e0134519. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Islam M. B., Simmons M. P. 2006. A thorny dilemma: Testing alternative intrageneric classifications within Ziziphus (Rhamnaceae). Systematic Botany 31: 826–842. [Google Scholar]
- Mendoza-Fernández A. J., Martínez-Hernández F., Pérez-García F. J., Arrido-Becerra J. A. G., Benito B. M., Salmerón-Sánchez E., Guirado J. S., et al. 2015. Extreme habitat loss in a Mediterranean habitat: Maytenus senegalensis subsp. europaea. Plant Biosystems 149: 503–511. [Google Scholar]
- Mota J. F., Peñas J., Castro H., Cabello J., Guirado J. S. 1996. Agricultural development vs biodiversity conservation: The Mediterranean semiarid vegetation in El Ejido (Almeria, southeastern, Spain). Biodiversity and Conservation 5: 1597–1617. [Google Scholar]
- Paradis E. 2010. pegas: An R package for population genetics with an integrated-modular approach. Bioinformatics (Oxford, England) 26: 419–420. [DOI] [PubMed] [Google Scholar]
- Pérez Latorre A. V., Cabezudo B. 2009. Ziziphus Mill. In G. Blanca, B. Cabezudo, M. Cueto, C. Fernández-López, and C. Morales-Torres [eds.], Flora vascular de Andalucía Oriental, vol. 3, 46–50. Consejería de Medio Ambiente, Junta de Andalucía, Seville, Spain. [Google Scholar]
- R Core Team. 2015. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. Website https://www.R-project.org/ [accessed 8 November 2016].
- Rousset F. 2008. GENEPOP’007: A complete reimplementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8: 103–106. [DOI] [PubMed] [Google Scholar]
- Rozen S., Skaletsky H. J. 1999. Primer3 on the WWW for general users and for biologist programmers. In S. Misener and S. A. Krawetz [eds.], Methods in molecular biology, vol. 132: Bioinformatics: Methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
- Tirado R. 2009. 5220 Matorrales arborescentes con Ziziphus. In VV.AA. [eds.], Bases ecológicas preliminares para la conservación de los tipos de hábitat de interés comunitario en España. Ministerio de Medio Ambiente, y Medio Rural y Marino, Madrid, Spain. Website http://www.jolube.es/Habitat_Espana/documentos/5220.pdf [accessed 21 November 2016]. [Google Scholar]
- van Oosterhout C., Hutchinson W. F., Wills D. P. M., Shipley P. 2004. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Resources 4: 535–538. [Google Scholar]
