Skip to main content
Antimicrobial Resistance and Infection Control logoLink to Antimicrobial Resistance and Infection Control
. 2017 Jan 17;6:13. doi: 10.1186/s13756-017-0171-6

Genetic markers associated with resistance to beta-lactam and quinolone antimicrobials in non-typhoidal Salmonella isolates from humans and animals in central Ethiopia

Tadesse Eguale 1,✉, Josephine Birungi 2, Daniel Asrat 3, Moses N Njahira 4, Joyce Njuguna 2, Wondwossen A Gebreyes 5, John S Gunn 6, Appolinaire Djikeng 2, Ephrem Engidawork 7
PMCID: PMC5240271  PMID: 28105330

Abstract

Background

Beta-lactam and quinolone antimicrobials are commonly used for treatment of infections caused by non-typhoidal Salmonella (NTS) and other pathogens. Resistance to these classes of antimicrobials has increased significantly in the recent years. However, little is known on the genetic basis of resistance to these drugs in Salmonella isolates from Ethiopia.

Methods

Salmonella isolates with reduced susceptibility to beta-lactams (n = 43) were tested for genes encoding for beta-lactamase enzymes, and those resistant to quinolones (n = 29) for mutations in the quinolone resistance determining region (QRDR) as well as plasmid mediated quinolone resistance (PMQR) genes using PCR and sequencing.

Results

Beta-lactamase genes (bla) were detected in 34 (79.1%) of the isolates. The dominant bla gene was blaTEM, recovered from 33 (76.7%) of the isolates, majority being TEM-1 (24, 72.7%) followed by TEM-57, (10, 30.3%). The blaOXA-10 and blaCTX-M-15 were detected only in a single S. Concord human isolate. Double substitutions in gyrA (Ser83-Phe + Asp87-Gly) as well as parC (Thr57-Ser + Ser80-Ile) subunits of the quinolone resistance determining region (QRDR) were detected in all S. Kentucky isolates with high level resistance to both nalidixic acid and ciprofloxacin. Single amino acid substitutions, Ser83-Phe (n = 4) and Ser83-Tyr (n = 1) were also detected in the gyrA gene. An isolate of S. Miami susceptible to nalidixic acid but intermediately resistant to ciprofloxacin had Thr57-Ser and an additional novel mutation (Tyr83-Phe) in the parC gene. Plasmid mediated quinolone resistance (PMQR) genes investigated were not detected in any of the isolates. In some isolates with decreased susceptibility to ciprofloxacin and/or nalidixic acid, no mutations in QRDR or PMQR genes were detected. Over half of the quinolone resistant isolates in the current study 17 (58.6%) were also resistant to at least one of the beta-lactam antimicrobials.

Conclusion

Acquisition of blaTEM was the principal beta-lactamase resistance mechanism and mutations within QRDR of gyrA and parC were the primary mechanism for resistance to quinolones. Further study on extended spectrum beta-lactamase and quinolone resistance mechanisms in other gram negative pathogens is recommended.

Keywords: Non-typhoidal Salmonella, Antimicrobial resistance, Mechanisms of resistance, Beta-lactamase, Quinolone, Fluoroquinolone, Human strains, Animal strains, Ethiopia

Background

Salmonellosis in humans is caused by several serovars belonging to Salmonella enterica subspecies enterica. Infection by Salmonella causes two forms of diseases; typhoid fever, a febrile illness caused by a few host specific serovars such as Salmonella enterica subspecies enterica serovar Typhi (S. Typhi,) and S. Paratyphi A, while the majority of Salmonella serovars cause non-typhoidal salmonellosis characterized by self limiting gastoentritis and occasional invasive salmonellosis in immunocompromised, young and elderly patients. Infection with non-typhoidal Salmonella (NTS) serovars is one of the leading causes of foodborne illnesses worldwide [1]. NTS infection is commonly associated with consumption of contaminated food of animal origin such as poultry products, beef and pork as well as contact with infected animals [2–4].

Antimicrobial treatment is usually not recommended due to the self-limiting nature of the disease. However, in cases of invasive complicated salmonellosis, treatment with beta-lactam antimicrobials such as ampicillin, ceftriaxone and quinolone drugs are employed as lifesaving agents [5]. Resistance to beta-lactam antimicrobials and quinolones has increased dramatically in NTS isolates from humans as well as food animals worldwide [6–9]. The common mechanism of resistance to beta-lactam antimicrobials is due to production of beta-lactamase enzymes with variable level of activity against different generations of beta-lactam antimicrobials. In addition to the first generation beta-lactamases: blaTEM1, blaSHV1, several extended spectrum blaTEM and blaSHV variants, other extended spectrum beta-lactamase enzymes such as blaCTX-M, blaCMY, blaOXA and AmpC have been reported in Salmonella serotypes from different parts of the world [10–13].

Resistance to quinolone drugs is primarily mediated by mutations in Quinolone Resistance Determining Region (QRDR) of gyrA and parC genes in Salmonella and other Gram-negative organisms. Specifically, high level resistance to ciprofloxacin is frequently attributed to double mutations in the gyrA gene and single or double mutation in the parC gene [14]. In addition to chromosomal mutations, other mechanisms such as activation of efflux pumps (multidrug efflux pump and quinolone specific plasmid mediated efflux pump encoded by qep genes), qnr (plasmid-mediated quinolone resistance), porins, and quinolone-modifying enzyme (aac(6')-Ib-cr) have been associated with decreased susceptibility to quinolones [14]. Of particular concern is the occurrence, within the last few years in different parts of the world, of plasmid-mediated quinolone resistance encoded by several qnr genes. These genes encode for pentapeptide proteins that protect bacterial topoisomerases from the effect of quinolones. They do not induce high level resistance but their presence leads to mutation in the QRDR [15]. However, recent report from Senegal indicated the presence of qnrB1 together with the quinolone modifying enzyme aac(6’)-Ib-cr in Salmonella associated with high level resistance to ciprofloxacin even in the absence of mutations in the QRDR [16]. These resistance determinants have been observed in various gram negative organisms including Salmonella [16, 17]. In recent years, the rate of resistance to ciprofloxacin has increased considerably in both clinical and food isolates of Salmonella [6, 18, 19].

In Ethiopia, reports revealed resistance to beta-lactam antimicrobials and quinolones in Salmonella isolates from human patients and food of animal origin [20, 21]. However, little data is available on the genetic basis of the observed phenotypic drug resistance. Multidrug resistant S. Concord isolates obtained from children adopted from Ethiopia in different European countries and USA were reported to harbor blaCTX-M-15, blaTEM1, blaSHV-12 genes encoding for resistance to third generation cephalosporins, qnrA and qnrB encoding for reduced susceptibility to fluoroquinolones [22, 23]. The aim of this study was to investigate the genetic markers associated with resistance to beta-lactam and quinolone antimicrobials among NTS isolates collected from humans and animals in central Ethiopia.

Methods

Bacterial isolates

Non-typhoidal Salmonella strains investigated in the current study were isolated from feces of food animals (cattle n = 50, poultry n = 26, swine n = 8) in Addis Ababa and surrounding districts of Oromia region namely: Ada, Barake, Sebeta and Sululta. In addition, Salmonella isolates obtained from stool of temporally and spatially related diarrheic human patients from primary health centers and Tikur Anbessa Specialized Hospital in Addis Ababa (n = 68) were also included. All human and animal isolates were collected from 2013 to 2014.

Antimicrobial susceptibility testing, serotyping and phage typing

Susceptibility of each isolate to beta-lactam and quinolone antimicrobials was determined using disk diffusion method according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI). The interpretation of the categories of susceptible, intermediate or resistant was also based on the CLSI guidelines [24]. For purposes of analysis, all readings classified as intermediate were considered resistant unless otherwise mentioned. Escherichia coli ATCC 25922 was used as a quality control. Salmonella isolates were serotyped and phage-typed at the Public Health Agency of Canada, World Organization for Animal Health (OIÉ), Reference Laboratory for Salmonellosis, Guelph, Ontario, Canada as described previously [25].

Bacterial DNA extraction

Isolates were grown on Luria Bertani (LB) agar (37 °C, over night). A single colony was inoculated to 5 ml of LB broth and grown in a shaking incubator at 37 °C for 16–18 h. Genomic DNA was then extracted using the QIAGEN genomic DNA extraction kit (QIAGEN, USA) according to the manufacturer’s recommendation.

Detection and characterization of beta-lactamase enzymes

A total of 43 isolates, 12 from humans and 31 from animals, with reduced susceptibility to one or more of beta-lactam antimicrobials (ampicillin, amoxicillin + clavulanic acid, cephalothin, ceftriaxone) were tested for genes encoding for beta-lactamase enzymes. PCR and DNA sequencing were performed for the detection and characterization of beta-lactamase (bla) genes with oligonucleotide primers previously described for blaTEM, blaSHV, blaPER, blaPSE, blaOXA1, blaOXA4, blaOXA10, blaCMY, and blaCTX-M genes (Table 1). The PCR conditions for all reactions involved an initial denaturation for 3 min at 95 °C followed by 30 cycles of (95 °C for 30 s, specific annealing temperature for 1 min, and extension at 72 °C for 30 s) followed by a final extension at 72 °C for 5 min. Specific annealing temperature for each PCR reaction is shown in Table 1. Group specific primers were used to characterize blaCTX-M enzymes [26]. The PCR amplicons were purified using QIAGEN PCR purification kit (QIAGEN, USA) and sequenced with forward and reverse primers at Sequencing, Genotyping, Oligosynthesis and Proteomics (Segolip) unit of Biosciences eastern and central Africa (BecA). All amplicon sequences were assembled and translated to amino acid sequences using CLC Main Work Bench (Inqaba Biotechnical Industries, (Pty) Ltd, Denmark) and compared with protein sequences in the Genbank database. Classification of blaTEM enzymes was based on beta-lactamase classification database (https://www.lahey.org/studies/temtable.asp).

Table 1.

List of primers used for detection and characterization of beta-lactamases

Gene/target Primer Sequence 5’-3’ Amplicon size AT °C Ref Remark
BLATem Gene TEM-F1 ATGAGTATTCAACATTTCCG 862-bp 55 [34]
TEM-R1 GACAGTTACCAATGCTTAATCA
blaTEM-F2 TAA CCA TGAGTGATAACACT [34] sequencing
blaTEM-R2 CCGATCGTT GTCAGAAGTAA
BLA SHV gene Bla SHV-F1 CTTTACTCGCCTTTATCG 827-bp 56 [34]
Bla SHV-R1 TCCCGC AGATAAATCACCA
blaSHV-F2 ACTGCCTTTTTG CGCCAGAT [34] sequencing
blaSHV-R2 CAGTTCCGTTTCCCAGCGGT
Bla OXA-1  OXA-1-F ATGAAAAACACAATACATATCAAC 755-bp 48 [13]
OXA-1-R TTTCCTGTAAGTGCGGACAC
Bla OXA −4  OXA-4-F TCAACAGATATCTCTACTGGT 216 bp 54 [13]
OXA-4-R TTTATCCCATTTGAATATG
Bla OXA-10 OXa 10-F TCAACAAATCGCCAGAGAAG 277 bp 57 [13]
Oxa-10-R TCCCACACCAGAAAAACCA
bla PER Per1-F AATTTGGGCTTAGGGCAGAA 925 bp 55 [50]
Per1-R ATGAATGTCATTATAAAAGC
blaPSE blaPSE-F TGCTTCGCAACTATGACTAC [42]
blaPSE-R AGCCTGTGTTTGAGCTAGAT
blaCYM blaCMY2-F TGGCCGTTGCCGTTATCTAC 868 57 [9]
blaCMY2-R CCCGTTTATGCACCCATGA
CTX-M group I CTXM1-F3 GACGATGTCACTGGCTGAGC 499 55 [38]
CTXM1-R2 AGCCGCCGACGCTAATACA
CTX-M group II TOHO1-2 F GCGACCTGGTTAACTACAATCC 351 55 [38]
TOHO1-1R CGGTAGTATTGCCCTTAAGCC
CTX-M group III CTXM825F CGCTTT GCCATGTGCAGCACC 307 55 [38]
CTXM825R GCT CAGTACGATCGAGCC
CTX-M group IV CTXM914F GCTGGAGAAAAGCAGCGGAG 474 62 [38]
CTXM914R GTAAGCTGACGCAACGTCTG

Investigation of quinolone resistance mechanism

Isolates with reduced susceptibility to nalidixic acid and/or ciprofloxacin (n = 29), three human isolates and 26 animal isolates were examined for the presence of known quinolone resistance determinants. Quinolone resistance determining region (QRDR): gyrA, gyrB, parC and parE genes were amplified using PCR. PCR was also used to examine for various plasmid mediated quinolone resistance genes: qnrA, qnrB, qnrD, qnrS, qepA, and aac(6′)-Ib-cr as described previously (Table 2). Similar PCR conditions described previously were used and annealing temperature for each primer set is presented in Table 2. PCR ampilicons were purified using QIAGEN PCR purification kit and sequenced as previously described. Presence of mutation in the QRDR was examined by translating nucleotide sequences into proteins and aligning against reference sequence of S. Typhimurium strain LT2 on NCBI database (Accession Number AE006468).

Table 2.

List of primers used for detection of quinolone resistance mechanism

Gene Primer name Primer sequence (5′ to 3′) Product size AT in °C References
gyrA GyrAFP AAATCTGCCCGTGTCGTTGGT 344 bp 58 [16]
GyrARP GCCATACCTACTGCGATACC
gyrB GyrB FP GAATACCTGCTGGAAAACCCAT 446 bp 57 [16]
GyrB RP CGGATGTGCGAGCCGTCGACGTCCGC
parC ParC FP AAGCCGGTACAGCGCCGCATC 395 bp 57 [16]
ParC RP GTGGTGCCGTTCAGCAGG
ParE ParE FP TCTCTTCCGATGAAGTGCTG 240 bp  55 [12]
ParE RP ATACGGTATAGCGGCGGTAG
qnrA qnrA FP ATTTCTCACGCCAGGATTTG 516 bp 53 [43]
qnrA RP GATCGGCAAAGGTTAGGTCA
qnrB qnrB FP GATCGTGAAAGCCAGAAAGG 469 bp 53 [43]
qnrB RP ACGATGCCTGGTAGTTGTCC
aac(6’)-Ib aac(6’)-Ib FP TTGCGATGCTCTATGAGTGGCTA 482-bp 55 [36]
aac(6’)-Ib-RP CTCGAATGCCTGGCGTGTTT
aac(6’)-Ib-cr-seq CGTCACTCCATACATTGCAA (for sequencing of aac(6’)-Ib-cr
qepA QepA FP CGTGTTGCTGGAGTTCTTC 403 bp 59 [7]
QepA RP CTGCAGGTACTGCGTCATG
QnrD QnrD FP CGAGATCAATTTACGGGGAATA 565 bp 53 [8]
QnrD RP AACAAGCTGAAGCGCCTG
QnrS QnrS FP ACGACATTCGTCAACTGCAA 417 bp 53 [43]
QnrS RP TAAATTGGCACCCTGTAGGC

FP forward primer, RP Reverse primer

Results

Resistance to beta-lactam antimicrobials and beta-lactamase genes in Salmonella isolates from animals and humans

Of the 20 different serotypes investigated in the current study, resistance to at least one beta-lactam antimicrobial was detected in nine serotypes and the bla gene was detected only in isolates belonging to six serotypes. Of the 43 isolates resistant to one or more beta-lactam antimicrobials (ampicillin, amoxicillin + clavulanic acid, cephalothin, ceftriaxone), bla genes were detected in 34/43 (79.1%) of the isolates. The dominant bla gene responsible for resistance to beta-lactam antimicrobials in the majority of Salmonella isolates, 33 (76.7%) was found to be variants of blaTEM gene. Most of these were TEM-1 type, 24 (72.7%) followed by TEM-57, 10 (30.3%). Both phenotypic resistance to beta-lactam antimicrobials and detection of bla genes was more common in isolates obtained from poultry compared to isolates from other sources (Table 3). In one of the human isolates of S. Concord, two bla genes (blaOXA-10 and blaCTX-M-15) were detected. Both of these genes encode for enzymes capable of extended spectrum beta-lactamase activity. This isolate was resistant to the third generation cephalosporin, ceftriaxone in addition to ampicillin, and cephalothin. In eight (18.6%) of the isolates, none of the tested bla genes were detected (Table 3).

Table 3.

Occurrence of bla genes in Salmonella isolates from different sources with reduced susceptibility to beta-lactam antimicrobials

Source Total no. of isolates aResistant to ≥ one of beta-lactams (%) bla genes detectedb Not detected No.(%) positive for bla genes
blaTEM blaOXA10 blaCTX-M
Cattle 50 16(32) 12 - - 4 8(75)
Poultry 26 13(50) 12 - 1 12(92.3)
Swine 8 2(25) 1 - - 1 1(50)
Human 68 12(17.7) 9 1 1 2 c10(83.3)
Total 152 43(28.3) 34 1 1 8 34(79.1)

aAmpicillin, Cephalothin, Cefoxitin, Ceftriaxone, amoxicillin and clavulanic acid

bThough all isolates were screened for blaSHV, blaOXA1, blaOXA4, blaPER, blaPSE and blaCMY2, none of them were positive for these genes

c blaOXA10 and blaCTX-M-15 were detected in a single isolate

Among the dominant serotypes, 66.7, 92.3, 50 and 100% of S. Typhimurium, S. Saintpaul, S. Virchow and S. Kentucky were positive for variants of the blaTEM gene, respectively. All of the 10 S. Kentucky isolates collected from cattle, poultry and humans were resistant to ampicillin, cephalothin and amoxicillin + clauvlanic acid and were all positive for blaTEM-1 gene (Table 4).

Table 4.

Beta-lactam resistance profile among different Salmonella serotypes from various hosts, occurrence of betalactamses genes and bla-types based on amino acid sequences

Serotype Total Host (No.) No. resistant to Beta-lactam(%) Beta-lactam R-profile bla positive(%) bla type
Intermediate Resistant
Aberdeen 1 C - - - - -
Agona 1 C - - - - -
Braenderup 3 C(2), H(1) - - - - -
Concord 1 H 1(100) Fox AmpAmcCroCf 1(100) OXA-10 and blaCTX-M-15
Dublin 3 C 2(66.7) Cf - - -
Enteritidis 2 H - - - - -
Haifa 4 C(3), P(1) 1P(25) Amp - - -
Heidelberg 1 S 1(100) Amc AmpCf 1(100) TEM-1
I:6;7,14:-:I,w 1 C 1(100) - AmpAmcCf 1(100) TEM-1
I: Rough-O:I:1,2 1 S - - - - -
Kentucky 10 C(6), 6(100) - AmpAmcCf 6(100) TEM-1
P(2) 2(100) - AmpAmcCf 2(100) TEM-1
H(2) 2(100) Fox AmpAmcCf 2(100) TEM-1
Amc AmpCf
Kottbus 8 C(1), H(7) - - - - -
Livingstone var.14+ 2 C(1), S(1) - - - - -
Miami 5 H(3), S(2) - - - - -
Mikawasima 2 C(2) - - - -
Newport 2 H(2) - - - - -
Saintpaul 33 P(20) 10(50) AmcCf Amp 4(100) TEM-57
- AmpAmcCf 4(100) TEM-57
Amc AmpCf 2(100) TEM-57
C(10) 2(20) Amc AmpCf 2(100) TEM-1
S(2) - - - - -
H(1) 1(100) Amc AmpCf 1 TEM-1
Typhimurium 42 C(12) 2(16.7) - AmpAmcCf 2(100) TEM-1
P(3) - - - - -
S(1) 1(100)
H(26) 6(64.5) 5(83.3) TEM-1
Cf - - -
Amc AmpCf 2(100) TEM-1
Amp - 1(100) TEM-1
- AmpAmcCf 2(100) TEM-1
Virchow 28 C(6) 3(50) Amc AmpCf 1(33.3) TEM-1
H(22) 1(4.6) - AmpAmcCf 1(100) TEM-1
V:ROUGH-O;-;- 1 H(1) 1 - AmpCf - -

C Cattle, H Human, P poultry, S swine, − = not detected, Amp ampicillin, Amc amoxicillin and clavulanic acid, Cf cephalothin, Cro ceftriaxone

Interestingly, all 10 blaTEM-57 were recovered from S. Saintpaul isolated from poultry, while those S. Saintpaul strains obtained from cattle and human were all TEM-1 type. Despite a change in amino-acid sequences, there was no distinct difference in phenotypic antimicrobial susceptibility pattern to beta-lactam antimicrobials among isolates carrying blaTEM-57 and blaTEM-1 enzymes.

Among eight isolates in which none of the tested bla genes were detected, most of them were susceptible to the major beta-lactams and were at the margin of susceptibility and intermediate; S. Dublin (n = 2) and S. Typhimurium (n = 2) only to cephalothin and S. Haifa to ampicillin (n = 1) On the other hand, three S. Virchow isolates and one S. V:ROUGH-O;-:- were completely resistant to ampicillin and cephalothin.

Mechanism of resistance to quinolone antimicrobials

Out of the 29 Salmonella isolates with reduced sensitivity to quinolones, high level resistance to both nalidixic acid and ciprofloxacin was observed in only 10 S. Kentucky isolates (34.5%) (Table 5). All of these S. Kentucky isolates had double mutations in gyrA (Ser83-Phe + Asp87-Gly) and parC (Thr57-Ser + Ser80-Ile) genes. Single mutation in gyrA (Ser83-Phe) was observed in four isolates (S. Livingstone var.14+ (2), S. Virchow (1), S. I:6;7,14:-:I,w (1). All these isolates were resistant to nalidixic acid and intermediately resistant to ciprofloxacin. A single amino acid substitution in gyrA (Ser83-Tyr) was detected in one S. Haifa from poultry with an R-phenotype [resistant to nalidixic acid and intermediately resistant to ciprofloxacin]. Overall, double and single substitutions in gyrA were detected in 15 (51.7%) of the isolates. Double substitution in parC (Thr57-Ser + Tyr83-Phe) was detected in one S. Miami isolated from swine. This strain was sensitive to nalidixic acid and intermediately resistant to ciprofloxacin. The Tyr83-Phe is a novel mutation. A strain of S. Agona with only single substitution at Thr57-Ser was intermediately resistant to nalidixic acid but sensitive to ciprofloxacin. Double substitution in the gyrB gene (Val423-Gly + Asp459-His) was detected in two isolates; S. Mikawasima and S. Braenderup, the latter having additional substitution in parC gene (Thr57-Ser) associated with intermediate susceptibility to both nalidixic acid and ciprofloxacin, whereas the former with intermediate susceptibility only to naldixic acid. A strain of serotype V: rough-O;-:- that was susceptible to nalidixic acid but intermediately resistant to ciprofloxacin had single substitution of Ser463-Ala on gyrB gene. Over half of the quinolone resistant isolates in the current study 17 (58.6%) were also resistant to at least one of the beta-lactam antimicrobials (Table 5) and all S. Kentucky isolates resistant to nalidixic acid and ciprofloxacin were also shown to be MDR to several antimicrobials in our previous works [27, 28]. No mutation was detected in parE gene in any of the isolates examined in the current study. Nine isolates with reduced sensitivity to nalidixic acid and or ciprofloxacin had no mutation in any of the QRDR (Table 5).

Table 5.

Susceptibility of isolates to quinolone drugs and mutation in QRDR

Serotype Zone of inhibition mm (susceptibility category) R-pattern betalactamsa Mutation in QRDR
Na Cip gyrA gyrB parC
Cattle Aberdeen 19[S] 27[I] - - - -
Cattle Virchow 20[S] 25[I] - - - -
Cattle Typhimurium PT 3 21[S] 25[I] AmpAmcCf - - -
Cattle Typhimurium PT 4 22[S] 27[I] AmpAmcCf - - -
Cattle Haifa 21[S] 25[I] - - - -
Poultry Saintpaul 20[S] 31[S] AmcCf - - -
Cattle Saintpaul 17[I] 25[I] AmpAmcCCf - - -
Cattle Saintpaul 21[S] 27[I] - - - -
Poultry Saintpaul 20[S] 27[I] - - - -
Human V:ROUGH-O;-:- 22[S] 28[I] AmpCf - Ser463Ala -
Cattle Mikawasima 20[S] 25[I] - - Val423Gly + Asp459His -
Cattle Agona 17[I] 31[S] - - - Thr57Ser
Cattle Braenderup 17[I] 25[I] - - Val423Gly + Asp459His Thr57Ser
Swine Miami 22[S] 27[I] - - - Thr57Ser + Tyr83Phe
Poultry Haifa 0[R] 25[I] - Ser83Tyr - -
Cattle Virchow 0[R] 26(I) AmpAmcCf Ser83Phe - -
Cattle Livingstone var.14+ 0[R] 24(I) - Ser83Phe - -
Cattle I:6;7,14:-:I,w 7[R] 30(I) AmpAmcCf Ser83Phe - -
Swine Livingstone var.14+ 0[R] 20[I] - Ser83Phe - -
Cattle Kentucky 0[R] 14[R] AmpAmcCf Ser83Phe + Asp87Gly - Thr57Ser + Ser80Ile
Cattle Kentucky 0[R] 12[R] AmpCf Amc Ser83Phe + Asp87Gly - Thr57Ser + Ser80Ile
Cattle Kentucky 0[R] 11[R] AmpCf Amc Ser83Phe + Asp87Gly - Thr57Ser + Ser80Ile
Cattle Kentucky 0[R] 9[R] AmpAmcCf Ser83Phe + Asp87Gly - Thr57Ser + Ser80Ile
Cattle Kentucky 0[R] 12[R] AmpCf Amc Ser83Phe + Asp87Gly - Thr57Ser + Ser80Ile
Cattle Kentucky 0[R] 10[R] AmpAmcCf Ser83Phe + Asp87Gly - Thr57Ser + Ser80Ile
Human Kentucky 0[R] 8[R] AmpAmcCf Fox Ser83Phe + Asp87Gly - Thr57Ser + Ser80Ile
Human Kentucky 0[R] 10[R] AmpCf Amc Ser83Phe + Asp87Gly - Thr57Ser + Ser80Ile
Poultry Kentucky 0[R] 9[R] AmpAmcCf Ser83Phe + Asp87Gly - Thr57Ser + Ser80Ile
Poultry Kentucky 0[R] 11[R] AmpAmcCf Ser83Phe + Asp87Gly - Thr57Ser + Ser80Ile

PT Phagetype, Amp Ampicillin, Amc Amoxicillin and clavulanic acid, Cf Cephalothin, Cip Ciprofloxacin, Na- Nalidixic acid, S susceptible, I intermediately resistant, R resistant

aResistance status, isolates were fully resistant to antimicrobials written in Bold and intermediately resistant to those written in italics

Plasmid mediated quinolone resistance

None of the tested plasmid mediated quinolone resistance genes were detected in the isolates examined in the current study. Seven isolates belonging to serotypes Saintpaul, Typhimurium, Aberdeen, Virchow and Haifa were susceptible to nalidixic acid but had shown reduced sensitivity to ciprofloxacin according to CLSI (2013) cut-off points, with zone of inhibition ranging from 25 to 28 mm. There appears to be other resistance mechanisms responsible for the observed decreased sensitivity.

Discussion

Detection of a high resistance rate to beta-lactam antimicrobials (50%) and the presence of bla genes in isolates from poultry could be due to the fact that drugs like ampicillin and amoxicillin are frequently employed in poultry farms in Ethiopia leading to selection pressure. The dominant beta-lactamase genes detected in the current study were variants of blaTEM with the majority being blaTEM-1, which is concordant with the observed spectrum of resistance to only ampicillin and first generation cephalosporin in most of the isolates. In Africa, blaTEM-1 has been reported from Salmonella isolated from poultry in Egypt [29], from children adopted from Mali [30], and S. Enteritidies in Senegal [31].

All S. Saintpaul isolated from poultry in the current study carried blaTEM-57, while those from cattle and human carried blaTEM-1. This is probably due to mutation of a blaTEM gene in a strain of S. Saintpaul in one of the poultry farms and clonal spread of strain carrying this mutant gene to farms in the area. All poultry S. Saintpaul were isolated from farms in the Adaa district. Compared to TEM-1, TEM-57 has a substitution of Gly to Asp at position 92 of amino acid sequence, which was first reported from Proteus mirabilis [32] and later on from E. coli in China [33]. To our knowledge, this is the first report of detection of blaTEM-57 in Salmonella. Fortunately, this mutation was not associated with extended spectrum activity against second and third generation cephalosporins.

One of the human isolates, S. Concord, resistant to ampicillin, cephalothin, cefoxitin and ceftriaxone was shown to produce blaCTX-M-15 and blaOXA-10. Previous studies have also reported blaCTX-M-15 in S. Concord isolated from children adopted from Ethiopia to different European countries and USA [34, 35]. In fact, a separate study also showed that blaCTX-M-15 isolated from S. Concord from Ethiopia was chromosomally encoded [35]. Nevertheless, the previous studies also showed production of blaSHV-12 in most of the S. Concord from Ethiopia, but OXA-10 was not reported. This is presumably due to loss of a plasmid encoding for SHV-12 and acquisition of OXA-10 in a new isolate from Ethiopia. During the last few years, CTX-M-15 and other related CTX-M enzymes have been widely reported from various Enterobacteriaceae including Salmonella in different African countries from both hospital and community settings [16, 36–39]. Oxacilinases including OXA-10 have also been commonly isolated from different enterobacteriaceae including Salmonella [40].

The possible reason for the absence of bla genes in a few isolates with reduced susceptibility in the current study despite testing for most of the known bla reported in Salmonella could be due to poor sensitivity of phenotypic resistance detection methods. In two S. Typhimurium and two S. Dublin intermediately resistant only to cephalothin and one S. Haifa intermediately resistant to ampicillin, the reading was at the margin of intermediate and susceptible. However, all the three S. Virchow were fully resistant to ampicillin and cephalothin and intermediately resistant to amoxicillin + clauvlanic acid. For these isolates, other resistance mechanisms not investigated in this study such as alterations in the beta-lactam targets (PBPs) [41], absence or down-regulation of the production of outer membrane porins [42], over expression of efflux pumps [43] and different ampC betalactamases [44] might be responsible for the observed reduction in susceptibility. In general, the rate of occurrence of extended spectrum beta-lactamases in Salmonella isolates in the current study is low. This could be due to the fact that most of the human isolates were obtained from primary health care centers and use of 2nd and 3rd generation cephalosporins is not a common practice in veterinary medicine [28, 45]. The single MDR S. Concord in the current study was isolated from hospitalized 1 year old child.

Amino acid substitutions at codon 83 and 87 of gyrA gene have been associated with high level fluoroquinolone resistance [46–49] whereas resistance to only nalidixic acid is associated with single or double mutation in parC gene in Salmonella and other Gram-negative pathogens [14, 50]. Detection of two amino acid substitutions in the gyrA gene at codon 83 and 87 and the parC gene at codon 57 and 80 in all S. Kentucky isolates with high level resistance to both nalidixic acid and ciprofloxacin obtained from humans and animals suggests the possibility of clonal spread of S. Kentucky strain in the human and animal population in the study area. Similar mutations in gyrA and parC genes were reported from S. Kentucky from French travelers returning from north east and eastern Africa [51]. Studies of S. Kentucky ST198 from different countries have also shown a similar substitution in gyrA at codon 83 (Ser83-Phe) for all isolates and substitution of aspartate at codon 87 with asparagine, tyrosine or glycine residues. S. Kentucky isolates in the current study also belonged to ST198 suggesting the clonal relatedness of our isolates to the internationally spreading clone of S. Kentucky (unpublished data). However, only single substitution in the parC gene at codon 80 (Ser80-Ile) was reported previously and none of them had substitution at codon 57 of parC gene [52]. Additional substitution at codon 57 of the parC gene in the Ethiopian isolates might have occurred separately. Contrary to these local and global spread of MDR fluoroquinolone resistant S. Kentucky, a previous study on S. Typhimurium showed that mutation based fluoroquinolone resistance is associated with fitness cost and resistant strains are less invasive [53]. This suggests that this internationally dispersed clone of S. Kentucky has unique mechanisms. Furthermore, we have previously shown that S. Kentucky strains from Ethiopia has strong biofilm forming ability which is one of the important traits for persistence of the organism in the host or the environment [54] that might have contributed to its dissemination.

Four of the Salmonella isolates resistant to nalidixic acid and intermediately resistant to ciprofloxacin had only a single substitution in the gyrA, Ser83-Phe, whereas one isolate S. Haifa from poultry had a Ser83-Tyr substitution. Previous studies have also shown that a single mutation in gyrA results only in resistance to nalidixic acid and not to ciprofloxacin [47, 53]. Although isolates with a single mutation in parC gene resulted only with reduced susceptibility to nalidixic acid, an S. Miami isolate with no mutation in gyrA gene but double substitution in parC gene: (Thr57-Ser) and a novel substitution (Tyr83-Phe) was fully susceptible to nalidixic acid and intermediately resistant to ciprofloxacin. This suggests that the novel mutation at codon 83 of parC gene might accentuate the activity of nalidixic acid and attenuate the activity of ciprofloxacin.

The observation of double substitution in gyrB gene (Val423-Gly + Asp459-His) associated with intermediate susceptibility only to nalidixic acid shows a minor contribution of mutation in gyrB compared to gyrA for development of resistance to quinolones. Interestingly, nine isolates with reduced sensitivity to ciprofloxacin and some to nalidixic acid had no mutation in QRDR. We have also not detected PMQR genes in any of the isolates. Other resistance mechanisms not tested in this study such as multidrug efflux pumps, other PMQR mechanisms recently described in Salmonella such as oqxAB efflux pump [19], and altered outer membrane porins might be involved [14].

Conclusion

Co-occurrence of beta-lactamases with ciprofloxacin resistant determinants in large proportion of isolates is a major threat. Occurrence of MDR S. Kentucky with high level fluoroquinolone resistance mediated by double mutations in gyrA and parC genes in cattle, poultry, and human in the study area suggests clonal spread of this strain and the need for strict pathogen control strategies to hamper further spread of this pathogen. As the majority of the isolates in this study were from healthy animals at the farm level and human patients from primary health care centers, the data presented here may not represent the national status. Further studies on extended spectrum beta-lactamase and fluoroquinolone resistance mechanisms in Salmonella and other gram negative pathogens in hospital and community settings is recommended.

Acknowledgments

We are grateful to Dr Roger Johnson, Linda Cole, Shaun Kernaghan, Ketna Mistry, Ann Perets and Betty Wilkie of the Public Health Agency of Canada, National Microbiology Laboratory at Guelph for serotyping and phagetyping of the Salmonella isolates. Technical assistance of Mr. Nega Nigusie and Mr Haile Alemayehu during sample collection and laboratory isolation is highly appreciated.

Funding

This study was supported by the BecA-ILRI Hub through the Africa Biosciences Challenge Fund (ABCF) program. The ABCF Program is funded by the Australian Department for Foreign Affairs and Trade (DFAT) through the BecA-CSIRO partnership; the Syngenta Foundation for Sustainable Agriculture (SFSA); the Bill & Melinda Gates Foundation (BMGF); the UK Department for International Development (DFID) and; the Swedish International Development Cooperation Agency (Sida). It was also supported by The National Institutes of Health (NIH) Fogarty International Center (grant 043TW008650) to W.A.G./J.S.G.

Availability of data and materials

All the data supporting the findings are presented in the manuscript.

Authors’ contributions

TE, EE, WG, JSG and DA JB and AD, participated in conception of the study and review of the draft manuscript. TE was involved in sample collection laboratory investigation and preparation of the draft manuscript. MN and JN participated in laboratory work. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

Ethical clearance for the study was obtained from the National Research Ethics Review Committee, Ethiopia. Informed oral consent was obtained from the farm owners and patients from health centers and hospital at the time of sample collection.

Abbreviations

bla

Betalactamase gene

CLSI

Clinical and Laboratory Standards Institute

MDR

Multi-drug resistance

NTS

Non-typhoidal Salmonella

PMQR

Plasmid mediated quinolone resistance

QRDR

Quinolone resistance determining region

Contributor Information

Tadesse Eguale, Phone: +251911435759, Email: tadesse.eguale@aau.edu.et.

Josephine Birungi, Email: J.Birungi@cgiar.org.

Daniel Asrat, Email: asratdan@gmail.com.

Moses N. Njahira, Email: mndotono@icipe.org

Joyce Njuguna, Email: j.n.njuguna@cgiar.org.

Wondwossen A. Gebreyes, Email: Gebreys.1@osu.edu

John S. Gunn, Email: John.Gunn@Osumc.edu

Appolinaire Djikeng, Email: a.djikeng@cgiar.org.

Ephrem Engidawork, Email: ephrem.engidawork@aau.edu.et.

References

  • 1.Majowicz SE, Musto J, Scallan E, Angulo FJ, Kirk M, O'Brien SJ, Jones TF, Fazil A, Hoekstra RM, Studies ICoEDBoI The global burden of nontyphoidal Salmonella gastroenteritis. Clin Infect Dis. 2010;50(6):882–9. doi: 10.1086/650733. [DOI] [PubMed] [Google Scholar]
  • 2.DE Knegt LV, Pires SM, Hald T. Attributing foodborne salmonellosis in humans to animal reservoirs in the European Union using a multi-country stochastic model. Epidemiol Infect. 2015;143(6):1175–86. doi: 10.1017/S0950268814001903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Jansen A, Frank C, Stark K. Pork and pork products as a source for human salmonellosis in Germany. Berl Munch Tierarztl Wochenschr. 2007;120(7–8):340–6. [PubMed] [Google Scholar]
  • 4.Braden CR. Salmonella enterica serotype Enteritidis and eggs: a national epidemic in the United States. Clin Infect Dis. 2006;43(4):512–7. doi: 10.1086/505973. [DOI] [PubMed] [Google Scholar]
  • 5.Hohmann EL. Nontyphoidal salmonellosis. Clin Infect Dis. 2001;32(2):263–9. doi: 10.1086/318457. [DOI] [PubMed] [Google Scholar]
  • 6.Wong MH, Yan M, Chan EW, Biao K, Chen S. Emergence of clinical Salmonella enterica serovar Typhimurium isolates with concurrent resistance to ciprofloxacin, ceftriaxone, and azithromycin. Antimicrob Agents Chemother. 2014;58(7):3752–6. doi: 10.1128/AAC.02770-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wadula J, von Gottberg A, Kilner D, de Jong G, Cohen C, Khoosal M, Keddy K, Crewe-Brown H. Nosocomial outbreak of extended-spectrum beta-lactamase-producing Salmonella isangi in pediatric wards. Pediatr Infect Dis J. 2006;25(9):843–4. doi: 10.1097/01.inf.0000233543.78070.a2. [DOI] [PubMed] [Google Scholar]
  • 8.Kruger T, Szabo D, Keddy KH, Deeley K, Marsh JW, Hujer AM, Bonomo RA, Paterson DL. Infections with nontyphoidal Salmonella species producing TEM-63 or a novel TEM enzyme, TEM-131, in South Africa. Antimicrob Agents Chemother. 2004;48(11):4263–70. doi: 10.1128/AAC.48.11.4263-4270.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Olesen I, Hasman H, Aarestrup FM. Prevalence of beta-lactamases among ampicillin-resistant Escherichia coli and Salmonella isolated from food animals in Denmark. Microb Drug Resist. 2004;10(4):334–40. doi: 10.1089/mdr.2004.10.334. [DOI] [PubMed] [Google Scholar]
  • 10.Carattoli A. Animal reservoirs for extended spectrum beta-lactamase producers. Clin Microbiol Infect. 2008;14(Suppl 1):117–23. doi: 10.1111/j.1469-0691.2007.01851.x. [DOI] [PubMed] [Google Scholar]
  • 11.Seiffert SN, Perreten V, Johannes S, Droz S, Bodmer T, Endimiani A. OXA-48 carbapenemase-producing Salmonella enterica serovar Kentucky isolate of sequence type 198 in a patient transferred from Libya to Switzerland. Antimicrob Agents Chemother. 2014;58(4):2446–9. doi: 10.1128/AAC.02417-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Li XZ, Mehrotra M, Ghimire S, Adewoye L. beta-Lactam resistance and beta-lactamases in bacteria of animal origin. Vet Microbiol. 2007;121(3–4):197–214. doi: 10.1016/j.vetmic.2007.01.015. [DOI] [PubMed] [Google Scholar]
  • 13.Whichard JM, Gay K, Stevenson JE, Joyce KJ, Cooper KL, Omondi M, Medalla F, Jacoby GA, Barrett TJ. Human Salmonella and concurrent decreased susceptibility to quinolones and extended-spectrum cephalosporins. Emerg Infect Dis. 2007;13(11):1681–8. doi: 10.3201/eid1311.061438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Redgrave LS, Sutton SB, Webber MA, Piddock LJ. Fluoroquinolone resistance: mechanisms, impact on bacteria, and role in evolutionary success. Trends Microbiol. 2014;22(8):438–45. doi: 10.1016/j.tim.2014.04.007. [DOI] [PubMed] [Google Scholar]
  • 15.Robicsek A, Jacoby GA, Hooper DC. The worldwide emergence of plasmid-mediated quinolone resistance. Lancet Infect Dis. 2006;6(10):629–40. doi: 10.1016/S1473-3099(06)70599-0. [DOI] [PubMed] [Google Scholar]
  • 16.Harrois D, Breurec S, Seck A, Delaune A, Le Hello S, Pardos de la Gandara M, Sontag L, Perrier-Gros-Claude JD, Sire JM, Garin B, et al. Prevalence and characterization of extended-spectrum beta-lactamase-producing clinical Salmonella enterica isolates in Dakar, Senegal, from 1999 to 2009. Clin Microbiol Infect. 2014;20(2):O109–16. doi: 10.1111/1469-0691.12339. [DOI] [PubMed] [Google Scholar]
  • 17.Jacoby GA, Strahilevitz J, Hooper DC. Plasmid-mediated quinolone resistance. Microbiol Spectr. 2014; 2(2). doi: 10.1128/microbiolspec. PLAS-0006-2013. [DOI] [PMC free article] [PubMed]
  • 18.Raveendran R, Wattal C, Sharma A, Oberoi JK, Prasad KJ, Datta S. High level ciprofloxacin resistance in Salmonella enterica isolated from blood. Indian J Med Microbiol. 2008;26(1):50–3. doi: 10.4103/0255-0857.38858. [DOI] [PubMed] [Google Scholar]
  • 19.Lin D, Chen K, Wai-Chi Chan E, Chen S. Increasing prevalence of ciprofloxacin-resistant food-borne Salmonella strains harboring multiple PMQR elements but not target gene mutations. Sci Rep. 2015;5:14754. doi: 10.1038/srep14754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Beyene G, Nair S, Asrat D, Mengistu Y, Engers H, Wain J. Multidrug resistant Salmonella Concord is a major cause of salmonellosis in children in Ethiopia. J Infect Dev Ctries. 2011;5(1):23–33. doi: 10.3855/jidc.906. [DOI] [PubMed] [Google Scholar]
  • 21.Zewdu E, Cornelius P. Antimicrobial resistance pattern of Salmonella serotypes isolated from food items and personnel in Addis Ababa, Ethiopia. Trop Anim Health Prod. 2009;41(2):241–9. doi: 10.1007/s11250-008-9181-y. [DOI] [PubMed] [Google Scholar]
  • 22.Kalender H, Sen S, Hasman H, Hendriksen RS, Aarestrup FM. Antimicrobial susceptibilities, phage types, and molecular characterization of Salmonella enterica serovar Enteritidis from chickens and chicken meat in Turkey. Foodborne Pathog Dis. 2009;6(3):265–71. doi: 10.1089/fpd.2008.9989. [DOI] [PubMed] [Google Scholar]
  • 23.Hendriksen RS, Mikoleit M, Kornschober C, Rickert RL, Duyne SV, Kjelso C, Hasman H, Cormican M, Mevius D, Threlfall J, et al. Emergence of multidrug-resistant salmonella concord infections in Europe and the United States in children adopted from Ethiopia, 2003–2007. Pediatr Infect Dis J. 2009;28(9):814–8. doi: 10.1097/INF.0b013e3181a3aeac. [DOI] [PubMed] [Google Scholar]
  • 24.CLSI. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Third Informational SupplementM100-S23. In., vol. 33; 2013.
  • 25.Grimont P, Weill F-X. Antigenic formulas of Salmonella Serotypes. 9. WHO Collaborating Centre for Reference and Research on Salmonella: France; 2007. [Google Scholar]
  • 26.Pitout JD, Hossain A, Hanson ND. Phenotypic and molecular detection of CTX-M-beta-lactamases produced by Escherichia coli and Klebsiella spp. J Clin Microbiol. 2004;42(12):5715–21. doi: 10.1128/JCM.42.12.5715-5721.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Eguale T, Gebreyes WA, Asrat D, Alemayehu H, Gunn JS, Engidawork E. Non-typhoidal Salmonella serotypes, antimicrobial resistance and co-infection with parasites among patients with diarrhea and other gastrointestinal complaints in Addis Ababa, Ethiopia. BMC Infect Dis. 2015;15:497. doi: 10.1186/s12879-015-1235-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Eguale T, Engidawork E, Gebreyes AW, Asrat D, Alemayehu H, Medhin G, Johnson RP, Gunn JS. Fecal prevalence, serotype distribution and antimicrobial resistance of Salmonellae in dairy cattle in central Ethiopia. BMC Microbiol. 2016;16(1):1–11. doi: 10.1186/s12866-016-0638-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ahmed AM, Shimamoto T. Genetic analysis of multiple antimicrobial resistance in Salmonella isolated from diseased broilers in Egypt. Microbiol Immunol. 2012;56(4):254–61. doi: 10.1111/j.1348-0421.2012.00429.x. [DOI] [PubMed] [Google Scholar]
  • 30.Boisrame-Gastrin S, Tande D, Munck MR, Gouriou S, Nordmann P, Naas T. Salmonella carriage in adopted children from Mali: 2001–08. J Antimicrob Chemother. 2011;66(10):2271–6. doi: 10.1093/jac/dkr307. [DOI] [PubMed] [Google Scholar]
  • 31.Sow AG, Wane AA, Diallo MH, Boye CS, Aidara-Kane A. Genotypic characterization of antibiotic-resistant Salmonella enteritidis isolates in Dakar, Senegal. J Infect Dev Ctries. 2007;1(3):284–8. [PubMed] [Google Scholar]
  • 32.Bonnet R, De Champs C, Sirot D, Chanal C, Labia R, Sirot J. Diversity of TEM mutants in Proteus mirabilis. Antimicrob Agents Chemother. 1999;43(11):2671–7. doi: 10.1128/aac.43.11.2671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Yuan L, Liu JH, Hu GZ, Pan YS, Liu ZM, Mo J, Wei YJ. Molecular characterization of extended-spectrum beta-lactamase-producing Escherichia coli isolates from chickens in Henan Province, China. J Med Microbiol. 2009;58(Pt 11):1449–53. doi: 10.1099/jmm.0.012229-0. [DOI] [PubMed] [Google Scholar]
  • 34.Hendriksen RS, Kjelso C, Torpdahl M, Ethelberg S, Molbak K, Aarestrup FM. Upsurge of infections caused by Salmonella Concord among Ethiopian adoptees in Denmark, 2009. Euro Surveill. 2010;15(23). Available online: http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=19587. [PubMed]
  • 35.Fabre L, Delaune A, Espie E, Nygard K, Pardos M, Polomack L, Guesnier F, Galimand M, Lassen J, Weill FX. Chromosomal integration of the extended-spectrum beta-lactamase gene blaCTX-M-15 in Salmonella enterica serotype Concord isolates from internationally adopted children. Antimicrob Agents Chemother. 2009;53(5):1808–16. doi: 10.1128/AAC.00451-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Fam N, Leflon-Guibout V, Fouad S, Aboul-Fadl L, Marcon E, Desouky D, El-Defrawy I, Abou-Aitta A, Klena J, Nicolas-Chanoine MH. CTX-M-15-producing Escherichia coli clinical isolates in Cairo (Egypt), including isolates of clonal complex ST10 and clones ST131, ST73, and ST405 in both community and hospital settings. Microb Drug Resist. 2011;17(1):67–73. doi: 10.1089/mdr.2010.0063. [DOI] [PubMed] [Google Scholar]
  • 37.Rafai C, Frank T, Manirakiza A, Gaudeuille A, Mbecko JR, Nghario L, Serdouma E, Tekpa B, Garin B, Breurec S. Dissemination of IncF-type plasmids in multiresistant CTX-M-15-producing Enterobacteriaceae isolates from surgical-site infections in Bangui, Central African Republic. BMC Microbiol. 2015;15:15. doi: 10.1186/s12866-015-0348-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Kiiru J, Kariuki S, Goddeeris BM, Butaye P. Analysis of beta-lactamase phenotypes and carriage of selected beta-lactamase genes among Escherichia coli strains obtained from Kenyan patients during an 18-year period. BMC Microbiol. 2012;12:155. doi: 10.1186/1471-2180-12-155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Usha G, Chunderika M, Prashini M, Willem SA, Yusuf ES. Characterization of extended-spectrum beta-lactamases in Salmonella spp. at a tertiary hospital in Durban, South Africa. Diagn Microbiol Infect Dis. 2008;62(1):86–91. doi: 10.1016/j.diagmicrobio.2008.04.014. [DOI] [PubMed] [Google Scholar]
  • 40.Hendriksen RS, Joensen KG, Lukwesa-Musyani C, Kalondaa A, Leekitcharoenphon P, Nakazwe R, Aarestrup FM, Hasman H, Mwansa JC. Extremely drug-resistant Salmonella enterica serovar Senftenberg infections in patients in Zambia. J Clin Microbiol. 2013;51(1):284–6. doi: 10.1128/JCM.02227-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Sun S, Selmer M, Andersson DI. Resistance to beta-lactam antibiotics conferred by point mutations in penicillin-binding proteins PBP3, PBP4 and PBP6 in Salmonella enterica. PLoS One. 2014;9(5) doi: 10.1371/journal.pone.0097202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Delcour AH. Outer membrane permeability and antibiotic resistance. Biochim Biophys Acta. 2009;1794(5):808–16. doi: 10.1016/j.bbapap.2008.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Piddock LJ. Multidrug-resistance efflux pumps - not just for resistance. Nat Rev Microbiol. 2006;4(8):629–36. doi: 10.1038/nrmicro1464. [DOI] [PubMed] [Google Scholar]
  • 44.Jacoby GA. AmpC beta-lactamases. Clin Microbiol Rev. 2009;22(1):161–82. doi: 10.1128/CMR.00036-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Beyene T, Endalamaw D, Tolossa Y, Feyisa A. Evaluation of rational use of veterinary drugs especially antimicrobials and anthelmintics in Bishoftu, Central Ethiopia. BMC Res Notes. 2015;8:482. doi: 10.1186/s13104-015-1466-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Baucheron S, Chaslus-Dancla E, Cloeckaert A, Chiu CH, Butaye P. High-level resistance to fluoroquinolones linked to mutations in gyrA, parC, and parE in Salmonella enterica serovar Schwarzengrund isolates from humans in Taiwan. Antimicrob Agents Chemother. 2005;49(2):862–3. doi: 10.1128/AAC.49.2.862-863.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Zurfluh K, Abgottspon H, Hachler H, Nuesch-Inderbinen M, Stephan R. Quinolone resistance mechanisms among extended-spectrum beta-lactamase (ESBL) producing Escherichia coli isolated from rivers and lakes in Switzerland. PLoS One. 2014;9(4) doi: 10.1371/journal.pone.0095864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Eaves DJ, Randall L, Gray DT, Buckley A, Woodward MJ, White AP, Piddock LJ. Prevalence of mutations within the quinolone resistance-determining region of gyrA, gyrB, parC, and parE and association with antibiotic resistance in quinolone-resistant Salmonella enterica. Antimicrob Agents Chemother. 2004;48(10):4012–5. doi: 10.1128/AAC.48.10.4012-4015.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Lin CC, Chen TH, Wang YC, Chang CC, Hsuan SL, Chang YC, Yeh KS. Analysis of ciprofloxacin-resistant Salmonella strains from swine, chicken, and their carcasses in Taiwan and detection of parC resistance mutations by a mismatch amplification mutation assay PCR. J Food Prot. 2009;72(1):14–20. doi: 10.4315/0362-028X-72.1.14. [DOI] [PubMed] [Google Scholar]
  • 50.Hsueh PR, Teng LJ, Tseng SP, Chang CF, Wan JH, Yan JJ, Lee CM, Chuang YC, Huang WK, Yang D, et al. Ciprofloxacin-resistant Salmonella enterica Typhimurium and Choleraesuis from pigs to humans, Taiwan. Emerg Infect Dis. 2004;10(1):60–8. doi: 10.3201/eid1001.030171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Weill FX, Bertrand S, Guesnier F, Baucheron S, Cloeckaert A, Grimont PA. Ciprofloxacin-resistant Salmonella Kentucky in travelers. Emerg Infect Dis. 2006;12(10):1611–2. doi: 10.3201/eid1210.060589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Le Hello S, Hendriksen RS, Doublet B, Fisher I, Nielsen EM, Whichard JM, Bouchrif B, Fashae K, Granier SA, Jourdan-Da Silva N, et al. International spread of an epidemic population of Salmonella enterica serotype Kentucky ST198 resistant to ciprofloxacin. J Infect Dis. 2011;204(5):675–84. doi: 10.1093/infdis/jir409. [DOI] [PubMed] [Google Scholar]
  • 53.Fabrega A, du Merle L, Le Bouguenec C, Jimenez de Anta MT, Vila J. Repression of invasion genes and decreased invasion in a high-level fluoroquinolone-resistant Salmonella typhimurium mutant. PLoS One. 2009;4(11) doi: 10.1371/journal.pone.0008029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Eguale T, Marshall J, Molla B, Bhatiya A, Gebreyes WA, Engidawork E, Asrat D, Gunn JS. Association of multicellular behaviour and drug resistance in Salmonella enterica serovars isolated from animals and humans in Ethiopia. J Appl Microbiol. 2014;117(4):961–71. doi: 10.1111/jam.12579. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All the data supporting the findings are presented in the manuscript.


Articles from Antimicrobial Resistance and Infection Control are provided here courtesy of BMC

RESOURCES