Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2018 Mar 1.
Published in final edited form as: J Endocrinol. 2016 Dec 15;232(3):377–389. doi: 10.1530/JOE-16-0471

Growth Hormone – A Newly Identified Developmental Organizer

Rajat K Das 1,1, Sarmistha Banerjee 1,1, Bernard H Shapiro 1
PMCID: PMC5241097  NIHMSID: NIHMS837922  PMID: 27980003

Abstract

The sexually dimorphic expression of cytochromes P450 (CYP) drug metabolizing enzymes has been reported in all species examined. These sex differences are only expressed during adulthood and are solely regulated by sex differences in circulating growth hormone (GH) profiles. Once established, however, the different male- and female-dependent CYP isoforms are permanent and immutable, suggesting that adult CYP expression requires imprinting. Since the hormone that regulates an adult function is likely the same hormone that imprints the function, we selectively blocked GH secretion in some newborn male rats while others received concurrent physiologic replacement of rat GH. The results demonstrate that adult male GH activation of the signal transduction pathway regulating expression of the principal CYP2C11 isoform is obligatorily dependent on perinatal GH imprinting, without which CYP2C11 and drug metabolism would be permanently and profoundly suppressed. Since there are other adult metabolic functions also regulated by GH, pediatric drug therapy known to disrupt GH secretion could unintentionally impair adult health.

Keywords: CYP2C11, growth hormone, imprinting, JAK/STAT, miRNA

INTRODUCTION

Hormonal imprinting refers to a biological process in which the target tissue becomes responsive to the hormone. During the initial exposure, the hormone irreversibly reprogrammes the development of the affected tissue so as to permanently alter some functional aspect normally responsive to the hormone and often establishing a sexual dimorphism (Csaba, 2008). Moreover, the tissue is programmable for only a brief developmental period, after which time the tissue becomes permanently unresponsive to imprinting (Shapiro, 1985a; Ohno, 1979; Goldman, 1970; Adler, 1981). Imprinting alone, however, is generally insufficient to ensure expression of the programmed function. Accordingly, expression of the affected function requires both imprinting and activation, the latter being a reversible process, but required to express the imprinted function. For example, perinatal testosterone or one of its metabolites is required to permanently “wire” or imprint the male brain to exclusively express masculine sexual behavior. However, the brain has to be stimulated or activated in adulthood by the same hormone to elicit the imprinted male sexual behavior. Both imprinting and activation are required for normal masculine sexual behavior (Shapiro, 1985a; Adler, 1981; Shapiro et al., 1980), which explains why perinatally castrated males and intact females, not hormonally imprinted, are unable, regardless of adult hormone treatment, to exhibit normal masculine sexual behavior (Adler, 1981; Shapiro et al., 1980).

The cytochromes P450 (CYP) monooxygenases are an ancient family of heme enzymes that catalyze a large variety of essential metabolites, which include the synthesis and the deactivation of adrenal, gonadal, and thyroid hormones, eicosanoids, bile acids, and fatty acids, as well as the detoxification of innumerable drugs and environmental chemicals – hence, their ubiquitous presence throughout all species, where hundreds of isoforms have evolved to catalyze a countless number of substrates (Nebert and Dieter, 2000; Hannemann et al., 2007). In the case of mammals, including humans, the CYPs are most prominent in the liver, where they are expressed during adulthood as dozens of different isoforms, many of which are sexually dimorphic (sex differences in CYP expression occurs postpubertally) (cf. ref. Shapiro et al., 1995). The only endogenous factor known to regulate expression of adult hepatic CYP is growth hormone (GH) (Legraverend et al., 1992; Shapiro et al., 1995). At puberty, males begin to secrete GH in what is referred to as an “episodic” profile characterized by several daily bursts of hormone separated by lengthy undetectable or barely detectable GH concentrations. In contrast, the adult female GH profile is considered “continuous,” as there are far more secretory bursts, often at lower amplitudes, of the hormone separated by briefer interpulse periods, often containing measurable levels of GH. In fact, these sex differences in the circulating GH profile are solely responsible for the sex difference in CYP expression and resulting drug metabolism observed during adulthood (Legraverend et al., 1992; Shapiro et al., 1995). That is, the masculine “episodic” GH profile induces expression of the male-specific CYP isoforms, whereas the feminine “continuous” GH profile induces expression of the female-specific CYP isoforms. In this regard, we previously reported that adult male rats and men cannot be induced (regardless of GH treatment) to express the normal female profile of hepatic CYPs (Dhir et al., 2006; Pampori and Shapiro, 1999; Thangavel et al., 2004; Thangavel and Shapiro, 2008; Thangavel et al., 2011) nor can adult female rats or women be induced to fully express the masculine CYP profile (Dhir et al., 2006; Thangavel et al., 2006; Thangavel and Shapiro, 2007; Dhir et al., 2007). The response of each of the dozen or so sex-dependent rat CYP isoforms to GH regulation has been described (Thangavel and Shapiro, 2008; Banerjee et al., 2014; Das et al., 2013a). If CYP enzymes were not imprinted, then irrespective of sex, the same adult treatment should produce the same CYP expression levels in males and females. Since this is not the case, we have concluded that the sex differences in adult expression profiles of CYPs are permanent and irreversible, a condition demonstrating imprinting. Because an adult tissue/function is apt to be responsive to the same hormone by which it was imprinted, we have proposed, for the first time, that like androgens, perinatal GH is a developmental organizer required for the normal expression of adult CYP-dependent drug metabolism.

MATERIALS AND METHODS

Animal Experimentation

Rats were housed in the University of Pennsylvania Laboratory Animal Resources facility under the supervision of certified laboratory animal medicine veterinarians and were treated according to a research protocol approved by the Institutional Animal Care and Use Committee of the University. Housing conditions, as well as breeding and treatment protocols, were reported previously (Shapiro et al., 1989; Pampori et al., 1991b). Basically, neonatal male rat pups were injected, sc, with either of 2 of 4 possible treatments. 1) Monosodium glutamate (MSG), 4mg/g b wt on alternate days, starting within 24 h of birth for a total of 5 injections. 2) An equivalent amount of the MSG NaCl diluent. 3) Rat growth hormone (GH), 20μg/100g b wt, twice/d for the first 12 days of life. 4) An equivalent amount of the GH bicarbonate diluent. Accordingly, control pups received treatments 2 and 4; MSG pups received treatments 1 and 4; GH pups received treatments 2 and 3; and MSG+GH pups received treatments 1 and 3. Body weights, Lee indices and hexobarbital sleep times were determined as previously reported (Shapiro et al., 1989; Pampori et al., 1991b).

Growth Hormone Determinations

Plasma GH concentrations were determined by a sensitive sandwich ELISA method as described previously (Das et al., 2013a). Procedures for collecting unstressed postnatal plasma as well as adult serial blood sampling for GH determinations have been reported (Pampori et al., 1991a; Banerjee at al., 2015).

Primary Hepatocyte Cultures

Preparation of hepatocytes from 18 week old male rats were performed by in situ perfusion of collagenase through the portal vein of anesthetized rats. The viability of the initial cell suspension of hepatocytes was typically between 80 and 90% with trypan blue). The hepatocytes were plated at a density of 3 × 106 viable cells per well in 6-well plates previously coated with Matrigel. Medium, cell isolation and culture conditions were reported previously (Thangavel et al., 2006; Thangavel and Shapiro, 2007).

Hormonal Conditions

To replicate the masculine episodic GH profile, hepatocytes were exposed to recombinant rat GH (0.2 ng/ml; National Hormone and Peptide Program, Torrance, CA, USA) for 30 min, followed by 2 careful washings with GH-free medium that remained in the wells for 11.5 h, at which time the cells were again washed and exposed to the next 30-min pulse of GH. On the 6th day, cells were harvested 30 min after the addition of the last GH pulse. Following the same treatment schedule, control cells were exposed to the GH vehicle alone (Thangavel et al., 2006; Thangavel and Shapiro, 2007).

Western Blot and Immunoprecipitation

Whole cell lysates and nuclear fractions (Thangavel and Shapiro, 2007; Banerjee et al., 2015) were extracted from freshly isolated preplated hepatocytes as well as cultured primary hepatocytes 30 min after the last GH pulse. Whole cell lysate protein was electrophoresed and electroblotted onto nitrocellulose membranes for immunoblotting. Accordingly, the blots were probed with antibodies against CYP2C11 and anti-suppressors of cytokine signaling (CIS and SOCS2). Nuclear fractions were immune precipitated with signal transducers and activators of transcription 5b (STAT5b) antibodies as described previously (Thangavel and Shapiro, 2007; Banerjee et al., 2015). Next, the immuno-precipitates were probed with anti-phosphotyrosine. The protein signals were scanned and the densitometric units were obtained as integrated density values. Antibodies and their vendors are listed in Table 1.

Table 1.

Source of antibodies.

NAME OF ANTIBODIES SOURCE
CYP2C11 Detroit R&D Inc., Franklin, MI
STAT5b Santa Cruz Biotechnology, Santa Cruz, CA
anti-phosphotyrosine EMD Millipore, Billerica, MA
CIS Santa Cruz Biotechnology, Santa Cruz, CA
SOCS2 Santa Cruz Biotechnology, Santa Cruz, CA
β-actin Sigma Chemical Co., St. Louis, MO
Open in a new tab

Quantitative Real-Time PCR (qRT-PCR)

Cyp2c11, Cis, Socs1, Socs2, Socs3 and cyclophilin A (housekeeping gene) expression were determined by qRT-PCR according to our previously report procedures (Das et al., 2013b; Banerjee et al., 2015). The primer sequences used to measure gene expression are listed in Table 2.

Table 2.

Primer sequences used for qRT-PCR.

mRNA FORWARD (5′_>3′) REVERSE (5′_>3′)
Cis AGCCATGCAGCCCTTAC CTAGCACCTTCGGTTCATTCT
Socs2 TTAAAAGAGGCGCCAGAAGGA GCCCGGCTGATGTCTTAACA
Socs3 CCTCCAGCATCTTTGTCGGAAGAC TACTGGTCCAGGAACTCCCGAATG
cyclophilin A CGACTGTGGACAGCTCTAAT CCTGAGCTACAGAAGGAATG
Open in a new tab

Chromatin Immunoprecipation (ChIP)

A ChIP assay was performed to determine the intensity of STAT5b binding to the Cyp2c11 promoter on cultured hepatocytes 30 min after the last episodic GH pulse on the 6th day in culture as previously described (Thangavel and Shapiro, 2007; Banerjee et al., 2015).

MicroRNA (miRNA)

Due to their possible association with CYP2C11 and GH expression and/or action, we measured expression levels of miRNA-141-3p, miRNA-130a-3p, miRNA-381-3p, and miRNA-29b-3p in freshly isolated hepatocytes as well as cultured hepatocytes exposed to the masculine-like GH profile according to our previous methods (Banerjee et al., 2015). The primers for the miRNAs and procedural controls are presented in Table 3.

Table 3.

Source of miRNA primers1

miRNA SOURCE
miR-141-3p Rn_miR-141_1 miScript Primer Assay
miR-130a-3p Rn_miR-130a_1 miScript Primer Assay
miR-381-3p Rn_miR-381_2 Primer Assay
miR-29b-3p Rn_miR-29b_1 miScript Primer Assay
Reverse transcriptase control Ctrl_miRTC_1 miScript Primer Assay
PCR control Hs_SNORD96A_11 miScript Primer Assay
Open in a new tab
1

From Qiagen Sciences, Frederick, MD.

Statistics

All data were subjected to ANOVA. Significant differences were determined with t statistics and the Bonferroni procedure for multiple comparisons.

RESULTS

Immediate and Long-term Suppression of GH Secretion by Neonatal MSG

In agreement with previous (Kacsoh et al., 1989; Oliver et al., 1982) as well as our own report (Banerjee et al., 2015), plasma GH levels in control groups were maximum the first few postpartum days of life, thereafter declining ~50% by 5 days of age to 75 to 80% from 8 through 15 days of age (Figure 1). GH levels of the MSG-treated neonates at 2 days of age, which was often less than 24h after the first MSG injection, were normal. Thereafter, circulating GH concentrations declined 90 to 95% (postnatal day 2 through 11 days of age), to undetectable (15 days of age). In spite of the administration of exogenous GH during the first 12 days of life, circulating levels of the hormone were the same as controls. This seemingly unexpected finding could be explained by the presence of a functional hypothalamic-pituitary GH feedback loop in which the administered GH suppressed secretion of endogenous hormone (Oliver et al., 1982; Wehrenberg and Giustina, 1992) and/or by the fact that blood collections occurred 12h after the last GH injection at which time the exogenous hormone could have cleared from the circulation (Brownborg et al., 1993). Concomitant administration of MSG and GH resulted in essentially normal-like levels of circulating hormone until the GH was withdrawn, and like the MSG treatment alone, plasma GH concentrations were now undetectable in the pups. (The ~30% above control levels of plasma GH in the 2 day old pups treated with MSG+GH could be due to a combination of the injected hormone and any transient residual GH from the MSG treatment.)

Figure 1. Plasma growth hormone (GH) of male rat pups treated with diluents (CONTROL), MSG and/or GH.

Figure 1

Open in a new tab

Neonatally treated pups were injected with either MSG (4mg/g b wt) or an equivalent dose of diluent on postnatal days 1, 3, 5, 7 and 9; rat GH (20μg/100g b wt) and/or the GH diluent, twice/d for the first 12 days of life. Results are presented as the means ± SD of at least 7 pups/group. *P<0.01 vs CONTROL; †P<0.01 vs MSG treatment alone.

Adult plasma GH profiles are presented as schematic representations of the actual circulating profiles (Figure 2). The control rats secreted the typical adult masculine profile (Jansson et al., 1985a; Agrawal et al., 1995; Shapiro et al., 1995) characterized by episodic pulses containing amplitudes of ~200 ng/ml with durations of ~1h, separated by interpulse periods of 2 to 3h devoid of measurable hormone. In contrast, none of the adult neonatally MSG-treated rats had any measurable plasma GH (>0.125 ng/ml) during the 8 continuous hours of serial sampling. Adult rats, administered GH for the first 12 days of life, secreted the typical masculine episodic GH profile with the exception of pulse amplitudes ~30% (p<0.01) lower than controls. The combined neonatal treatment of MSG and GH resulted in adult GH profiles identical to MSG alone, i.e., no detectable plasma GH.

Figure 2. Adult plasma growth hormone (GH) profiles in growth hormone depleted neonates.

Figure 2

Open in a new tab

Plasma levels of circulating GH were obtained from individual, undisturbed catheterized adult rats neonatally treated with diluents (CONTROL), MSG and/or GH for 8 continuous hours at 15 min intervals. Similar results were obtained from 4 to 5 additional animals in each treatment group. See Figure 1 for details of neonatal treatment.

Neonatal GH Mitigates Neonatal MSG-Induced Adult Obesity

The Lee index is a measure of obesity; the higher the value, the greater the obesity. At all ages measured (5 to 18 weeks of age), the Lee index of the neonatally MSG-treated rats was significantly (p<0.01) greater than age-matched controls (Figure 3A); this is not likely a result of overeating (Olney, 1969), but rather a consequence of thermoregulation of a lower than normal body temperature and a general lethargy (Tokuyama and Himms-Hagen, 1986) preventing normal body weight gain. The Lee indices of the GH-alone treated rats were no different from controls. In spite of the absence of any detectable plasma GH, adult rats neonatally exposed to both MSG and GH exhibited no measurable obesity at 5, 7 and 9 weeks of age; thereafter (11 and 18 weeks of age), their Lee indices were intermediate (p<0.01) between controls and MSG alone, suggesting that the hormone imprints the “obesity set point” attenuating the effects of both neonatal and adult GH depletion observed in MSG-alone treated rats.

Figure 3. Growth hormone (GH) imprinting affects post-weaning maturational Lee index profiles (A) and body weight gains (B).

Figure 3

Open in a new tab

Results are presented as the means ± SD of at least 15 rats/group. CONTROL, MSG and/or GH treatments are described in detail in Figure 1. *P<0.01 vs CONTROL; †P<0.01 vs MSG treatment alone.

In contrast to its effect on obesity, neonatal GH was unable to moderate the inhibitory action of MSG on body weight gain, i.e. an index of general (e.g. musculoskeletal) body growth (Figure 3B). Consequently, adult body weight gain of male rats neonatally treated with either MSG or both MSG and GH were no different, but significantly (p<0.01 at all ages) less than controls which in turn were less than the GH alone treated rats, the latter treatment producing the greatest body weight gain.

Neonatal GH Imprints Adult Responsiveness of Hepatic CYP2C11 to Episodic GH Regulation

Hexobarbital-induced sleep time is an in vivo measure of drug metabolism competence. When given the same dose of hexobarbital per kg of b wt, adult rats neonatally treated with MSG slept 3 times as long as control rats (Figure 4A1), indicating a considerable deficiency in CYP isoforms, particularly CYP2C11 (Ryan and Levin, 1990; Pampori et al., 1991b), which greatly contributes to hexobarbital metabolism, i.e., hydroxylation. Neonatal treatment of MSG and GH resulted in adult sleeping times that were about twice as long as controls but still significantly briefer than the MSG alone treatment, indicating the expression of some level of hexobarbital hydroxylase capacity, e.g., CYP2C11.

Figure 4. Neonatal growth hormone (GH) imprints adult hepatic CYP2C11 expression.

Figure 4

Open in a new tab

(A) CYP2C11-dependent hexobarbital-induced sleeping times in adult rats neonatally administered diluents (CONTROL), MSG and/or GH determined following an ip injection of hexobarbital (150mg/kg b wt). Results are presented as the means ± SD of at least 10 rats/group. *P<0.01 vs CONTROL; †P<0.01 vs MSG treatment alone.

(B1) Relative expression levels (mRNA and protein) of the paramount male-specific CYP2C11 isoform in freshly isolated preplated hepatocytes from adult male rats neonatally administered diluent (CONTROL), MSG and/or GH. Results are presented as a percentage of mRNA or protein in hepatocytes from CONTROL rats arbitrarily designated as 100%. Values are means ± SD of at least 6 rats/data point. *P<0.01 vs CONTROL; †P<0.01 vs MSG treatment alone.

(B2) Hepatocytes from the same rats as (B1) above were exposed to either the episodic male like GH profile or the hormone’s vehicle for 6 days in culture. Results are presented as a percentage of mRNA or protein in hepatocytes exposed to vehicle arbitrarily designated 100%. Values are means ± SD of at least 6 rats/data point. *P<0.01 vs hepatocytes exposed to the episodic vehicle profile from rats of the same neonatal treatment, i.e. CONTROL, MSG, GH or MSG+GH as described in Figure 1.

CYP2C11 is the principal male-dependent form, comprising >50% of the total CYPs in adult male rat liver (Morgan et al., 1985), but undetectable in female liver, explaining its designation as male-specific (Legraverend et al., 1992). [CYP2C11 is expressed only in adulthood and its full expression is solely dependent on the circulating masculine GH profile whose secretion occurs only postpubertally (Legraverend et al., 1992; Shapiro et al., 1995).]

As freshly isolated hepatocytes, CYP levels in vitro reflect in vivo concentrations (Thangavel et al., 2006). Accordingly, expression of episodic GH-dependent CYP2C11 was profoundly reduced in freshly isolated hepatocytes from GH-devoid, neonatally MSG-treated adult male rats (Figure 4B1). In contrast, neonatal administration of both MSG and GH resulted in substantial expression levels of CYP2C11 (~40% of control values) in spite of the same total absence of circulating GH as observed in the MSG-treated rats. In this regard, a minimal baseline level of the hepatic CYP2C11 (~20 to 40% of normal) can be expressed in the absence of GH, whereas full induction of the isoform requires exposure to the masculine episodic GH profile (Waxman et al., 1991; Agrawal and Shapiro, 2000). Consequently, these findings indicate that neonatal GH programmes developmental mechanisms responsible for expression of GH-independent, baseline CYP2C11 expression. Neonatal GH-treatment alone, however, had no effect on in vivo-like adult expression of CYP2C11.

After 6d of exposure to the male-like episodic GH profile, CYP2C11 expression levels in the primary heptaocytes derived from control rats doubled above vehicle-treated baseline concentrations (Figure 4B2). The inability of the masculine GH profile to induce CYP2C11 expression in hepatocytes from MSG-alone treated males indicates an irreversible repression of the enzyme. In contrast, hepatocytes derived from adult males neonatally treated with both MSG and GH responded to the episodic GH profile with a ≥2.5-fold increase in CYP2C11 expression. The only differences between the MSG-alone group and the MSG plus GH group was the presence in the latter of GH during the critical postnatal developmental period demonstrating the imprinting action of neonatal GH on adult function. Recall, both groups were lacking GH during their immature, peripubertal, and adult lives. (The difference between CYP2C11 induction levels in the control and the combined MSG and GH treatment group is not as dramatic as it appears. Induction levels are based on vehicle exposure levels designated 100% in all groups. In fact, vehicle treatment of levels of CYP2C11 in the combined MSG and GH group were considerably lower (~35%) than that in the control group resulting in a calculated higher GH induction level in the combined treatment group.)

Neonatal GH Irreversibly Imprints the STAT5b Signal Transduction Pathway Mediating Episodic GH Induction of CYP2C11

The terminal transducer in the signaling transduction pathway mediating episodic GH induction of CYP2C11 is STAT5b. This transcription factor must be activated (i.e., phosphorylated), homodimerized and translocated to the nucleus, where it binds to a promoter site initiating transcription of the Cyp2c11 gene (Waxman and Frank, 2000). Primary hepatocytes were cultured in the presence of the masculine episodic GH profile or episodic GH vehicle alone for 6 days. The cells were harvested 30 min after the last GH pulse; an optimal time to measure the STAT5b response (Verma et al., 2005). In agreement with the transduction requirements of GH-induced transcription of CYP2C11, the concentration of activated nuclear phospho STAT5b (pSTAT5b) increased 2-fold in episodic GH-exposed hepatocytes from control rats, whereas the same horomone treatment produced a 20 to 25% decline in nuclear levels of pSTAT5b in adult hepatocytes from neonatal MSG-alone treated rats (Figure 5). In contrast, exposure of adult hepatocytes from the combined neonatal MSG and GH treatment to episodic GH resulted in a 2-fold increase in nuclear pSTAT5b concentrations, similar to control hepatocytes. Neonatal GH treatment alone, however, resulted in only ~50% increase in the nuclear translocation of pSTAT5b reflecting the lower induced levels of CYP2C11 (Figure 4B2).

Figure 5. Neonatal growth hormone (GH) imprints adult growth hormone regulation of STAT5b activation, nuclear translocation and binding to the CYP2C11 promoter.

Figure 5

Open in a new tab

(Left Panel) Nuclear levels of activated STAT5b (pSTAT5b) in cultured primary hepatocytes exposed to either the episodic male-like GH profile or the episodic profile containing GH vehicle alone for 6 days. Results are presented as a percentage of nuclear pSTAT5b in hepatocytes exposed to vehicle arbitrarily designated as 100%. Values are means ± SD of at least 6 rats/data point. *P<0.01 vs hepatocytes exposed to the episodic vehicle GH profile from rats of the same neonatal treatment, i.e. CONTROL, MSG, GH or MSG+GH as described in Figure 1.

(Right Panel) Representative ChIP blots (2 of 5/group) demonstrating episodic GH regulation (♂GH) described above, of pSTAT5b binding to the Cyp2c11 promoter in hepatocytes derived from adult male rats neonatally treated with either diluents (CONTROL), MSG, GH or MSG+GH as described in Figure 1.

The binding of pSTAT5b to the Cyp2c11 promoter was evaluated in adult hepatocytes from the various neonatal treatments by ChIP assays (Figure 5, right). In agreement with the expected sequence of signaling events, robust binding of pSTAT5b to the promoter occurred in control hepatocytes exposed to the masculine–like GH profile. In contrast, none of the episodic GH-treated hepatocytes from the MSG-treated rats exhibited detectable binding of the activated transcription factor to the Cyp2c11 promoter. Hepatocytes from the combined neonatal treatment (MSG+GH) were found to display pSTAT5b promoter binding levels similar to that of hepatocytes from control male rats. Lastly, the density of the pSTAT5b bands in the ChIP assays in hepatocytes from the GH-alone treated rats were somewhat lower than that of bands from control and combined MSG and GH-treated rats, indicating reduced binding, in agreement with the hepatocytes’ lower levels of both nuclear pSTAT5b and CYP2C11 expression.

Developmental GH Irreversibly Imprints Expression of the SOCS Family of Inhibitory Proteins Mediating GH Action

The SOCS family of inhibitory proteins are negative regulators of GH signaling. Their actions are particularly important in regulating the effects of episodic GH on such male-dependent parameters as growth, musculoskeletal metabolism and CYP expression (Karlsson et al., 1999; Waxman and Frank, 2000). Consequently, we decided to examine the long term effects of neonatal GH on both the in vivo-like levels and in vitro responsiveness of four of the most commonly referenced SOCS, i.e. CIS, SOCS1, SOCS2 and SOCS3 (Figure 6). Neonatal GH ablation (i.e. MSG treatment) had little effect on both the in vivo and in vitro adult expression of hepatic SOCS3 (Figure 6D1 & 2) which may explain our earlier report demonstrating the ineffectiveness of the masculine episodic GH profile to regulate SOCS3 expression (Thangavel and Shapiro, 2007). In contrast, the absence of circulating GH in adulthood of both the MSG and MSG+GH neonatal treatment groups resulted in lower CIS, SOCS2 and SOCS1 in vivo expression levels, most dramatically at the transcription level (Figure 6A1, B1, C1), a possible result of altered ubiquitination levels shown to be regulated by GH (Banerjee et al., 2013). These SOCS proteins are known to be induced by the episodic GH profile, but only in males, and not in females even when females are renaturalized with the male-dependent profile suggesting irreversible sex-dependent imprinting (Thangavel and Shapiro, 2007).

Figure 6. Neonatal growth hormone (GH) imprints adult growth hormone regulation of CIS/SOCSs expression.

Figure 6

Open in a new tab

(A1, B1, C1, D1) Levels of 4 members of the CIS/SOCS family (i.e. CIS, SOCS2, SOCS1 and SOCS3) were measured in freshly isolated preplated hepatocytes from adult male rats neonatally administered diluents (CONTROL), MSG, GH or MSG+GH as described and statistically analyzed in Figure 1.

(A2, B2, C2, D2) Concentrations of the same CIS/SOCS family members in hepatocytes from the same rats (A1, B1, C1, D1) were exposed to either the episodic male-like GH profile or the hormone vehicle for 6 days in culture. Results are presented and statistically analyzed as described in Figure 4-B2.

Hepatocytes from the control treatment group exposed to the male-like GH profile responded with a 2 to 3-fold increase in CIS, SOCS2 and SOCS1 expression levels (Figure 6A2, B2, C2). In contrast, the SOCS expression levels in adult hepatocytes from the MSG-alone treatment group were actually suppressed by the episodic GH profile whereas cells from the combined MSG and GH neonatal treatment responded the same as controls to the masculine-like GH profile. As with other measured parameters, hepatocytes derived from GH alone treated rats exhibited a muted response of CIS, SOCS2 and SOCS1 to the episodic GH profile.

GH Imprinting is Associated with Permanent Alterations in miRNA Expression

miRNAs are naturally occurring small, single-stranded non-coding RNA molecules involved in post-transcriptional control of gene expression. In animals, miRNAs imperfectly hybridize, through partial sequence homology, to the 3′-UTR of target mRNAs causing a block in translation and/or increased mRNA degradation (Bartel, 2009). Prediction of miRNA target mRNA was carried out by our use of the algorithms miRanda (John et al., 2004) and TargetScan (Lewis et al., 2003). Four miRNAs were identified by in silico analyses with high predictability to interfere with the expression and/or action of CYP2C11 and/or GH. Three of the miRNAs (miR-29b-3p, miR-130a-3p and miR-381-3p) exhibited a dramatic ≥3-fold overexpression in freshly isolated hepatocytes from GH-devoid MSG and MSG plus GH-treated rats (Figures A1, B1, C1). Since these 3 miRNAs have high predictability pairing scores for such relevant mRNAs as Cyp2c11, Socs2 and Igf1 (Figure 7D) known to be regulated by the masculine GH profile, their overexpression is in agreement with the subnormal in vivo expression levels of CYP2C11 (Figure 4B1), SOCS2 (Figure 6B1) and IGF1 (Pampori and Shapiro, 1996) in episodic GH-ablated male rats. Furthermore, the 3 miRNAs were found to be completely unresponsive to the in vitro administration of the episodic GH profile in heptatocytes from all treatment groups neonatally exposed to GH, i.e. controls, GH alone and MSG + GH (Figures 7A2, B2, C2). Only hepatocytes derived form the MSG-alone treatment responded to the episodic GH profile with a significant reduction in miR-29b-3p and miR130a-3p concentrations, now similar to all the other treatment groups indicating that neonatal GH imprints the 3 miRNAs to be unresponsive to episodic GH regulation. [miRNA-141-3p, an in silico predicted blocker of STAT5b expression, was unaffected, statistically, by all the neonatal treatments (not presented).]

Figure 7. Adult expression of 3 rat-specific hepatic microRNAs (miR) neonatally imprinted by growth hormone (GH).

Figure 7

Open in a new tab

(A1, B1, C1) Levels of 3 microRNAs (rno-miR-29b-3p, rno-miR-381a-3p, rno-miR-130a-3p) were measured in freshly isolated preplated hepatocytes from adult male rats neonatally administered diluents (CONTROL), MSG, GH or MSG+GH as described and statistically analyzed in Figure 1.

(A2, B2, C2) Levels of the same hepatic microRNAs from the same rats (A1, B1, C1) were exposed to either the episodic male-like GH profile or the hormone vehicle for 6 days in culture. Results are presented and statistically analyzed as described in Figure 4-B2.

(D) Sequence of the 3 microRNAs and their complementary sites in the 3′-UTR of CYP2C11, SOCS2 and IGF1.

DISCUSSION

Since an endocrine responsive tissue appears to be imprinted/programmed by the same hormone that regulates its adult function (Shapiro and Goldman, 1979; Csaba, 2008), it seemed reasonable to assume that the expression of adult hepatic CYPs by GH is accordingly imprinted by GH. To investigate the specific requirement for perinatal GH in the imprinting process, we blocked postpartum GH secretion in newborn male rats using MSG, a selective disrupter of developing hypothalamic GH releasing hormone nuclei (Bakke et al., 1978; Dada et al., 1984) while having no direct effect on liver differentiation (Kaufhold et al., 2002). In addition, some of the MSG treated neonates simultaneously received replacement rat GH during the “critical developmental period”. We also included two control groups; vehicle alone or GH alone. Plasma GH levels were normal in both control groups during the first two weeks of life, whereas neonatal MSG virtually eliminated circulating GH after the first injection, and as designed, concurrent GH replacement maintained generally normal postnatal levels of the hormone. However, as soon as exogenous GH was withdrawn, plasma concentrations of the hormone declined to undetectable as observed in the MSG alone group. As adults, males from both control groups secreted the typical masculine GH profile (Pampori et al., 1991b; Agrawal and Shapiro, 2000) characterized by episodic pulses of ~1h duration separated by interpulses of 2 to 3 h containing undetectable concentrations of the hormone. The one exception being that the pulse amplitudes were somewhat lower in the GH alone group. Since the GH releasing hormone hypothalamic nuclei were permanently destroyed in the neonates by MSG, both MSG groups, with and without concurrent neonatal GH replacement, secreted no measurable levels of GH as adults. Nevertheless, and in spite of the same complete lack of circulating GH, the two MSG treatment groups expressed very different peripubertal and adult functions of what would normally be GH–dependent activities. That is, adults from the MSG alone treatment group were profoundly obese, exhibited a 3-fold longer hexobarbital-induced sleep time than controls and a concomitant near complete deficiency in hexobarbital hydroxylase-dependent CYP2C11. In contrast and irrespective of the same absence of plasma GH, adult males neonatally treated with both MSG and GH exhibited only a late onset mild obesity, a prolonged hexobarbital-induced sleep time that was still ~30% shorter than that resulting from the MSG alone treatment and CYP2C11 expression levels (mRNA and protein) representing ~40% of controls. Evidently, even though there was no circulating GH after 12d of age in the MSG+GH treatment group, the neonatal replacement GH alone appears to have programmed a permanent imprint that attenuated the abnormalities associated with congenital-like GH deficiency as characterized by the MSG alone treatment. The present findings identifying the effects of GH imprinting are analogous to those of the model developmental organizer/imprinter androgen. During the perinatal period when the brain is nonsexual and still differentiating, testicular androgens or one of their metabolites programme/imprint neural pathways required to fully express numerous masculine functions, such as gonadotropin secretory profiles, taste preferences and sexual behavior, when subsequently exposed to adult androgens (Adler, 1981; Shapiro, 1985a). Without hormonal imprinting, however, these masculine neural pathways are never established and/or are permanently refractory to androgens and their dependent masculine functions can never be expressed, regardless of adult hormone treatment. In this regard, it seemed more than reasonable to assume that androgens also masculinize (i.e., imprint) hepatic sex-dependent CYP isoforms, as neonatal orchidectomy had been reported to demasculinize drug metabolism (i.e., CYP isoforms). However, the permanence or irreversibility of the imprinting was either never tested by administering testosterone to neotnatal castrates as adults (Chung and Chao, 1980; Waxman et al., 1985) or, in fact, the defects produced by neonatal castration were found to be completely corrected when treated with the androgen as adults (Gustafsson and Stenberg, 1974; Jansson et al., 1985b; Dannan et al., 1986; Bandiera and Dworschak, 1992). [Androgens, including testosterone, have no direct effect on hepatic CYP expression, but rather can act at the hypothalamic-pituitary axis to regulate the sexually dimorphic secretion of GH, which, in turn, regulates sex-dependent CYPs (Kramer et al., 1979; Shaprio, 1985b; Jansson et al., 1985a).] If the effects of neonatal orchidectomy on CYP expression can be completely corrected (i.e., reversible), by definition, and despite the researchers’ conclusions, androgens do not imprint the sexually dimorphic expression of CYP isoforms. Moreover, our observation that neonatal MSG has no inhibitory effects on circulating testosterone levels during the first 15 days of life, inclusive of the critical period of hypothalamic-pituitary-hepatic axis differentiation (Das et al., 2014), is further support that perinatal androgens are not imprinters of CYP sexual dimorphisms. Rather, our results indicate that just as the brain of the adult not imprinted by androgens is permanently incapable of responding to androgens with a display of masculine behaviors, the liver of the adult male rat not imprinted by GH is permanently incapable of responding to episodic GH induction of the predominant CYP2C11 isoform. Consequently, hepatocytes derived from adult males not imprinted by neonatal GH (MSG only treatment) were completely unresponsive to episodic GH induction of CYP2C11 expression. In contrast, when the same neonatal treatment was supplemented with rat GH, the adult hepatocytes were fully responsive to the episodic GH profile exhibiting a ~2.5-fold induction of CYP2C11 establishing perinatal GH as a requisite developmental organizer or imprinter.

What, then, are the defects in the GH-inductive response of CYP2C11 in adult rats neonatally treated with MSG? That is, why cannot the hepatocytes respond to GH? In this regard, GH signaling in liver by the episodic profile (in contrast to the continuous profile) is initiated by hormone binding to and the resulting activation of GH receptor (GHR) on the surface of the target cells. This allows for the recruitment and/or activation of two molecules of Janus kinase 2 (JAK2), which then cross-phosphorylate each other, as well as phosphorylating the receptor on key tyrosine residues. STAT5b, a latent transcription factor, binds to these phosphorylated receptor docking sites and is, in turn, phosphorylated and homodimerizes and translocates to the nucleus, where it binds to promoter sites initiating transcription of GH-regulated genes. An important negative regulatory mechanism of GH signaling, the SOCS family of inhibitory proteins, which, depending on the protein, inhibit GH signaling by inactivating JAK2, by competing with STAT5b for common tyrosine-binding sites on the intracellular tail of the GHR, and/or by a proteasome-dependent mechanism that results in the degradation of the (GH-GHR-JAK2)• SOCS complex (Waxman and Frank, 2000; LeRoith and Nissley, 2005; Landsman and Waxman, 2005). At least 4 possible components in this signal transduction pathway were permanently altered by neonatal MSG. The response to episodic GH of hepatocytes from control rats (vehicle-treated more so than GH alone; the latter suggesting that too much of a hormone, just like too little, can have deleterious effects) increased cellular CIS, SOCS1 and SOCS2, as well as nuclear pSTAT5b, by 2- to 3-fold, whereas these transducers in hepatocytes from the MSG-treated rats were completely unresponsive to the masculine GH profile. Not only did developmental exposure to MSG permanently suppress STAT5b activation (i.e. phosphorylation) and nuclear translocation, but it completely blocked the binding of the transcription factor to the Cyp2c11 promoter, explaining the inability of the masculine GH profile to induce CYP2C11 expression. In contrast, when MSG-treated pups were briefly injected with rat GH, induction levels of cellular CIS, SOCS1 and SOCS2 as well as nuclear translocation levels of pSTAT5b and its subsequent binding to the Cyp2c11 promoter were statistically the same as vehicle controls demonstrating the successful imprinting of the developing liver by neonatal GH alone. The possible involvement of miRNAs in the suppression of adult CYP2C11 by neonatal MSG was also examined. We used multiple in silico prediction tools and identified complimentary sequence homology sites in downstream GH activated genes, including Cyp2c11 and Socs2. Three of the miRNAs, miR-29b, miR-130a and miR-381, were several fold overexpressed only in the adult GH-devoid, MSG-treated males in agreement with a report that miR-29b is suppressed by GH treatment (Cheung et al., 2009). Although it isn’t clear just what role, if any, the miRNAs play in GH imprinting, it is apparent from our findings that all three miRNAs are permanently refractory to GH regulation in only those animals neonatally imprinted by GH (i.e., vehicle alone, GH alone and MSG+GH). Since miRNA studies are a nascent area of biological investigation, any conclusion that one of the purposes of GH imprinting is to permanently limit the inhibitory effects of miRNA on adult GH induction of CYP2C11 and other GH-dependent genes may seem reasonable (Banerjee et al., 2015), but remains speculative.

Clearly, then, neonatal exposure to MSG irreversibly suppresses GH activation of CYP2C11 dependent signal transduction at multiple steps. Whether the multiple defects in the signaling pathway are all independently induced or rather the result of an initial upstream defect (i.e. GHR) cascading dysfunctions down the signaling pathway is under investigation. In summary, our findings demonstrate for the first time that perinatal GH imprints a latently expressed programme, which is then subsequently responsive to GH during adulthood. The imprinting is obligatory and occurs during a critical developmental period, whereas the imprinted programme is only expressed in adulthood. Since there is a myriad of metabolic functions in humans, including growth rates and lean body mass (e.g., note our Lee index findings); cardiovascular, bone, adipose, and muscle physiology; protein, carbohydrate, lipid and electrolyte metabolism all regulated, at least in part, by GH, and like CYP expression, exhibit permanent sexual dimorphisms (cf. ref. Thangavel and Shapiro, 2007), it may be that these adult functions also require perinatal GH imprinting and could be vulnerable to pediatric drug therapy known to inadvertently disrupt GH secretion.

The cartoon depicts the latently expressed imprinting role of neonatal growth hormone on the developing liver by irreversibly programming the responsive signal transduction pathway (JAK/STAT) mediating adult episodic growth hormone induction of the principal CYP2C11 isoform.

Acknowledgments

FUNDING

This work was supported by the U.S. National Institutes of Health, Eunice Kennedy Shriver National Institute of Child Health and Human Development (grant HD-061285).

We thank Ms. Sarah Rauers for proofreading the manuscript.

Footnotes

DECLARATION OF INTEREST

The authors declare no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

References

  1. Agrawal AK, Pampori NA, Shapiro BH. Neonatal phenobarbital-induced defects in age- and sex-specific growth hormone profiles regulating monooxygenases. American Journal of Physiology. 1995;268:E439–445. doi: 10.1152/ajpendo.1995.268.3.E439. [DOI] [PubMed] [Google Scholar]
  2. Agrawal AK, Shapiro BH. Differential expression of gender-dependent hepatic isoforms of cytochrome P-450 by pulse signals in the circulating masculine episodic growth hormone profile of the rat. Journal of Pharmacology and Experimental Therapeutics. 2000;292:228–237. [PubMed] [Google Scholar]
  3. Bakke JL, Lawrence N, Bennett J, Robinson S, Bowers CY. Late endocrine effects of administering monosodium glutamate to neonatal rats. Neuroendocrinology. 1978;26:220–228. doi: 10.1159/000122829. [DOI] [PubMed] [Google Scholar]
  4. Bandiera S, Dworschak C. Effects of testosterone and estrogen on hepatic levels of cytochromes P450 2C7 and P450 2C11 in the rat. Archives of Biochemistry and Biophysics. 1992;296:286–295. doi: 10.1016/0003-9861(92)90574-g. [DOI] [PubMed] [Google Scholar]
  5. Banerjee S, Das RK, Shapiro BH. Growth hormone-independent suppression of growth hormone-dependent female isoforms of cytochrome P450 by the somatostatin analog ocreotide. European Journal of Pharmacology. 2013;715:256–261. doi: 10.1016/j.ejphar.2013.05.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Banerjee S, Das RK, Giffear KA, Shapiro BH. Permanent uncoupling of male-specific CYP2C11 transcription/translation by perinatal glutamate. Toxicology and Applied Pharmacology. 2016;284:79–91. doi: 10.1016/j.taap.2015.02.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bartel D. MicroRNAs: target recognition and regulatory functions. Cell. 2009;136:215–233. doi: 10.1016/j.cell.2009.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Brownborg HM, Klemcke HG, Borg KE, Klindt J. Prolactin and growth-hormone clearance in neonatal boars. Journal of Animal Science. 1993;71:2055–2060. doi: 10.2527/1993.7182055x. [DOI] [PubMed] [Google Scholar]
  9. Cheung L, Gustavsson C, Norstedt G, Tollet-Egnell P. Sex-different and growth hormone-regulated expression of microRNA in rat liver. BMC Molecular Biology. 2009;10:13. doi: 10.1186/1471-2199-10-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chung LWK, Chao H. Neonatal imprinting and hepatic cytochrome P-450. I. Comparison of testosterone hydroxylation in a reconstituted system between neonatally imprinted and nonimprinted rats. Molecular Pharmacology. 1980;18:543–549. [PubMed] [Google Scholar]
  11. Csaba G. Hormonal imprinting: phylogeny, ontogeny, diseases and possible role in present-day human evolution. Cell Biochemistry and Function. 2008;26:1–10. doi: 10.1002/cbf.1412. [DOI] [PubMed] [Google Scholar]
  12. Dada MO, Campbell GT, Blake CA. Effects of neonatal administration of monosodium glutamate on somatotrophs and growth hormone secretion in prepubertal male and female rats. Endocrinology. 1984;115:996–1003. doi: 10.1210/endo-115-3-996. [DOI] [PubMed] [Google Scholar]
  13. Dannan GA, Guengerich FB, Waxman DJ. Hormonal regulation of rat liver microsomal enzymes. Role of gonadal steroids in programming, maintenance, and suppression of Δ4-steroid 5α-reductase, flavin-containing monooxygenase, and sex-specific cytochromes P-450. Journal of Biological Chemistry. 1986;261:10728–10735. [PubMed] [Google Scholar]
  14. Das RK, Banerjee S, Shapiro BH. Noncanonical suppression of GH-dependent isoforms of cytochrome P450 by the somatostatin analog octreotide. Journal of Endocrinology. 2013a;216:87–97. doi: 10.1530/JOE-12-0255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Das RK, Banerjee S, Shapiro BH. Extensive sex- and/or hormone-dependent expression of rat housekeeping genes. Endocrine Research. 2013b;38:105–111. doi: 10.3109/07435800.2012.723294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Das RK, Banerjee S, Shapiro BH. Irreversible perinatal imprinting of adult expression of the principal sex-dependent drug metabolizing enzyme CYP2C11. FASEB Journal. 2014;28:4111–4122. doi: 10.1096/fj.13-248864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Dhir RN, Dworakowski W, Thangavel C, Shapiro BH. Sexually dimorphic regulation of hepatic isoforms of human cytochrome p450 by growth hormone. Journal of Pharmacology and Experimental Therapeutics. 2006;316:87–94. doi: 10.1124/jpet.105.093773. [DOI] [PubMed] [Google Scholar]
  18. Dhir RN, Thangavel C, Shapiro BH. Attenuated expression of episodic growth hormone-induced CYP2C11 in female rats associated with suboptimal activation of the Jak2/Stat5B and other modulating signaling pathways. Drug Metabolism and Disposition. 2007;35:2102–2110. doi: 10.1124/dmd.107.017475. [DOI] [PubMed] [Google Scholar]
  19. Feder NH. Perinatal hormones and their role in the development of sexually dimorphic behaviors. In: Adler NT, editor. Neuroendocrinology of Reproduction, Physiology and Behavior. New York: Plenum Press; 1981. pp. 127–158. [Google Scholar]
  20. Goldman AS. Animal models of inborn errors of steroidogenesis and steroid action. Hoppe-Seyler’s Zeitschrift fur physiologische Chemie. 1981;351:426–436. [Google Scholar]
  21. Gustafsson JA, Stenberg A. Masculinization of rat liver enzyme activities following hypophysectomy. Endocrinology. 1974;95:891–896. doi: 10.1210/endo-95-3-891. [DOI] [PubMed] [Google Scholar]
  22. Hannemann F, Bichet A, Ewen KM, Bernhardt R. Cytochrome P450 systems-biological variations of electron transport chains. Biochimica et Biophysica Acta. 2007;1770:330–344. doi: 10.1016/j.bbagen.2006.07.017. [DOI] [PubMed] [Google Scholar]
  23. Jansson JO, Eden S, Isaksson O. Sexual dimorphism in the control of growth hormone secretion. Endocrine Reviews. 1985a;6:128–150. doi: 10.1210/edrv-6-2-128. [DOI] [PubMed] [Google Scholar]
  24. Jansson JO, Ekberg S, Isaksson O, Mode A, Gustafsson JA. Imprinting of growth hormone secretion, body growth, and hepatic steroid metabolism by neonatal testosterone. Endocrinology. 1985b;117:1881–1889. doi: 10.1210/endo-117-5-1881. [DOI] [PubMed] [Google Scholar]
  25. John B, Enright AJ, Aravin A, Tuschl T, Sander C, Marks DS. Human microRNA targets. PLoS Biology. 2004;2:1862–1879. doi: 10.1371/journal.pbio.0020363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kacsoh B, Terry LC, Meyers JS, Crowley WR, Grosvenor CE. Maternal modulation of growth hormone secretion in the neonatal rat. I. Involvement of milk factors. Endocrinology. 1989;125:1326–1336. doi: 10.1210/endo-125-3-1326. [DOI] [PubMed] [Google Scholar]
  27. Karlsson H, Gustafsson JA, Mode A. Cis desensitizes GH induced Stat5 signaling in rat liver cells. Molecular and Cellular Endocrinology. 1999;154:37–43. doi: 10.1016/s0303-7207(99)00101-x. [DOI] [PubMed] [Google Scholar]
  28. Kaufhold A, Nigam PK, Dhir RN, Shapiro BH. Prevention of latently expressed CYP2C11, CYP3A2, and growth hormone defects in neonatally monosodium glutamate-treated male rats by the N-methyl-D-aspartate receptor antagonist dizocilpine maleate. Journal of Pharmacology and Experimental Therapeutics. 2002;302:490–496. doi: 10.1124/jpet.102.034785. [DOI] [PubMed] [Google Scholar]
  29. Kramer RE, Greiner JW, Rumbaugh RC, Sweeney TD, Colby HD. Requirement of the pituitary gland for gonadal hormone effects on hepatic drug metabolism in rats. Journal of Pharmacology and Experimental Therapeutics. 1979;208:19–23. [PubMed] [Google Scholar]
  30. Landsman T, Waxman DJ. Role of the cytokine-induced SH2 domain-containing protein CIS in growth hormone receptor internalization. Journal of Biological Chemistry. 2005;280:37471–37480. doi: 10.1074/jbc.M504125200. [DOI] [PubMed] [Google Scholar]
  31. Legraverend C, Mode A, Wells T, Robinson I, Gustafsson JA. Hepatic steroid hydroxylating enzymes are controlled by the sexually dimorphic pattern of growth hormone secretion in normal and dwarf rats. FASEB Journal. 1992;6:711–718. doi: 10.1096/fasebj.6.2.1537461. [DOI] [PubMed] [Google Scholar]
  32. Leroith D, Nissley P. Knock your SOCS off! Journal of Clinical Investigation. 2005;115:233–236. doi: 10.1172/JCI24228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Lewis BP, Shih IH, Jones-Rhoades MW, Bartel DP, Burge CB. Prediction of mammalian microRNA targets. Cell. 2003;115:787–798. doi: 10.1016/s0092-8674(03)01018-3. [DOI] [PubMed] [Google Scholar]
  34. Morgan ET, MacGeoch C, Gustafsson JA. Hormonal and developmental regulation of expression of the hepatic microsomal steroid 16 alpha-hydroxylase cytochrome P-450 apoprotein in the rat. Journal of Biological Chemistry. 1985;260:11895–11898. [PubMed] [Google Scholar]
  35. Nebert DW, Dieter MZ. The evolution of drug metabolism. Pharmacology. 2000;61:124–135. doi: 10.1159/000028393. [DOI] [PubMed] [Google Scholar]
  36. Ohno S. Major Sex-Determining Genes. Berlin: Springer-Verlag; 1979. [Google Scholar]
  37. Oliver C, Giraud P, Lissitzky JC, Cote J, Boudouresque F, Gillioz P, Conte-Devolx B. Influence of endogenous somatostatin on growth hormone and thyrotropin secretion in neonatal rats. Endocrinology. 1982;110:1018–1022. doi: 10.1210/endo-110-3-1018. [DOI] [PubMed] [Google Scholar]
  38. Olney JW. Brain lesions, obesity and other disturbances in mice treated with monosodium glutamate. Science. 1969;164:719–721. doi: 10.1126/science.164.3880.719. [DOI] [PubMed] [Google Scholar]
  39. Pampori NA, Agrawal AK, Shapiro BH. Renaturalizating the sexually dimorphic profiles of circulating growth hormone in hypophysectomized rats. Acta Endocrinology (Copenhagen) 1999;124:283–289. doi: 10.1530/acta.0.1240283. [DOI] [PubMed] [Google Scholar]
  40. Pampori NA, Agrawal AK, Waxman DJ, Shapiro BH. Differential effects of neonatally administered glutamate on the ultradian pattern of circulating growth hormone regulating expression of sex-dependent forms of cytochrome P450. Biochemical Pharmacology. 1991;41:1299–1309. doi: 10.1016/0006-2952(91)90101-a. [DOI] [PubMed] [Google Scholar]
  41. Pampori NA, Shapiro BH. Gender differences in the responsiveness of the sex-dependent isoforms of hepatic P450 to the feminine plasma growth hormone profile. Endocrinology. 1999;140:1245–1254. doi: 10.1210/endo.140.3.6545. [DOI] [PubMed] [Google Scholar]
  42. Ryan DE, Levin W. Purification and characterization of hepatic microsomal cytochrome P-450. Pharmacology and Therapeutics. 1990;45:153–239. doi: 10.1016/0163-7258(90)90029-2. [DOI] [PubMed] [Google Scholar]
  43. Shapiro BH. A paradox in development: masculinization of the brain without androgen receptors. Progress in Clinical and Biological Research. 1985a;171:151–173. [PubMed] [Google Scholar]
  44. Shapiro BH. Pituitary-dependent masculinization of hepatic hexobarbital hydroxylase in Crl: CD-1(ICR)BR mice. Life Sciences. 1985b;36:1169–1174. doi: 10.1016/0024-3205(85)90234-6. [DOI] [PubMed] [Google Scholar]
  45. Shapiro BH, Agrawal AK, Pampori NA. Gender differences in drug metabolism regulated by growth hormone. International Journal of Biochemistry and Cellular Biology. 1995;27:9–20. doi: 10.1016/1357-2725(94)00056-5. [DOI] [PubMed] [Google Scholar]
  46. Shapiro BH, Goldman AS. New thoughts on sexual differentiation of the brain. In: Porter IH, Vallet HL, editors. Genetic Mechanisms of Sexual Development. New York, NY: Academic Press; 1979. pp. 221–252. [Google Scholar]
  47. Shapiro BH, Levine DC, Adler NT. The testicular feminized rat: a naturally occurring model of androgen independent brain masculinization. Science. 1980;209:418–420. doi: 10.1126/science.7384816. [DOI] [PubMed] [Google Scholar]
  48. Shapiro BH, MacLeod JN, Pampori NA, Morrissey JJ, Lapenson DP, Waxman DJ. Signalling elements in the ultradian rhythm of circulating growth hormone regulating expression of sex-dependent forms of hepatic cytochrome P450. Endocrinology. 1989;125:2935–2944. doi: 10.1210/endo-125-6-2935. [DOI] [PubMed] [Google Scholar]
  49. Thangavel C, Boopathi E, Shapiro BH. Intrinsic sexually dimorphic expression of the principal human CYP3A4 correlated with suboptimal activation of GH/glucocorticoid-dependent transcriptional pathways in men. Endocrinology. 2011;152:4813–4824. doi: 10.1210/en.2011-1274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Thangavel C, Dworakowski W, Shapiro BH. Inducibility of male-specific isoforms of cytochrome p450 by sex-dependent growth hormone profiles in hepatocyte cultures from male but not female rats. Drug Metabolism and Disposition. 2006;34:410–419. doi: 10.1124/dmd.105.007716. [DOI] [PubMed] [Google Scholar]
  51. Thangavel C, Garcia MC, Shapiro BH. Intrinsic sex differences determine expression of growth hormone-regulated female cytochrome P450s. Molecular and Cellular Endocrinology. 2004;220:31–39. doi: 10.1016/j.mce.2004.04.002. [DOI] [PubMed] [Google Scholar]
  52. Thangavel C, Shapiro BH. A molecular basis for the sexually dimorphic response to growth hormone. Endocrinology. 2007;148:2894–2903. doi: 10.1210/en.2006-1333. [DOI] [PubMed] [Google Scholar]
  53. Thangavel C, Shapiro BH. Inherent sexually dimorphic expression of hepatic CYP2C12 correlated with repressed activation of growth hormone-regulated signal transduction in male rats. Drug Metabolism and Disposition. 2008;36:1884–1895. doi: 10.1124/dmd.108.021451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Tokuyama K, Himms-Hagen J. Brown adipose tissue thermogenesis, torpor, and obesity of glutamate-treated mice. American Journal of Physiology. 1986;250:E409–415. doi: 10.1152/ajpendo.1986.251.4.E407. [DOI] [PubMed] [Google Scholar]
  55. Verma AS, Dhir RN, Shapiro BH. Inadequacy of the Janus kinase 2/signal transducer and activator of transcription signal transduction pathway to mediate episodic growth hormone-dependent regulation of hepatic CYP2C11. Molecular Pharmacology. 2005;67:891–901. doi: 10.1124/mol.104.005454. [DOI] [PubMed] [Google Scholar]
  56. Waxman DJ, Dannan GA, Guengerich FB. Regulation of rat hepatic cytochrome P-450: age dependent expression, hormonal imprinting, and xenobiotic inducibility of sex-specific isoenzymes. Biochemistry. 1985;24:4409–4417. doi: 10.1021/bi00337a023. [DOI] [PubMed] [Google Scholar]
  57. Waxman DJ, Frank SJ. Growth hormone action: signaling via a JAK-STAT-coupled receptor. In: Conn MP, Means AR, editors. Principles of Molecular Regulation. Totowa, NJ: Humana Press; 2000. pp. 55–83. [Google Scholar]
  58. Waxman DJ, Pampori NA, Ram PA, Agrawal AK, Shapiro BH. Interpulse interval in circulating growth hormone patterns regulates sexually dimorphic expression of hepatic cytochrome P450. Proceedings of the National Academy of Sciences USA. 1991;88:6868–6872. doi: 10.1073/pnas.88.15.6868. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Wehrenberg WB, Giustina A. Basic counterpoint: mechanisms and pathways of gonadal steroid modulation of growth hormone secretion. Endocrine Reviews. 1992;13:299–308. doi: 10.1210/edrv-13-2-299. [DOI] [PubMed] [Google Scholar]

RESOURCES