Skip to main content
eLife logoLink to eLife
. 2017 Jan 17;6:e22540. doi: 10.7554/eLife.22540

MAPK signaling promotes axonal degeneration by speeding the turnover of the axonal maintenance factor NMNAT2

Lauren J Walker 1, Daniel W Summers 2, Yo Sasaki 2, EJ Brace 1, Jeffrey Milbrandt 2,3, Aaron DiAntonio 1,3,*
Editor: Carol A Mason4
PMCID: PMC5241118  PMID: 28095293

Abstract

Injury-induced (Wallerian) axonal degeneration is regulated via the opposing actions of pro-degenerative factors such as SARM1 and a MAPK signal and pro-survival factors, the most important of which is the NAD+ biosynthetic enzyme NMNAT2 that inhibits activation of the SARM1 pathway. Here we investigate the mechanism by which MAPK signaling facilitates axonal degeneration. We show that MAPK signaling promotes the turnover of the axonal survival factor NMNAT2 in cultured mammalian neurons as well as the Drosophila ortholog dNMNAT in motoneurons. The increased levels of NMNAT2 are required for the axonal protection caused by loss of MAPK signaling. Regulation of NMNAT2 by MAPK signaling does not require SARM1, and so cannot be downstream of SARM1. Hence, pro-degenerative MAPK signaling functions upstream of SARM1 by limiting the levels of the essential axonal survival factor NMNAT2 to promote injury-dependent SARM1 activation. These findings are consistent with a linear molecular pathway for the axonal degeneration program.

DOI: http://dx.doi.org/10.7554/eLife.22540.001

Research Organism: D. melanogaster, Mouse

Introduction

Axon loss is a hallmark of many neurological disorders. Developing methods to maintain axons and preserve neural circuit integrity following injury or disease will require a mechanistic understanding of the axonal degeneration program (Conforti et al., 2014). Injury-induced axonal degeneration is a regulated process of subcellular self-destruction that is controlled by the counteracting functions of axon survival and axon degenerative proteins. Over the past few years, essential survival and degenerative proteins have been identified (Gerdts et al., 2016). Now the key challenge is to delineate the relationship among these factors. Here we study this interplay, and present a unified model that incorporates major axon survival and degenerative proteins into a linear pathway.

Axon survival factors inhibit axon degeneration after injury. Overexpression of these factors delays or prevents injury-dependent axon degeneration, and loss of these factors accelerates or induces axon degeneration. NMNAT2, an NAD+ biosynthetic enzyme, is an essential axon survival factor whose loss is sufficient to trigger axon degeneration (Gilley and Coleman, 2010). NMNAT2 has a very short half-life, and maintenance of NMNAT2 in the axon requires continuous anterograde transport. Axonal injury blocks axon transport, causing local NMNAT2 levels to fall and axon degeneration to initiate. Factors that slow the degradation of NMNAT2 profoundly delay axon degeneration after injury (Babetto et al., 2013; Milde et al., 2013a, 2013b; Xiong et al., 2012). SCG10, a microtubule regulating protein also known as Stathmin 2, is a less potent axonal survival factor whose loss speeds degeneration after injury but does not trigger degeneration in the absence of injury (Shin et al., 2012). Like NMNAT2, SCG10 is a labile protein that is delivered to the axon via anterograde transport, and slowing its degradation protects axons (Shin et al., 2012).

Axon degeneration factors promote degeneration and consequently loss-of-function mutants in these factors slow or block axon degeneration after injury. The MAP3K dual leucine-zipper kinase (DLK) and its downstream MAPK JNK were the first axon degeneration factors identified (Miller et al., 2009). This MAPK pathway was thought to play an ancillary role in the axonal degeneration program (Wang et al., 2012) because loss of DLK only leads to a modest slowing of degeneration. Recently Yang and colleagues found redundancy at each level of the MAPK cascade, showing that loss of all of the relevant triple, double, or single kinases leads to a long-lasting block in axonal degeneration, and hence demonstrating that MAPK signaling is essential to promote local axon degeneration (Yang et al., 2015). SARM1 is another essential axon degeneration factor, and likely functions as the central executioner of the degenerative cascade. Loss of SARM1 protects axons after sciatic nerve injury, traumatic brain injury, or treatment with the chemotherapeutic drug vincristine in vivo in mouse (Geisler et al., 2016; Gerdts et al., 2013; Henninger et al., 2016; Osterloh et al., 2012) and activated versions of SARM1 are sufficient to trigger axon degeneration (Gerdts et al., 2013, 2015; Yang et al., 2015).

Four recent studies have identified mechanistic links among these axon survival and degeneration programs. Two studies suggest that loss of NMNAT2 is a likely trigger for SARM1 activation. Genetic analysis shows that knockdown of NMNAT2 in cultured neurons triggers SARM1-dependent axon degeneration, and the embryonic lethality of NMNAT2 knockout mice is fully rescued by the simultaneous loss of SARM1 (Gilley et al., 2015). Biochemical studies demonstrate that expression of NMNAT enzymes blocks axon degeneration, not by increasing NAD+ synthesis, but rather by blocking SARM1-dependent NAD+ depletion (Sasaki et al., 2016). These results support the model that loss of NMNAT2 activates SARM1 to induce degeneration. How does activated SARM1 cause axon loss? SARM1 is a TIR-domain containing protein, and dimerization of the SARM1-TIR domain is sufficient to trigger axon degeneration (Gerdts et al., 2015; Yang et al., 2015). Using this system, Gerdts et al. demonstrated that activated SARM1 triggers the rapid degradation of NAD+ and the subsequent loss of ATP, inducing a metabolic catastrophe and axon loss (Gerdts et al., 2015). Yang et al. showed that dimerizing the SARM1-TIR domains activates MAPK signaling, that injury induces a SARM1-dependent activation of the MAPK signaling pathway, and that MAPK signaling is required for ATP loss after injury (Yang et al., 2015). Hence activated SARM1 can induce both NAD+ depletion and MAPK activation, but the relationship between these two activities is unknown.

We hypothesized that SARM1-dependent MAPK signaling was either a cause or consequence of NAD+ depletion, so we investigated the relationship among SARM1 activation, MAPK activation, NAD+ depletion, and axon degeneration. We find that MAPK signaling is required for injury-dependent NAD+ depletion and axonal degeneration, but surprisingly not for NAD+ depletion or axon degeneration induced by activated SARM1. This suggests that MAPK signaling could function upstream of SARM1 to promote injury-dependent activation of SARM1. We previously demonstrated that MAPK signaling promotes the turnover of the axon survival factor SCG10 (Shin et al., 2012), and so hypothesized that MAPK signaling also promotes the turnover of the major axon survival factor NMNAT2. Here we show that inhibition of MAPK signaling slows the turnover of both NMNAT2 and SCG10, leading to increased levels of both survival factors. Moreover, the axon protection afforded by inhibiting MAPK signaling requires elevated levels of NMNAT2. This revises our understanding of how MAPK signaling promotes axon degeneration, placing MAPK signaling upstream of axon survival factor turnover and SARM1 activation. Our new findings unify major axon survival and degeneration proteins into a single, linear pathway.

Results

MKK4/7 are necessary for NAD+ loss and axon degeneration after axotomy but not in response to constitutively active SARM1

A linear MAPK signaling pathway is required for axon degeneration. This pathway includes the MAPKKKs DLK, MLK2, and MEKK4, the MAPKKs MKK4 and MKK7 (with MKK4 dominant), and the MAPKs JNK1-3. Within this pathway, the MAPKKs MKK4 and MKK7 represent a targetable bottleneck in which loss of these kinases abrogates the MAPK signaling necessary for axon degeneration (Yang et al., 2015). Lentiviral transduction of previously validated shRNAs targeting the MAPKKs MKK4 and MKK7 into mouse dorsal root ganglia neurons effectively down regulates the levels of MKK4 and MKK7 protein and confers robust axon protection after axotomy when used in tandem (Figure 3—figure supplement 1). Thus, by simultaneously knocking down MKK4 and MKK7 (hereafter abbreviated as MKK4/7 or sh4/7), we can interrogate the mechanism by which the MAPK pathway promotes axon degeneration.

Axon injury triggers a number of SARM1-dependent local molecular changes within the axon, including NAD+ depletion and MAPK activation (Gerdts et al., 2015; Yang et al., 2015). We hypothesized that there could be a linear relationship between NAD+ depletion and MAPK activation such that MAPK signaling is required for NAD+ depletion or, conversely, that NAD+ depletion is the trigger for MAPK activation. To investigate the relationship between MAPK signaling and NAD+ depletion, we assessed whether MAPK signaling is necessary for NAD+ depletion within axons after axotomy. At two and four hours after axotomy, a time when axons remain morphologically intact, axonal NAD+ has decreased to 71% and 7% of baseline levels and is undetectable at six hours after axotomy in neurons expressing a control shRNA that targets luciferase. Strikingly, NAD+ is maintained at 45% of baseline levels six hours after axotomy in the absence of MKK4/7 (Figure 1A; p≤0.001), revealing that MAPK signaling is upstream of axotomy-induced NAD+ depletion. ATP depletion is another consequence of axon injury that requires MAPK signaling (Yang et al., 2015). ATP levels are also maintained six hours after axotomy when MKK4/7 are knocked down (Figure 1B; p≤0.05). These data indicate that MKK4/7 are important for NAD+ and ATP depletion after axotomy.

Figure 1. MKK4/7 are necessary for NAD+ and ATP loss after axotomy but not in response to constitutively active SARM1.

Figure 1.

MKK4/7 are necessary for NAD+ and ATP depletion in axons following axotomy but not following direct SARM1 activation. Axonal NAD+ (A) and ATP (B) levels were assayed at indicated timepoints after axotomy with lentiviral knockdown of MKK4 and MKK7 (sh4/7, grey bars) or Luciferase (ctrl, black bars) control. There is no change in the rate of NAD+ (C) or ATP (D) depletion after direct activation of SARM1 via dimerization of the SARM1-TIR domains in the absence of injury when MKK4/7 are depleted compared to controls. The compound AP20187 was used to induce SARM1-TIR dimerization. Values are presented as mean ± SEM. All measurements were normalized to time zero. N = 6; p values: *≤ 0.05, **≤ 0.01, ***≤ 0.001, ****≤ 0.0001 by ANOVA.

DOI: http://dx.doi.org/10.7554/eLife.22540.002

We previously demonstrated that SARM1 is required for NAD+ and ATP depletion after axotomy (Gerdts et al., 2015). Hence, the finding that MKK4/7 are important for axotomy-induced NAD+ and ATP depletion is consistent with MAPK signaling either (a) acting downstream of SARM1 as an intermediate between SARM1 activation and NAD+ and ATP loss, or (b) functioning upstream of SARM1 to promote injury-dependent SARM1 activation. To distinguish between these possibilities, we assessed whether MKK4/7 activity is necessary for NAD+ depletion induced by a constitutively active form of SARM1 that bypasses the need for injury-dependent SARM1 activation. To generate an activated form of SARM1, we used a pharmacologically controlled system in which the SARM1-TIR domain fused to FKBP is homodimerized upon application of the small molecule AP20187 (Gerdts et al., 2015; Yang et al., 2015). Dimerization of the SARM1-TIR domains induces loss of NAD+ within two hours, similar to the two hour window in which most NAD+ is lost following axotomy (Figure 1A). Surprisingly, knockdown of MKK4/7 does not change the rate of NAD+ depletion after SARM1-TIR dimerization (Figure 1C). ATP is also depleted, albeit more slowly than NAD+, when SARM1-TIR domains are dimerized. As with NAD+, inhibition of MKK4/7 does not change the rate of ATP depletion induced by SARM1-TIR dimerization (Figure 1D). We find similar results when analyzing axonal NAD+ following SARM1-TIR dimerization (SARM1-TIR dimerization, % NAD+ depletion at 2 hr: control 54.9% ± 4.2% vs shMKK4/7 54.9% ± 4.0%, ns, p=0.99). Hence, MAPK signaling is not an intermediate between activated SARM1 and NAD+ depletion. Taken together with the finding that MKK4/7 are required for injury-dependent NAD+ and ATP depletion, these results are consistent with the model that MAPK signaling functions upstream of SARM1 to promote injury-dependent SARM1 activation.

These findings made us reassess the model that MAPK signaling functions downstream of SARM1 in the axon degeneration pathway. The strongest functional evidence for a role for MAPKs downstream of SARM1 in the axon destruction program is the finding that depletion of MKK4/7 partially blocks axon degeneration induced by direct dimerization of the SARM1-TIR domains (Yang et al., 2015). We reassessed this finding by simultaneously testing whether MAPKs are required for axon degeneration induced by either axotomy or dimerized SARM1-TIR. In control cultures both axotomy and dimerized SARM1-TIR induce robust axon degeneration. In contrast, depletion of MKK4/7 prevents axon degeneration for at least 24 hr after axotomy; however, in parallel experiments performed in the same dish, depletion of MKK4/7 fails to block axon degeneration induced by dimerization of the SARM1-TIR domains (Figure 2A–B). JNK inhibition also fails to block axon degeneration induced by dimerization of the SARM1-TIR domains (Figure 2C). These results are consistent with the findings in Figure 1 demonstrating that MAPK signaling is required for NAD+ depletion following injury but not direct dimerization of SARM1-TIR. While we cannot replicate the finding that the MAPK pathway is required for SARM1-TIR induced axon degeneration, we do observe activation of MKK4 following SARM1-TIR dimerization (Figure 2—figure supplement 1) as reported by Yang et al. Hence, we agree that activated SARM1 can induce the MAPK stress pathway, but we find no functional evidence that this a significant modulator of NAD+ depletion or axon loss. While we cannot explain why our findings differ from those of Yang et al., we suggest that epistasis experiments performed with engineered constructs such as the dimerized SARM1-TIR should be interpreted with care. As such, we chose to investigate the mechanism by which MAPK signaling promotes axotomy-induced axon degeneration. As is shown below, we identify a mechanism by which MAPK signaling acts upstream of endogenous SARM1 to inhibit axon degeneration, and this mechanism is fully consistent with the findings presented here with the dimerized SARM1-TIR.

Figure 2. MAPKs are required for injury-induced but not SARM1-TIR-induced axon degeneration.

(A) Depletion of MKK4/7 (sh4/7) protects axons for 24 hours after axotomy but not when axon degeneration is induced by dimerization of the SARM1-TIR domains with addition of the ligand AP20187 (n = 4). Knockdown of MKK4/7 is compared to controls (ctrl) expressing an shRNA targeting luciferase (B) Quantification of degeneration index (DI). (C) Treatment with JNK inhibitor VIII delays axon degeneration 24 hours after axotomy but not when axon degeneration is induced by dimerization of the SARM1-TIR domains with addition of the ligand AP20187 as compared to DMSO vehicle control (n = 3). The data for each histogram are derived from neurons that were cultured in the same dish with treatments (i.e. axotomy or TIR-dimerization) performed in parallel. p value: ***≤ 0.001 and ****≤ 0.0001 by ANOVA; non-significant (ns). Values are presented as mean ± SEM. See also Figure 2—figure supplement 1.

DOI: http://dx.doi.org/10.7554/eLife.22540.003

Figure 2.

Figure 2—figure supplement 1. Dimerization of the SARM1-TIR domains with the ligand AP20187 results in MKK4 phosphorylation on Ser257/Thr261.

Figure 2—figure supplement 1.

Lystate from DRGs was collected at the indicated timepoints after addition of AP20187.

MKK4/7 regulates the levels of axon survival factors NMNAT2 and SCG10

The mechanism of injury-dependent SARM1 activation is unknown, however one prominent model is that the axonal survival factor NMNAT2 delivered from the cell body inhibits SARM1 activation in healthy axons (Gilley et al., 2015). We previously demonstrated that JNK promotes the turnover of a second axonal survival factor, the microtubule regulating protein SCG10, whose overexpression can also delay axon degeneration, albeit much less potently than NMNAT2 (Shin et al., 2012). This lead us to test the hypothesis that MAPK signaling might have a broader role in controlling the stability of axonal maintenance factors. We tested if MAPKs promote turnover of survival factors by assessing whether depletion of MKK4/7 leads to an increase in the levels of NMNAT2 and SCG10 protein. We first compared levels of NMNAT2 and SCG10 in the presence or absence of MKK4/7 under basal conditions. We find that levels of endogenous NMNAT2 and SCG10 are elevated in neurons upon MKK4/7 knockdown (Figure 3A and quantified in 3F; NMNAT2 3.2 ± 0.5 fold increase, SCG10 5.4 ± 1 fold increase). We observe a similar increase in the levels of NMNAT2 and SCG10 when we knockdown MKK4 with a second shRNA, and when we target MKK4 using the Cas9/CRISPR system (Figure 3—figure supplement 1B). Axon degeneration is regulated locally; therefore, we asked if MKK4/7 regulates axon survival factors within axons. Levels of endogenous NMNAT2 and SCG10 are elevated within axon-only lysate after depletion of MKK4/7 (Figure 3B; Nmnat2 3.5 ± 0.8 fold increase, SCG10 4.3 ± 1.3 fold increase). Similar results were observed following treatment with the JNK inhibitor VIII, where levels of NMNAT2 and SCG10 are boosted within two hours of JNK inhibition (Figure 3C). This finding indicates that MKK4/7 function through the canonical JNK pathway to deplete NMNAT2 and SCG10.

Figure 3. MKK4/7 regulates the levels of axon survival factors NMNAT2 and SCG10.

Loss of MKK4/7 (sh4/7) increases levels of endogenous NMNAT2 and SCG10 within cultured DRG neurons (A) and axons (B) as observed via western blot as compared to shLuciferase (ctrl) controls (n = 3). Vertical line in westerns blots denotes where lanes were removed; however, samples were run on the same gel and images are from the same exposure. We confirm that MKK4/7 functions through the canonical JNK pathway, as timecourse treatment with JNK inhibitor (JNKi) VIII (10 uM, 0–12 hr treatment; n = 4) increases endogenous NMNAT2 and SCG10 within neurons within two hours. (C) MKK4/7 regulate levels of exogenously-expressed NMNAT2-myc and endogenous SCG10 (D) as observed by immunostaining within uninjured DRG axons, indicating the modulation is post-transcriptional. The anti-Tuj1 antibody stains tubulin and labels all axons. Scale bar: 25 µm, n = 4 (E) Western blot from embryonic DRG neurons reveals that knockdown of MKK4/7 leads to an increase in the levels of endogenous NMNAT2 and SCG10 in both wildtype (WT) and SARM1 knockout (SARM1 KO) neurons. (F) Quantification of endogenous NMNAT2 and SCG10 in WT and SARM1 knockout neurons with depletion of MKK4/7 by shRNA. Data were normalized to protein levels with shLuciferase controls (not significant, n = 3). Also refer to Figure 3—figure supplement 1.

DOI: http://dx.doi.org/10.7554/eLife.22540.005

Figure 3.

Figure 3—figure supplement 1. Depletion of MAPKs elevates survival factors and protects axons.

Figure 3—figure supplement 1.

(A) Validation of specificity of shMKK4-2 and shMKK7 used in this study. All samples were run on the same gel. Vertical line indicates lanes cropped out of blot. (B) Western blot from embryonic DRGs derived from a Cas9 knock-in mouse demonstrating that depletion of MKK4 using two independent shRNAs or pooled guide RNAs (gRNA) can deplete MKK4 and modulate expression of NMNAT2 and SCG10. The shRNA used in this study to knockdown MKK4 was shMKK4-2. (C) Depletion of MKK4/7 protects axons 24 hr after injury compared to shLuciferase (ctrl) controls. Values represent the Degeneration Index, with higher DI values representing axon degeneration. Values are presented as mean ± SEM. ****p≤0.0001, **p≤0.01, n = 3–6. (D) Western blot from axon-only lysate demonstrating MKK4/7 regulate exogenously-expressed NMNAT2-myc. The NMNAT2-myc construct is expressed from the ubiquitin C promoter instead of the endogenous NMNAT2 promoter, suggesting that MAPK-dependent regulation of NMNAT2 is post-transcriptional. Samples were blotted with an anti-myc antibody (n = 3).

We analyzed SCG10 and NMNAT2 expression by immunocytochemistry as an independent test of whether these survival factors are elevated within axons. While there is an excellent antibody for SCG10 (Shin et al., 2012), our antibody for endogenous NMNAT2 works for Westerns but not immunocytochemistry. Hence we expressed myc-tagged NMNAT2 (NMNAT2-myc) in DRG neurons from the ubiquitin C promoter. Upon MKK4/7 knockdown, both NMNAT2-myc and SCG10 are elevated within axons (Figure 3D; p≤0.001, n = 7–9). Moreover, the upregulation of NMNAT2-myc expressed from an exogenous promoter indicates that MKK4/7 regulates NMNAT2 post-transcriptionally, consistent with the hypothesis that they regulate protein turnover (Figure 3—figure supplement 1D).

Having demonstrated that MAPKs regulate levels of NMNAT2 in vitro in mammalian neurons, we next assessed whether this regulation is evolutionarily conserved and occurs in vivo. The JNK ortholog Basket (Bsk) promotes axon degeneration of motoneurons in Drosophila larvae—expression of a dominant negative JNK transgene or depletion of JNK using RNAi delays axon degeneration after nerve pinch injury (Figure 4—figure supplement 1, Xiong and Collins, 2012). Thus, we asked if JNK can also regulate levels of the only NMNAT isoform in Drosophila, dNmnat. We expressed HA-dNmnat in motoneurons using OK6-Gal4 and assessed levels of tagged dNmnat by immunostaining. We find that expression of HA-dNmnat is elevated within larval nerves when MAPK activity is inhibited (Figure 4; JNK dominant negative 2.8 ± 0.2 fold higher; JNK RNAi 2.2 ± 0.2 fold higher than controls). These results demonstrate that MAPKs regulate NMNAT in vivo, and that this MAPK-dependent regulation is evolutionarily conserved.

Figure 4. MAPKs modulate dNMNAT in vivo in Drosophila larvae.

Immunostaining in third instar Drosophila larvae of HA-dNMNAT (green) expressed in nerves from the motorneuron driver OK6-Gal4, with HRP labeling (red) to counterstain the nerve. (A) Expression of JNK dominant negative (DN) or depletion of JNK with RNAi (BL57035) increases levels of HA-dNMNAT in the nerve in vivo. (B) Quantification of fluorescence intensity of HA-dNMNAT normalized to wildtype (WT) controls. N = 8–10 animals. p values: ***≤ 0.001, ****≤ 0.0001 by ANOVA. Also refer to Figure 4—figure supplement 1.

DOI: http://dx.doi.org/10.7554/eLife.22540.007

Figure 4.

Figure 4—figure supplement 1. Depletion of JNK with RNAi or expression of JNK dominant negative (DN) protects Drosophila larval axons 24 hr after pinch injury.

Figure 4—figure supplement 1.

(A) Representative images of injured axons. Usually two single axons within the nerve are labeled with GFP driven by m12-GAL4. Total nerve is labeled with HRP. (B) Quantification of axon degeneration, with 100 being complete fragmentation and 0 being an intact axon. Values are presented as mean ± SEM. N = 7–12 nerves. **p≤0.01, *p≤0.05.

MKK4/7 function upstream of SARM1 for NAD+ depletion (Figure 1), however there are strong data that SARM1 and its orthologs can function upstream of MAPK signals (Figure 2—figure supplement 1; Blum et al., 2012; Chen et al., 2011; Chuang and Bargmann, 2005; Kurz et al., 2007; Yang et al., 2015). Hence, we tested whether the MKK4/7-dependent regulation of axonal survival factors occurs downstream of SARM1. If MKK4/7 function downstream of SARM1, then we predict that loss of SARM1 should phenocopy the loss of MKK4/7 and lead to an increase in the levels of NMNAT2 and SCG10. However, levels of NMNAT2 and SCG10 are comparable in wild type and SARM1 knockout neurons (Figure 3E–F; not significant, n = 3; Gilley et al., 2015). If SARM1 were upstream of MKK4/7, then we would further predict that MKK4/7 regulation of survival factors would require SARM1. To test this prediction, we knocked down MKK4/7 in both wild type and SARM1 knockout neurons and measured the levels of NMNAT2 and SCG10. We find that MKK4/7 regulate these axon survival factors even in the absence of SARM1, as levels of NMNAT2 and SCG10 are elevated upon knockdown of MKK4/7 in both wild type and SARM1 knockout neurons (Figure 3E–F; in SARM1 knockout with shMKK4/7, NMNAT2 3.9 ± 0.7 fold increase, SCG10 6.6 ± 1.4 fold increase compared to shRNA controls; not significant comparing genotypes). Thus, MAPK regulation of axon survival factors is independent of SARM1. Since elevated levels of NMNAT2 inhibits SARM1-dependent axon degeneration, these findings are consistent with the model that MAPK signaling functions upstream of SARM1.

MKK4/7 promote turnover of axon survival factors

Survival factors function locally within the axon after injury. Thus, we asked whether inhibition of MKK4/7 maintains elevated levels of NMNAT2 and SCG10 within the axon in the first hours after injury, when the axon commits to degenerate. We axotomized cultured DRG neurons and stained for myc-tagged NMNAT2 and endogenous SCG10. By four hours after axotomy, NMNAT2 is depleted and endogenous SCG10 is undetectable in distal axons from control neurons. However, four hours after axotomy NMNAT2 and SCG10 are maintained within distal axons from MKK4/7 knockdown neurons (Figure 5A). Indeed, axonal levels of NMNAT2 and SCG10 are comparable at four hours post-axotomy from MKK4/7 knockdown neurons to the levels in uninjured axons from wild type neurons (for NMNAT2-myc, fluorescence intensity four hours after injury for shMKK4/7 is 1.2 ± 0.2 fold (p>0.05) of the levels measured in uninjured control axons; for SCG10, fluorescence intensity four hours after injury for shMKK4/7 is 1.1 ± 0.2 fold (p>0.05) of the levels measured in uninjured control axons (p>0.05), n = 7–9). The four hour time-point is significant, as this is approximately the time at which axons irreversibly commit to degenerate after injury in vitro (Gerdts et al., 2016). Hence, knockdown of MKK4/7 maintains axon survival factors at the time and place they are needed to inhibit the axon degeneration program.

Figure 5. MKK4/7 promote turnover of axon survival factors.

(A) Immunostaining for NMNAT2-myc and SCG10 in distal axons four hours after axotomy. Fluorescence signal is diminished four hours after cut in control axons; however, with depletion of MKK4/7 (sh4/7) levels of NMNAT2-myc and SCG10 are maintained after injury compared to shLuciferase (ctrl) control (p≤0.01 for NMNAT2-myc and p≤0.001 for SCG10, comparing fluorescence between conditions at four hours, n = 4). Scale bar: 25 µm (B) rtPCR reveals no significant change in transcript levels for NMNAT2 or SCG10 after depletion of MKK4/7 when normalized to shLuciferase controls. N = 3, p=0.29. (C) Western blot analysis from axon-only lysate from DRG cultures treated with cycloheximide (CHX) for the indicated timepoints to block protein synthesis. Quantification from CHX timecourse experiments for fraction of NMNAT2 (D) and SCG10 (E) as compared to time zero. The turnover rate of both NMNAT2 and SCG10 is slowed upon MKK4/7 knockdown. N = 4; p values: **≤ 0.01, ***≤ 0.001. Also refer to Figure 5—figure supplements 1 and 2.

DOI: http://dx.doi.org/10.7554/eLife.22540.009

Figure 5.

Figure 5—figure supplement 1. Pre-treatment with JNKi VIII (30 min) delays degradation of NMNAT2 and SCG10 after cycloheximide (CHX).

Figure 5—figure supplement 1.

Western blot analysis from axon-only lysate from DRG cultures treated with CHX for the indicated timepoints to block protein synthesis to show turnover of endogenous NMNAT2 (A) and SCG10 (B). TUJ1 is a loading control. Quantification from CHX timecourse experiments for fraction of NMNAT2 (C) and SCG10 (D) as compared to time zero. The turnover rate of both NMNAT2 and SCG10 is slowed upon treatment with JNKi VIII compared to vehicle (DMSO) controls. N = 4; P values: * ≤ 0.05, ** ≤ 0.01.
Figure 5—figure supplement 2. Elevation of NMNAT2 and SCG10 does not delay turnover of survival factors within axons.

Figure 5—figure supplement 2.

Representative western blots from axon-only lysate from DRG cultures treated with cycloheximide (CHX) for the indicated timepoints, showing turnover of endogenous NMNAT2 (A) and endogenous SCG10 (B). (C) Representative western blot from axon-only lysate from DRG cultures that were uninfected (left lane; endogenous) or overexpressing both NMNAT2-myc and wildtype SCG10 and treated with CHX. NMNAT2-myc and SCG10 were expressed at levels 5- to 8-fold higher than wildtype protein. The vertical line denotes where bands were cropped out of the blot, but all samples within (C) were run on the same gel. The bands for NMNAT2-myc and endogenous NMNAT2 are labeled. Quantification from CHX timecourse experiments for fraction of NMNAT2 (D) and SCG10 (E) as compared to time zero. The turnover rate of both NMNAT2 and SCG10 is not statistically different when comparing endogenous survival factors in non-infected cultures to the turnover rate in cultures overexpressing high amounts of NMNAT2-myc and SCG10.

Both NMNAT2 and SCG10 are labile proteins that are rapidly turned over in axons. We previously demonstrated that JNK inhibition slows the turnover rate of SCG10 (Shin et al., 2012). Hence, we postulated that MAPK signaling limits the levels of axon survival factors by promoting their turnover. To test this hypothesis, we assessed their half-life by treating cultured DRG neurons with the translation inhibitor cycloheximide to block new protein synthesis and measured the levels of endogenous NMNAT2 and SCG10 within axons at various times after cycloheximide treatment (Figure 5C–E). Consistent with previous reports (Gilley and Coleman, 2010; Shin et al., 2012), the normal turnover of NMNAT2 and SCG10 is rapid, with half-lives of approximately 1.1 and 1.5 hr, respectively. However, with MKK4/7 knockdown the turnover of these survival factors is slowed, with half-lives for NMNAT2 and SCG10 of approximately 3.4 and 2.7 hr, respectively. Thus, MAPKs likely influence the turnover of NMNAT2 and SCG10.

As levels of NMNAT2 and SCG10 are elevated within the axon upon MAPK depletion, it is possible that turnover is delayed due to saturation of degradation machinery. To test this hypothesis we performed two additional experiments. First, we pre-treated DRG neurons with JNK inhibitor VIII for only 30 min, which does not allow for enough time for substantial buildup of protein. We then treated with cycloheximide and measured endogenous NMNAT2 and SCG10 turnover in axons. We find that even acute inhibition of JNK signaling is sufficient to delay the degradation of both survival factors, consistent with the model that MAPK signaling regulates protein turnover (Figure 5—figure supplement 1). Second, we tested directly whether high levels of axonal NMNAT2 and SCG10 would hinder the degradation process and slow turnover. For this, we compared the turnover rate within axons of endogenous NMNAT2 and SCG10 to the turnover rate in cultures overexpressing high levels of NMNAT2-myc and wildtype SCG10. We observe no change in the degradation rate of survival factors when levels are increased over 5-fold higher than endogenous levels, which is even more than the increase in protein levels that we observe with depletion of MKK4/7 (Figure 5—figure supplement 2). Hence, the slowed turnover is not due to the higher levels of these proteins. Finally, there is no increase in transcript levels of either NMNAT2 or SCG10 after depletion of MKK4/7 as assessed by rt-PCR (Figure 5B). These findings are all consistent with the model that MAPK signaling promotes the turnover of NMNAT2 and SCG10. While turnover is slowed, NMNAT2 and SCG10 are still lost in the absence of MKK4/7, albeit at a slower rate, indicating that there are likely MAPK-independent mechanisms promoting their degradation.

MAPK signaling promotes axonal degeneration via regulation of survival factors

Inhibition of MAPK signaling via knockdown of MKK4/7 delays axonal degeneration following axotomy (see Figure 3—figure supplement 1C, Yang et al., 2015) and increases the levels of NMNAT2 (Figure 3). Since increased levels of NMNAT2 are sufficient to delay axon degeneration following injury, we hypothesized that the axonal protection afforded by MKK4/7 knockdown is due to the elevation of NMNAT2 levels. To test this model, we simultaneously depleted MKK4/7 with shRNAs and used guide RNAs (gRNAs) to knockout NMNAT2 in cultured Cas9 knockin DRG neurons and assessed the rate of axon degeneration following axotomy. Knockout of NMNAT2 using gRNAs fully blocks the increase in NMNAT2 protein levels induced by MKK4/7 knockdown (Figure 6—figure supplement 1), and also abrogates the axonal protection resulting from MKK4/7 knockdown (Figure 6A–B and Figure 6—figure supplement 1). Following axotomy, axons from control neurons degenerate after 6 hr, yet 24 hr after axotomy axons from MKK4/7 knockdown neurons remain intact with addition of control scrambled gRNA (Figure 6A–B and Figure 6—figure supplement 1). However, this protection is lost when NMNAT2 is simultaneously knocked out with gRNAs (Figure 6A–B and Figure 6—figure supplement 1). Indeed, with the simultaneous knockdown of MKK4/7 and NMNAT2 axons degenerate at 6 hr after axotomy, the same time point at which wildtype axons begin to degenerate. Hence, NMNAT2 is required for the axonal protection afforded by MKK4/7 knockdown, indicating that the protective effect of inhibiting MAPK signaling is conferred by elevated levels of NMNAT2. NMNAT2 knockdown does not block the protection afforded by deletion of SARM1 (Figure 6A–B), consistent with previous findings showing that NMNAT2 functions upstream of SARM1 to inhibit axonal degeneration (Gilley et al., 2015).

Figure 6. MAPK signaling promotes axonal degeneration via regulation of survival factors.

MKK4/7 requires NMNAT2 to protect axons. Cas9 knock-in DRGs were cultured and treated with scrambled (gScrambled) or NMNAT2 (gNMNAT2) guide RNAs. (A) Knockdown of MKK4/7 (sh4/7) protects axons at 24 hr after axotomy; however, knocking out NMNAT2 using guide RNAs suppresses this protection (p≤0.0001). In contrast, axons from SARM1 -/- DRG neurons do not require NMNAT2 to maintain integrity. (B) Quantification of degeneration index (DI) from images shown in A and in Figure 6—figure supplement 1 plus additional replicates. NMNAT2 guide RNAs revert protection from shMKK4/7 at 6 hr. (C) The protection conferred by overexpression of Scg10-AA (stable, with JNK sites mutated) and NMNAT2-myc is synergistic. Expression of SCG10-AA protects axons for 9 hr (∧), while overexpression of NMNAT2-myc delays degeneration for 36 hr (∧∧). When expressed together, SCG10-AA and NMNAT2-myc protect axons for 72 hr, comparable to protection due to expression of cytoplasmically-localized NMNAT1 (cytNMNAT1). At 9 hr, all conditions are statistically different from non-recombinant vector controls (ctrl; p≤0.01) and axons are protected. After 48 hr, NMNAT2-myc is statistically different from cytNMNAT1 and NMNAT2-myc + SCG10-AA (p≤0.01); however, cytNMNAT1 and NMNAT2-myc + SCG10-AA are essentially equivalent. The horizontal dotted lines indicate the DI value above which axons have begun to degenerate. (D) Representative images from figure C at 9 hr or 48 hr after axotomy, as noted. N = 3–4. Also refer to Figure 6—figure supplement 1.

DOI: http://dx.doi.org/10.7554/eLife.22540.012

Figure 6.

Figure 6—figure supplement 1. MKK4/7 requires NMNAT2 to protect axons.

Figure 6—figure supplement 1.

Cas9 knock-in DRGs were cultured and treated with scrambled (gScrambled) or Nmnat2 (gNMNAT2) guide RNAs (gRNA). (A) Uninjured Cas9 knock-in DRGs are intact when NMNAT2 is knocked out using guide RNA (gNMNAT2) and when MKK4/7 (sh4/7) or SARM1 (shSARM1) are depleted with shRNAs. (B) Knockdown of MKK4/7 protects axons at 6 hr after axotomy compared to shLuciferase (ctrl) controls; however, knocking out NMNAT2 using guide RNAs suppresses this protection (p≤0.0001). Scrambled gRNAs (gScrambled) have no effect on sh4/7 axon protection. In contrast, depletion of SARM1 with shRNAs (shSARM1) in DRG neurons does not require NMNAT2 to maintain integrity. Quantification of degeneration is shown in Figure 6 . (C) Representative western blot demonstrating efficacy of shRNAs and guide RNAs (Scr is scrambled gRNA, N2 is Nmnat2 gRNA). TUJ1 is a loading control.

These findings demonstrate that NMNAT2 is absolutely essential for the protection mediated by loss of MAPK signaling, raising the question of whether or not SCG10 also participates in this process. While overexpression of NMNAT2 and SCG10 each confer axon protection after injury (Gilley and Coleman, 2010; Shin et al., 2012), inhibition of MAPK signaling elevates the levels of these proteins in tandem. To test of whether SCG10 could enhance NMNAT2-induced axon protection, we simultaneously overexpressed NMNAT2 and SCG10 in order to mimic this coordinate up regulation. We overexpressed SCG10-AA (S62/73A), a more stable form of the protein in which JNK phosphorylation sites are mutated (Shin et al., 2012), and NMNAT2-myc singly or in combination in otherwise wild type cultured DRG neurons. Overexpression of SCG10-AA delays axon degeneration after axotomy by about 3 hr compared to control, consistent with the very modest axon protection previously described (Shin et al., 2012). Overexpression of NMNAT2-myc protects axons for 36 hr after axotomy. Surprisingly, co-expression of SCG10-AA and NMNAT2-myc results in robust axon protection for at least 72 hr (Figure 6C–D). The extent of protection is comparable to that achieved via overexpression of cytoplasmic NMNAT1, the most axo-protective gain-of-function manipulation described to-date (Babetto et al., 2010; Sasaki et al., 2009a). Thus, elevation of NMNAT2 and SCG10 confers robust protection, indicating that these factors either function synergistically or contribute to parallel pathways to prevent axon degeneration. These results are consistent with the model that MAPK signaling promotes axonal degeneration by coordinately down regulating axon survival factors (Figure 7).

Figure 7. Model of the axonal degeneration program.

Figure 7.

In this model, MAPK signaling limits the levels of NMNAT2 and SCG10. NMNAT2 blocks activation of SARM1, and SCG10 may facilitate NMNAT2 function. Upon axon injury, delivery of the labile survival factors via anterograde transport is blocked. The continued degradation of survival factors allows levels of survival factors to drop below a critical threshold, thereby activating SARM1. Activated SARM1 rapidly depletes NAD+, leading to depletion of ATP and induction of a metabolic crisis that drives axon fragmentation. Our studies identify a critical function for MAPK signaling upstream of endogenous SARM1, however forced dimerization of SARM1-TIR can activate JNK, and so there could be additional roles for MAPK signaling downstream of SARM1.

DOI: http://dx.doi.org/10.7554/eLife.22540.014

Discussion

A balance between axonal survival and axonal degeneration factors determines the choice between axon maintenance and axon loss. MAPK signaling via JNK is an essential component of the pro-degenerative program (Miller et al., 2009; Yang et al., 2015), but the mechanism of action of MAPK signaling was not known. Here we define this mechanism, demonstrating that MAPK signaling promotes axonal degeneration by enhancing the turnover of axonal survival factors. We present a model of the axonal degeneration program that incorporates many of the major axon survival and degeneration proteins into a linear pathway.

SARM1 is the central executioner of the axonal degeneration program, and so it is important to understand how activated SARM1 triggers axon loss. Others and we have identified two downstream consequences of SARM1 activation. We demonstrated that activated SARM1 induces the rapid degradation of the essential metabolic co-factor NAD+, and that endogenous SARM1 is necessary for NAD+ loss following nerve injury in vivo (Gerdts et al., 2015). Yang and colleagues showed that activated SARM1 induces rapid MAPK activation, and that endogenous SARM1 is necessary for MAPK activation after nerve injury in vivo (Yang et al., 2015). Here we tested the hypothesis that MAPK signaling is necessary for SARM1-dependent NAD+ loss. To our surprise, MAPK signaling is necessary for injury-dependent NAD+ depletion, but not for NAD+ loss induced by activated SARM1. MAPK signaling is also necessary for axon degeneration induced by axotomy, but not axon degeneration induced by activated SARM1. These findings support the model that MAPK signaling is required for the injury-induced activation of SARM1, but that once SARM1 is active, then MAPK signaling is dispensable for SARM1-dependent NAD+ depletion and axon loss.

The detailed molecular mechanism of injury-dependent SARM1 activation is unknown, however strong genetic data demonstrate that loss of the axonal survival factor NMNAT2 induces SARM1-dependent axon degeneration (Gilley et al., 2015). Here we show that MAPK signaling promotes axonal NMNAT2 protein turnover both in mouse DRG neurons in culture and Drosophila motoneurons in vivo. Moreover, this increase in NMNAT2 levels is necessary for the axon protection afforded by knockdown of MKK4 and MKK7. In addition, MAPK signaling promotes the turnover of the only other identified axonal survival factor, SCG10. Taken together, these data fit the model that MAPK signaling promotes axonal degeneration by limiting the levels of axon survival factors.

This model places MAPK signaling upstream of SARM1 activation. However, SARM1 activity can induce MAPK activation (this manuscript; Chang et al., 2011; Hayakawa et al., 2011; Inoue et al., 2013; Tong et al., 2009; Yang et al., 2015), which would be consistent with an alternative model in which SARM1 activates MAPK signaling which then promotes the turnover of NMNAT2 as part of a positive feedback loop. We tested and excluded this feedback loop model using SARM1 knockout neurons. SARM1 knockout neurons do not have elevated levels of NMNAT2 or SCG10 at steady state, and the regulation of NMNAT2 and SCG10 by MKK4/7 does not require SARM1. The Coleman group reported similar findings in injured axons, demonstrating that NMNAT2 is still degraded after injury in SARM1 knockout neurons (Gilley et al., 2015). These data are incompatible with the feedback loop model. Instead, the finding that MKK4/7 regulate the levels of these axon survival factors in the absence of SARM1 is genetic proof that for this activity MAPK signaling does not function downstream of SARM1. However, it does not exclude the possibility that SARM1-dependent activation of MAPK signaling plays a modulatory role that was not discernable in our functional studies.

How might MAPK signaling promote the turnover of NMNAT2 and SCG10? For SCG10, the regulation is, at least in part, direct. SCG10 is phosphorylated by JNK kinases (Shin et al., 2012; Tararuk et al., 2006), and we showed that mutating these phosphorylation sites slows SCG10 turnover in axons (Shin et al., 2012). However, we also demonstrated that inhibiting JNK kinases further slows the turnover of this mutant SCG10, suggesting additional mechanisms of regulation (Shin et al., 2012). For NMNAT2 we do not know the mechanism. We have mutated candidate phosphorylation sites, but have not identified sites required for MAPK regulation (unpublished findings). NMNAT2 turnover is regulated by palmitoylation, localization, and the ubiquitin ligase Highwire/PHR1 (Babetto et al., 2013; Milde and Coleman, 2014; Milde et al., 2013a; Xiong et al., 2012). Hence MAPK signaling could impact NMNAT2 turnover by modulating these processes, and this will be a topic of future studies.

Our findings in conjunction with previous work in the field support a simple model for the mechanism of axonal degeneration that incorporates many of the major axonal survival and degenerative proteins (Figure 7). In this model MAPK signaling limits the levels of NMNAT2, and NMNAT2 in turn inhibits the activation of SARM1. Upon injury, anterograde transport of NMNAT2 is blocked, thereby causing a local reduction in NMNAT2 as a consequence of constitutive protein degradation. When NMNAT2 levels fall below a critical threshold, SARM1 is activated, leading to a precipitous drop in NAD+ and ATP levels, energetic crisis, and axon destruction. In this model, MAPK activity is a rheostat controlling the levels of NMNAT2 and hence the propensity for an axon to degenerate. Such tuning might be particularly important in chronic conditions such as neuropathy in which axonal transport of survival factors may be impaired but not completely blocked, as it is following axotomy.

In this model the core components of the degeneration program form a linear pathway, but additional regulatory molecules will impinge on this mechanism. For example, AKT activity is mildly axoprotective, and inhibits MAPK signaling via direct phosphorylation of MKK4 (Wakatsuki et al., 2011; Yang et al., 2015). The ubiquitin ligase Highwire/PHR1 targets NMNAT2 for degradation, and loss of this ligase is potently axoprotective (Babetto et al., 2013; Xiong et al., 2012). The axoprotective mechanism of action of SCG10 is unknown, but we previously demonstrated that maintaining SCG10 in injured axons enhances axonal transport (Shin et al., 2012). We show that co-expression of SCG10 with NMNAT2 greatly enhances axon protection after injury, and so speculate that SCG10 could facilitate the transport of NMNAT2 to its sites of action within the injured axon. To date no proteins have been identified that directly regulate SARM1, but we anticipate that such molecules would potently modulate axon degeneration. We suggest that knowledge of the core axonal degeneration program presented here will provide a framework for understanding the molecular mechanism of newly identified players in this pathway.

Materials and methods

Antibodies and chemicals

The following antibodies were used in this study: rabbit anti-β3 tubulin (TUJ1; 1:5000; Sigma-Aldrich (St. Louis, MO) Cat# T2200 RRID:AB_262133), mouse anti-β3 tubulin (Tuj1; 1:5000; Biolegend, (San Diego, CA) Cat# 801202 RRID:AB_10063408), rabbit anti-MKK4 (1:1000; Cell Signaling Technologies (CST; Danvers, MA) Cat# 9152 RRID:AB_330905), rabbit anti-MKK7 (1:1000; CST Cat# 4172 RRID:AB_330914), rabbit HSP90 (1:500; CST Cat# 4877S RRID:AB_2233307), rabbit Phospho-SEK1/MKK4(Ser257/Thr261) (1:1000; CST Cat# 9156S RRID:AB_2297420), mouse anti-Myc-Tag (9B11; 1:5000; CST Cat# 2276 RRID:AB_2314825), rabbit anti-SCG10 (Shin et al., 2012), rabbit anti-NMNAT2 (Mayer et al., 2010), Cy3 and Cy5-conjugated goat α-HRP (1:1000, Jackson ImmunoResearch (West Grove, PA)), Alexa488 α-GFP (1:1000, Life Technologies (Carlsbad, CA)), α-HA (16B2; 1:500, Covance). JNK inhibitor VIII (#15946, Cayman Chemical Company (Ann Arbor, MI)) was used at 10 µM, AP20187 (BB Homodimerizer; Clontech (Mountain View, CA) #635060) was used at 50 nM, and cycloheximide (10 ug/mL, Sigma (St. Louis, MO)).

Mouse dorsal root ganglia cultures

Embryonic DRG spot cultures were prepared as described by Gerdts et al. (Gerdts et al., 2013). Briefly, DRGs were cultured from embryonic day 12.5–13.5 CD1 (Charles River) or SARM1 -/- mice (Szretter et al., 2009) on plates coated with poly-D-Lysine and laminin. Neurobasal culture medium (Invitrogen, Carlsbad, CA) was supplemented with 2% B27 (Invitrogen), 50 ng/mL nerve growth factor (Harlan Laboratories, Indianapolis, IN), and 1 µM 5-Fluoro-2’-deoxyuridine (Sigma) and 1 µM uridine (Sigma). All experiments were performed at DIV 8–9.

Lentivirus transduction

Lentiviruses were generated as previously described (Araki et al., 2004). Virus was added to cultures at DIV2. We achieve ~100% transduction efficiency into DRG neurons. All cultures were treated with lentivirus expressing Bcl-XL to suppress non-specific shRNA toxicity. Bcl-XL overexpression does not influence the SARM1 Wallerian degeneration program or axon degeneration induced by dimerization of the SARM1-TIR domains (Gerdts et al., 2013; Vohra et al., 2010; Yang et al., 2015). Plasmids used in this study: NMNAT2-myc-6xHis (NMNAT2-myc; Babetto et al., 2013), SCG10-AA (Shin et al., 2012), shMKK4-2 (Sigma; TRCN0000345130, primary MKK4 shRNA used in this study), shMKK4-1 (Sigma; TRCN000025264), shMKK7 (Sigma; TRCN0000012609), shSARM1 (Gerdts et al., 2013), FkbpF36V-sTIR-Cerulean (Gerdts et al., 2015), CytNMNAT1 (Sasaki and Milbrandt, 2010), and FCIV for vector controls (Araki et al., 2004). Expression of constructs was confirmed by green fluorescence in cells or by western blot analysis. Multiple shRNAs were validated for MKK4.

CRISPR/gRNA

For CRISPR/gRNA studies, Cas9 knock-in mice from Jackson Laboratory (Strain# 024857) (Platt et al., 2014) were bred to mice expressing CRE recombinase under control of mouse beta-Actin promoter. From this breeding, E13.5 embryos were dissected and embryonic DRGs seeded and cultured as described above. For analysis of NMNAT2 protein levels after depletion of MKK4/7, DRGs were infected with lentivirus on DIV1. Cells were lysed on DIV 8 and cell extracts analyzed by western immunoblotting. For suppression of axon protection experiments, DRGs were infected with Bcl-XL and shRNAs on DIV 3 and gRNA to Nmnat2 or scrambled control on DIV 4. Axons were not fragmented spontaneously with gRNA to Nmnat2 during the course of the experiment. Scrambled gRNAs (CGTCGCCGGCGAATTGACGG and CGCGGCAGCCGGTAGCTATG), Map2k4 (MKK4) gRNAs (TTGTTTTACAGGGCGACTGT and TTTGTAAAACTTATCGAACG), Map2k7 (MKK7) gRNAs (TTGCAGCAAATGCGGCGCT and CCAAAGCACTGAACGATGTA), Nmnat2 gRNA (GGAGCCCACCTGTTTTCCGT). gRNAs were designed with help from the Genome Engineering and iPSC center. gRNA sequences were cloned into LentiGuide-puro plasmid (Addgene # 52963).

qRT-PCR

Total RNA was purified from DRG cultures using phenol-chloroform extraction using Trizol (Invitrogen). RNA was retro-transcribed using qScript cDNA supermix (Quanta Biosciences, Beverly, MA). Quantitative real-time PCR was performed using a SYBR green-based assay on a 7900 HT sequence detection system (Applied Biosystems) and quantified using delta-CT, with Gapdh as an internal control. Primers include: Nmnat2 Fwd: 5’ GACCGAGACCACAAAGACCC, NMNAT2 Rev: 5’ CCCTGGCTCTCTCGAACATC, Stmn2 (SCG10) Fwd: 5’ TGCGTGCACATCCCTACAAT, Stmn2 (SCG10) Rev: 5’ CTGCTTCACCTCCATGTCGT, Gapdh Fwd: 5’ TGTGAACGGATTTGGCCGTA, and Gapdh Rev: 5’ ACTGTGCCGTTGAATTTGCC.

Drosophila

Drosophila melanogaster were raised on standard fly food at 25°C. The following strains were used in this study: Canton S (wild-type), hiw∆N (Wu et al., 2005), UAS-bskDN (Weber et al., 2000),OK6-Gal4 (motoneuron specific; Aberle et al., 2002), m12-Gal4 (single-axon resolution; Ritzenthaler et al., 2000), UAS-HA-dNMNAT (Zhai et al., 2006), and the following RNAi lines from the Bloomington Trip collection (Bsk, 53310 and 57035). For the nerve crush assay, segmental nerves of third instar larvae were visualized through the cuticle under a dissection microscope. Larvae were immobilized in a cold dish and the segmental nerves were pinched tightly through the cuticle for five seconds with Dumostar number five forceps. After injury, the larva were transferred to a grape plate and kept alive for varying periods of time at 25°C before dissection. This assay was adapted from (Xiong et al., 2010). Axons were labeled with GFP expressed by the M12-Gal4 driver and nerves were labeled with α-HRP.

NAD+ and ATP measurements

Dense spot cultures derived from four embryos were cultured in a 24-well plate. For NAD+ measurement after axotomy, axons were cut at the indicated timepoints, cell bodies were removed using forceps, and NAD+ was collected from the remaining neurites. NAD+ was collected from whole cell for SARM1-TIR-mediated NAD+ depletion experiments. Wells were rinsed twice with cold saline and metabolites were collected in 150 µL 1 M perchloric acid (HClO4) on ice for five minutes. After spinning for five minutes, the supernatant was transferred to a new tube, 20 µL 3M potassium carbonate (K2CO3) was added. The supernatant was loaded for HPLC after a five minute spin as described (Gerdts et al., 2015). NAD+ measurements were normalized to the time zero controls for each condition.

Axotomy

DRG spot cultures were axotomized using a microscalpel and images of distal axons were taken at indicated timepoints. Axon images for gRNA and SARM1-TIR experiments were acquired using an Operetta high-content imaging system (PerkinElmer, Waltham, MA). For quantification of axon degeneration, images were analyzed using ImageJ software with the Degeneration Index algorithm, which computes an unbiased degeneration score ranging from 0–1.0, with 1.0 being total fragmentation (Sasaki et al., 2009b). In this study, a score of about 0.3 indicates an approximate transition from a morphologically intact to a blebbing axon. Each technical replicate included 2–3 wells per condition and experiments were repeated for at least three independent biological replicates.

Western blot

For axon-only western blot, dense spot cultures were plated using 4 embyros per 24-well plate. A microscalpel was used to remove cell bodies. Axon-only lysate was collected from 4–6 wells. Samples were lysed on ice using Laemmli buffer with protease inhibitor cocktail (Roche #11836170001). A standard western blot procedure was followed. For quantification, bands were normalized to HSP90 or Tuj1 as loading controls. For half-life quantification, data were fit to a curve.

Immunofluorescence

DRGs were plated in spot cultures in 8-well Permanox slides (Lab-Tek, Thermo Scientific). Neurons were fixed in 4% paraformaldehyde, washed, and blocked as described (Shin et al., 2012). NMNAT2-myc was detected with anti-myc tag antibody (9B11; CST #2276), and neurons were co-stained with anti-β3 tubulin. Larval filet preps of third instar larva were fixed in 4% paraformaldehyde for 20 min at room temperature. Blocking and staining were performed in PBS + 0.1% Triton X-100 + 5% goat serum. All Drosophila samples were mounted and imaged in 70% glycerol containing Vectashield. Samples were imaged on a Leica DMI 4000B Confocal microscope using 40x or 60x oil objectives. Images are maximal Z-projections of confocal stacks. Samples for each experiment were processed simultaneously with identical confocal gain settings. Intensity of NMNAT2-myc and SCG10 in DRGs was quantified using ImageJ by determining the mean grey value within the total axonal area as defined by Tuj1 staining with background subtracted. A similar strategy was employed for intensity of HA-dNMNAT, with HRP labeling total axonal area.

Statistical analysis

One-way ANOVA comparison with Tukey post-hoc was used to test for statistical significance. All data are presented as mean ± SEM. Data analysis was performed in GraphPad Prism.

Acknowledgements

We thank T Fahrner, S Johnson, P Breton, and X Sun for technical assistance and members of the DiAntonio and Milbrandt labs for fruitful discussions.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Funding Information

This paper was supported by the following grants:

  • National Institute of Neurological Disorders and Stroke NS087632 to Jeffrey Milbrandt, Aaron DiAntonio.

  • Muscular Dystrophy Association MDA349925 to Aaron DiAntonio.

  • Muscular Dystrophy Association MDA 344513 to Daniel W Summers.

  • National Institute of Neurological Disorders and Stroke NS065053 to Aaron DiAntonio.

Additional information

Competing interests

The authors declare that no competing interests exist.

Author contributions

LJW, Conceptualization, Data curation, Formal analysis, Investigation, Writing—original draft, Writing—review and editing.

DWS, Data curation, Formal analysis, Funding acquisition, Investigation, Writing—review and editing.

YS, Data curation, Formal analysis, Investigation, Writing—review and editing.

EJB, Data curation, Formal analysis, Investigation, Writing—review and editing.

JM, Conceptualization, Resources, Supervision, Funding acquisition, Writing—review and editing.

AD, Conceptualization, Resources, Supervision, Funding acquisition, Writing—original draft, Writing—review and editing.

Ethics

Animal experimentation: This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All of the animals were handled according to approved institutional animal care and use committee (IACUC) protocols (#A-3381- 01) at Washington University in St. Louis. The protocol was approved by the Committee on the Ethics of Animal Experiments of the University of Minnesota (Permit Number: 2015043).

References

  1. Aberle H, Haghighi AP, Fetter RD, McCabe BD, Magalhães TR, Goodman CS. Wishful thinking encodes a BMP type II receptor that regulates synaptic growth in Drosophila. Neuron. 2002;33:545–558. doi: 10.1016/S0896-6273(02)00589-5. [DOI] [PubMed] [Google Scholar]
  2. Araki T, Sasaki Y, Milbrandt J. Increased nuclear NAD biosynthesis and SIRT1 activation prevent axonal degeneration. Science. 2004;305:1010–1013. doi: 10.1126/science.1098014. [DOI] [PubMed] [Google Scholar]
  3. Babetto E, Beirowski B, Janeckova L, Brown R, Gilley J, Thomson D, Ribchester RR, Coleman MP. Targeting NMNAT1 to axons and synapses transforms its neuroprotective potency in vivo. Journal of Neuroscience. 2010;30:13291–13304. doi: 10.1523/JNEUROSCI.1189-10.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Babetto E, Beirowski B, Russler EV, Milbrandt J, DiAntonio A. The Phr1 ubiquitin ligase promotes injury-induced axon self-destruction. Cell Reports. 2013;3:1422–1429. doi: 10.1016/j.celrep.2013.04.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Blum ES, Abraham MC, Yoshimura S, Lu Y, Shaham S. Control of nonapoptotic developmental cell death in Caenorhabditis elegans by a polyglutamine-repeat protein. Science. 2012;335:970–973. doi: 10.1126/science.1215156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chang C, Hsieh YW, Lesch BJ, Bargmann CI, Chuang CF. Microtubule-based localization of a synaptic calcium-signaling complex is required for left-right neuronal asymmetry in C. elegans. Development. 2011;138:3509–3518. doi: 10.1242/dev.069740. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen CY, Lin CW, Chang CY, Jiang ST, Hsueh YP. Sarm1, a negative regulator of innate immunity, interacts with syndecan-2 and regulates neuronal morphology. The Journal of Cell Biology. 2011;193:769–784. doi: 10.1083/jcb.201008050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chuang CF, Bargmann CI. A Toll-interleukin 1 repeat protein at the synapse specifies asymmetric odorant receptor expression via ASK1 MAPKKK signaling. Genes & Development. 2005;19:270–281. doi: 10.1101/gad.1276505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Conforti L, Gilley J, Coleman MP. Wallerian degeneration: an emerging axon death pathway linking injury and disease. Nature Reviews Neuroscience. 2014;15:394–409. doi: 10.1038/nrn3680. [DOI] [PubMed] [Google Scholar]
  10. Geisler S, Doan RA, Strickland A, Huang X, Milbrandt J, DiAntonio A. Prevention of vincristine-induced peripheral neuropathy by genetic deletion of SARM1 in mice. Brain. 2016;139:3092–3108. doi: 10.1093/brain/aww251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gerdts J, Summers DW, Sasaki Y, DiAntonio A, Milbrandt J. Sarm1-mediated axon degeneration requires both SAM and TIR interactions. Journal of Neuroscience. 2013;33:13569–13580. doi: 10.1523/JNEUROSCI.1197-13.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gerdts J, Brace EJ, Sasaki Y, DiAntonio A, Milbrandt J. SARM1 activation triggers axon degeneration locally via NAD⁺ destruction. Science. 2015;348:453–457. doi: 10.1126/science.1258366. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Gerdts J, Summers DW, Milbrandt J, DiAntonio A. Axon Self-Destruction: New links among SARM1, MAPKs, and NAD+ Metabolism. Neuron. 2016;89:449–460. doi: 10.1016/j.neuron.2015.12.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gilley J, Coleman MP. Endogenous Nmnat2 is an essential survival factor for maintenance of healthy axons. PLoS Biology. 2010;8:e1000300. doi: 10.1371/journal.pbio.1000300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gilley J, Orsomando G, Nascimento-Ferreira I, Coleman MP. Absence of SARM1 rescues development and survival of NMNAT2-deficient axons. Cell Reports. 2015;10:1974–1981. doi: 10.1016/j.celrep.2015.02.060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hayakawa T, Kato K, Hayakawa R, Hisamoto N, Matsumoto K, Takeda K, Ichijo H. Regulation of anoxic death in Caenorhabditis elegans by mammalian apoptosis signal-regulating kinase (ASK) family proteins. Genetics. 2011;187:785–792. doi: 10.1534/genetics.110.124883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Henninger N, Bouley J, Sikoglu EM, An J, Moore CM, King JA, Bowser R, Freeman MR, Brown RH. Attenuated traumatic axonal injury and improved functional outcome after traumatic brain injury in mice lacking Sarm1. Brain. 2016;139:1094–1105. doi: 10.1093/brain/aww001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Inoue A, Sawatari E, Hisamoto N, Kitazono T, Teramoto T, Fujiwara M, Matsumoto K, Ishihara T. Forgetting in C. elegans is accelerated by neuronal communication via the TIR-1/JNK-1 pathway. Cell Reports. 2013;3:808–819. doi: 10.1016/j.celrep.2013.02.019. [DOI] [PubMed] [Google Scholar]
  19. Kurz CL, Shapira M, Chen K, Baillie DL, Tan MW. Caenorhabditis Elegans pgp-5 is involved in resistance to bacterial infection and heavy metal and its regulation requires TIR-1 and a p38 map kinase cascade. Biochemical and Biophysical Research Communications. 2007;363:438–443. doi: 10.1016/j.bbrc.2007.08.190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Mayer PR, Huang N, Dewey CM, Dries DR, Zhang H, Yu G. Expression, localization, and biochemical characterization of nicotinamide mononucleotide adenylyltransferase 2. Journal of Biological Chemistry. 2010;285:40387–40396. doi: 10.1074/jbc.M110.178913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Milde S, Fox AN, Freeman MR, Coleman MP. Deletions within its subcellular targeting domain enhance the axon protective capacity of Nmnat2 in vivo. Scientific Reports. 2013a;3:2567. doi: 10.1038/srep02567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Milde S, Gilley J, Coleman MP. Subcellular localization determines the stability and axon protective capacity of axon survival factor Nmnat2. PLoS Biology. 2013b;11:e1001539. doi: 10.1371/journal.pbio.1001539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Milde S, Coleman MP. Identification of palmitoyltransferase and thioesterase enzymes that control the subcellular localization of axon survival factor nicotinamide mononucleotide adenylyltransferase 2 (NMNAT2) Journal of Biological Chemistry. 2014;289:32858–32870. doi: 10.1074/jbc.M114.582338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Miller BR, Press C, Daniels RW, Sasaki Y, Milbrandt J, DiAntonio A. A dual leucine kinase-dependent axon self-destruction program promotes wallerian degeneration. Nature Neuroscience. 2009;12:387–389. doi: 10.1038/nn.2290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Osterloh JM, Yang J, Rooney TM, Fox AN, Adalbert R, Powell EH, Sheehan AE, Avery MA, Hackett R, Logan MA, MacDonald JM, Ziegenfuss JS, Milde S, Hou YJ, Nathan C, Ding A, Brown RH, Conforti L, Coleman M, Tessier-Lavigne M, Züchner S, Freeman MR. dSarm/Sarm1 is required for activation of an injury-induced axon death pathway. Science. 2012;337:481–484. doi: 10.1126/science.1223899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Platt RJ, Chen S, Zhou Y, Yim MJ, Swiech L, Kempton HR, Dahlman JE, Parnas O, Eisenhaure TM, Jovanovic M, Graham DB, Jhunjhunwala S, Heidenreich M, Xavier RJ, Langer R, Anderson DG, Hacohen N, Regev A, Feng G, Sharp PA, Zhang F. CRISPR-Cas9 knockin mice for genome editing and cancer modeling. Cell. 2014;159:440–455. doi: 10.1016/j.cell.2014.09.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Ritzenthaler S, Suzuki E, Chiba A. Postsynaptic filopodia in muscle cells interact with innervating motoneuron axons. Nature neuroscience. 2000;3:1012–1017. doi: 10.1038/79833. [DOI] [PubMed] [Google Scholar]
  28. Sasaki Y, Vohra BPS, Baloh RH, Milbrandt J. Transgenic mice expressing the Nmnat1 protein manifest robust delay in axonal degeneration in vivo. Journal of Neuroscience. 2009a;29:6526–6534. doi: 10.1523/JNEUROSCI.1429-09.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Sasaki Y, Vohra BP, Lund FE, Milbrandt J. Nicotinamide mononucleotide adenylyl transferase-mediated axonal protection requires enzymatic activity but not increased levels of neuronal nicotinamide adenine dinucleotide. Journal of Neuroscience. 2009b;29:5525–5535. doi: 10.1523/JNEUROSCI.5469-08.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Sasaki Y, Milbrandt J. Axonal degeneration is blocked by nicotinamide mononucleotide adenylyltransferase (Nmnat) protein transduction into transected axons. Journal of Biological Chemistry. 2010;285:41211–41215. doi: 10.1074/jbc.C110.193904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Sasaki Y, Nakagawa T, Mao X, DiAntonio A, Milbrandt J. NMNAT1 inhibits axon degeneration via blockade of SARM1-mediated NAD+ depletion. eLife. 2016;5:e19749. doi: 10.7554/eLife.19749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Shin JE, Miller BR, Babetto E, Cho Y, Sasaki Y, Qayum S, Russler EV, Cavalli V, Milbrandt J, DiAntonio A. SCG10 is a JNK target in the axonal degeneration pathway. PNAS. 2012;109:E3696–E3705. doi: 10.1073/pnas.1216204109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Szretter KJ, Samuel MA, Gilfillan S, Fuchs A, Colonna M, Diamond MS. The immune adaptor molecule SARM modulates tumor necrosis factor alpha production and microglia activation in the brainstem and restricts west nile virus pathogenesis. Journal of Virology. 2009;83:9329–9338. doi: 10.1128/JVI.00836-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Tararuk T, Ostman N, Li W, Björkblom B, Padzik A, Zdrojewska J, Hongisto V, Herdegen T, Konopka W, Courtney MJ, Coffey ET. JNK1 phosphorylation of SCG10 determines microtubule dynamics and axodendritic length. The Journal of Cell Biology. 2006;173:265–277. doi: 10.1083/jcb.200511055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Tong A, Lynn G, Ngo V, Wong D, Moseley SL, Ewbank JJ, Goncharov A, Wu YC, Pujol N, Chisholm AD. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase. PNAS. 2009;106:1457–1461. doi: 10.1073/pnas.0809339106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Vohra BP, Sasaki Y, Miller BR, Chang J, DiAntonio A, Milbrandt J. Amyloid precursor protein cleavage-dependent and -independent axonal degeneration programs share a common nicotinamide mononucleotide adenylyltransferase 1-sensitive pathway. Journal of Neuroscience. 2010;30:13729–13738. doi: 10.1523/JNEUROSCI.2939-10.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Wakatsuki S, Saitoh F, Araki T. ZNRF1 promotes wallerian degeneration by degrading AKT to induce GSK3B-dependent CRMP2 phosphorylation. Nature Cell Biology. 2011;13:1415–1423. doi: 10.1038/ncb2373. [DOI] [PubMed] [Google Scholar]
  38. Wang JT, Medress ZA, Barres BA. Axon degeneration: molecular mechanisms of a self-destruction pathway. The Journal of Cell Biology. 2012;196:7–18. doi: 10.1083/jcb.201108111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Weber U, Paricio N, Mlodzik M. Jun mediates Frizzled-induced R3/R4 cell fate distinction and planar polarity determination in the Drosophila eye. Development. 2000;127:3619–3629. doi: 10.1242/dev.127.16.3619. [DOI] [PubMed] [Google Scholar]
  40. Wu C, Wairkar YP, Collins CA, DiAntonio A. Highwire function at the drosophila neuromuscular junction: spatial, structural, and temporal requirements. Journal of Neuroscience. 2005;25:9557–9566. doi: 10.1523/JNEUROSCI.2532-05.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Xiong X, Wang X, Ewanek R, Bhat P, Diantonio A, Collins CA. Protein turnover of the wallenda/DLK kinase regulates a retrograde response to axonal injury. The Journal of Cell Biology. 2010;191:211–223. doi: 10.1083/jcb.201006039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Xiong X, Collins CA. A conditioning lesion protects axons from degeneration via the wallenda/DLK MAP kinase signaling cascade. Journal of Neuroscience. 2012;32:610–615. doi: 10.1523/JNEUROSCI.3586-11.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Xiong X, Hao Y, Sun K, Li J, Li X, Mishra B, Soppina P, Wu C, Hume RI, Collins CA. The highwire ubiquitin ligase promotes axonal degeneration by tuning levels of nmnat protein. PLoS Biology. 2012;10:e1001440. doi: 10.1371/journal.pbio.1001440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Yang J, Wu Z, Renier N, Simon DJ, Uryu K, Park DS, Greer PA, Tournier C, Davis RJ, Tessier-Lavigne M. Pathological axonal death through a MAPK cascade that triggers a local energy deficit. Cell. 2015;160:161–176. doi: 10.1016/j.cell.2014.11.053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Zhai RG, Cao Y, Hiesinger PR, Zhou Y, Mehta SQ, Schulze KL, Verstreken P, Bellen HJ. Drosophila NMNAT maintains neural integrity independent of its NAD synthesis activity. PLoS Biology. 2006;4:e416. doi: 10.1371/journal.pbio.0040416. [DOI] [PMC free article] [PubMed] [Google Scholar]
eLife. 2017 Jan 17;6:e22540. doi: 10.7554/eLife.22540.015

Decision letter

Editor: Carol A Mason1

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

[Editors’ note: a previous version of this study was rejected after peer review, but the authors submitted for reconsideration. The first decision letter after peer review is shown below.]

Thank you for submitting your work entitled "MAPK Signaling Promotes Axonal Degeneration by Speeding the Turnover of the Axonal Maintenance Factor NMNAT2" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Marianne Bronner as the Senior Editor. The reviewers have opted to remain anonymous.

Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife.

Overall, the reviewers were positive both in their reviews and in their online discussion. As one reviewer commented in our discussion, your study on the relationship between injury, MAPK signaling, NMNAT2, and NAD+ level alterations constitutes "a significant data set that will contribute to the eventual full understanding of degenerative pathways".

The reviewers recognize that your results differ from those in Yang et al., from the Tessier-Lavigne group but in no way dismiss your results. Rather, they offer suggestions, albeit requiring additional experiments, to parse out MKK4/7 control of SARM activation that in turn regulates the neuroprotective elements NMNAT2 and SCG10:

Although only Reviewer 1 noted this in the reviews below, all three agreed in our discussion that the Bcl-XL overexpression, to enhance neuron viability after transfection with shRNA constructs, is one aspect that could contribute to these differences. Bcl-XL overexpression should be explained and discussed in the text and, ideally, tested.

The epistasis experiments are welcome, but the reviewers called for analysis of activation of individual components. They also agree that it would be important to test the effects of reducing JNK activity.

All three reviewers were concerned about the conclusion that the MAPK pathway regulates degradation: They ask for clarification on the degradation and turnover analyses that lead to the conclusion that MKK4/7 promote axonal turnover of NMNAT2 and SCG10 post-injury. Reviewer 2 indicates that the lower rate of protein degradation could result from the degradation components being saturated with the high levels of NMNAT2 and SC10 seen in the MKK4/7/ depleted condition. Reviewer 3 asks whether this is due to axonal turnover depending on concurrent MAP kinase activity, or increased axonal loading overwhelming the normal course of degradation. A suggested experiment would involve increasing the levels of NMNAT2 and SCG10 in cells (to levels comparable to those seen with MKK4/7/ depletion) and show that the rate of degradation is unaltered.

Reviewer 3 asked for the FRET experiment to directly readout SARM, but believes that this would be challenging, and so we will not hold you to perform this experiment.

Thus, based on consultation among the three reviewers with the Reviewing Editor on these aspects and the individual reviews below, several asking for additional analyses, we regret to inform you that your work as it stands will not be considered for publication in eLife at this time. We would be happy to receive a new submission if you were to address the reviewers' concerns.

Reviewer #1:

The mechanism of axon degeneration is an area of great interest and intense investigation. Several highly conserved components involved in axotomy induced injury have been identified, including a critical prodegenerative component SARM, a distinctive MAPK pathway comprised of DLK/MEKK4/JNKs, and an anti-degenerative metabolic enzyme NMNAT. Together these molecules alter the metabolic state of axons, and regulate axonal degeneration. Additional components, including ubiquitinating enzymes, Bcl2 family members, caspases, and calpain have all been tied to regulation of axon degeneration. Here Walker et al. try to develop a cohesive view of these multiple components, and how they work together. The findings presented contradict a recent paper in the field. While that study concluded that SARM is upstream of the MAPK cascade, the present study reaches the opposite conclusion, namely that MAPK regulates degradation of NMNAT2 (and other components). Thus, in reviewing the paper, I tried to consider both how the current study differs from Yang et al., and also how well the current model is explored. A major problem (with both studies) is the push to place all these components in a single linear pathway. The impetus to place all the components in a linear pathway may have oversimplified this complex process.

1) A major methodologic difference with the Yang et al. report is that the current study expresses Bcl-XL in all cultures in which shRNA knock down is performed. (Subsection “Lentivirus Transduction”, "All cultures were treated with lentivirus expressing Bcl-XL to suppress non-specific shRNA toxicity). The authors note that this enhances the viability of neurons transfected with shRNA constructs. However, the Tessier-Lavigne group has reported that bclxl can promote axonal survival and prevent degeneration. Therefore, this overexpression could definitely alter the results throughout the study (all experimental figures with the exception of Figure 4 seem to be affected by this issue).

2) The results suggest that MAPK is needed for activation of SARM1, but once activated SARM functions independently of MAPK. IF this is true, then genetic epistasis experiments showing that MAPK is not needed for the activity of a constitutively active SARM, do not indicate that MAPK must be downstream of SARM. I believe there could indeed be a feedback loop. The authors considered, and rejected this possibility. The rejection of this model was based on evidence that MAPK regulates NMNAT2 in the absence of SARM. Again, this result is only problematic if the authors feel that there is a single input into this MAPK cascade.

3) In Figure 1, NAD and ATP are measured in axonal lysates following axotomy, but are instead measured in lysates of the whole cells after SARM dimerization. It is possible that MKK4/7 only alters NAD and ATP locally in axons, but does so both in response to axotomy or to SARM activation, Therefore the conclusion that MKK4/7 only alter NAD and ATP following axotomy and not following SARM activation is somewhat problematic.

4) I think that genetic epistatis experiments are very useful, but it is also important to examine directly activation of individual components. Does activated SARM stimulate the DLK/Mkk4/JNK pathway? To address this question, the authors should look at phosphorylation or catalytic activity of pathway components as an indicator that the MAPK cascade is activated. This is particularly important since the genetic epistasis experiments are not all consistent, and it is likely that many of the pathway components have multiple functions.

Reviewer #2:

This manuscript by Walker and colleagues provides interesting mechanistic insights into the pathway of Wallerian degeneration, which has made significant advances in recent years. Specifically, this manuscript elucidates the order of events that have been recently shown to be key mediators of this pathway, namely-MAPK, NMNAT, and Sarm1. The authors here show that MKK4/7 are important for the loss of NAD+ in axons in response to axotomy and find that MKK4/7 depletion does not prevent the loss of NAD+ in neurons where Sarm1 is directly activated. These findings are interesting because MKK4/7 was previously shown to function after the point of Sarm1 activation to mediate axon degeneration. However, a major point of this manuscript is MKK4/7 functions before the point of Sarm1 activation in this pathway.

The authors follow up this finding by identifying the role of MKK4/7 in regulating the levels of NMNAT2 and SCG10, both previously implicated in protecting against Wallerian degeneration. Loss of MKK4/7 leads to increase levels of NMNAT2 and SCG10, which maintain axon survival.

Overall, these are interesting findings. However, additional experiments are needed to strengthen the conclusions. Also, the current title is not fully supported with the data shown. The data mainly show that MKK4/7 acts upstream of Sarm1 activation and mediates axon degeneration by regulating levels of NMNAT2 and SCG10.

1) The differences in results between this manuscript and the Yang 2015 paper are significant and there does not seem to be any straightforward explanation for this. The Yang 2015 paper shows that both MKK4/7 depletion and JNK1/2/3 depletion prevented active Sarm1-induced axon degeneration. Since the results in his manuscript show that MKK4/7 depletion did not block axon degeneration in the context of direct Sarm activation, the authors should also examine whether similar results are obtained with JNK depletion (or inhibition).

2) In Figure 3E, it appears as though MKK4/7 depletion may also decrease Sarm1 levels. Can the authors comment on this observation? If this is indeed the case, then decreasing levels of Sarm1 could be another mechanism by which MKK4/7 depletion may protect axon degeneration.

3) In Figure 5, the results showing that MKK4/7 depletion decreases the rate of NMNAT2 and SCG10 degradation is not convincing. For example, the lower rate of protein degradation could be because the degradation components are saturated with the high levels of NMNAT2 and SC10 seen in the MKK4/7/ depleted condition. To eliminate that possibility, one would need to increase the levels of NMNAT2 and SCG10 in cells (to levels comparable to those seen with MKK4/7/ depletion) and show that the rate of degradation is unaltered.

4) Have the authors considered increased transcription or translation as factors that could result in the increased accumulation of NMNAT2 or SCG10 in MKK4/7 depleted conditions? Since the title of this manuscript seems to imply turnover as the main mechanism, they need to be more rigorous to not only show convincing degradation data but also to eliminate the other possibilities.

5) In the third paragraph of the subsection “MKK4/7 are necessary for NAD+ loss and axon degeneration after axotomy but not in response to constitutively active SARM1”, the authors conclude that MKK4/7 are "required" for NAD depletion after axotomy. Perhaps it is more accurate to state that MKK4/7 is important for NAD depletion after axotomy (since NAD levels are decreased nearly 50% even in the sh4/7 condition; Figure 1A).

Reviewer #3:

This paper revises the current understanding of the relationship between injury, MAPK signaling, NMNAT2, and NAD+. These are interesting and significant findings given the prominent role of these proteins in axon degeneration. I have a few suggestions before this manuscript would be appropriate for eLife.

a) Although the epistasis is convincing, in general a direct readout of SARM would be very powerful. This would allow testing whether activating or inactivating MAP kinase signaling is sufficient to activate SARM, independently of axon injury. Perhaps this could be done with a FRET reporter for SARM conformation.

b) The experiments in cultured cells and flies suggest that MAP kinase signaling is active even in uninjured neurons, and acts to limit levels of axon survival factors. This is a surprising result that needs more discussion. Can MAP kinase signaling be blocked acutely? How quick is the resulting accumulation of NMNAT2 and SCG10?

c) An important conclusion is that MKK4/7 promote axonal turnover of NMNAT2 and SCG10 post-injury. However, in these experiments the initial amount of NMNAT2 and SCG10 is greatly increased. Thus, it is impossible to know whether axonal turnover really depends on concurrent MAP kinase activity, or whether increased axonal loading overwhelms the normal course of degradation. Perhaps these proteins could be overexpressed to mimic what happens in the MKK4/7 knockdown, and then turnover after injury could be measured.

d) In the final experiment, NMNAT2 is shown to be downstream of MKK4/7, but not SARM. I have concerns about the interpretation. For NMNAT2, the data do show that "NMNAT2 is required for the axonal protection afforded by MKK4/7 knockdown", as stated, but not that "the protective effect of inhibiting MAPK signaling is conferred by elevated levels of NMNAT2" (subsection “MAPK signaling promotes axonal degeneration via regulation of survival factors”, first paragraph). In fact, the proposed model also includes SGC10, and there may be other protective effectors as well.

[Editors’ note: what now follows is the decision letter after the authors submitted for further consideration.]

Thank you for submitting your article "MAPK Signaling Promotes Axonal Degeneration by Speeding the Turnover of the Axonal Maintenance Factor NMNAT2" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Marianne Bronner as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

Summary:

All three reviewers are satisfied with the amendments and agree that the manuscript is strengthened. They have two remaining sets of recommendations.

Essential revisions:

Reviewer 3 asks that some of the key data be included in the revised manuscript, either in the main or figure supplements. This reviewer believes that including the following data in figures is important, especially as some of the data directly address and sometimes contradict the published data from Yang et al.

a) You repeated the SARM1-TIR experiment using JNK inhibitor and found that, like MKK4/7 depletion, JNKi did not block axon degeneration induced by direct SARM1 activation. In particular, these data should be in the main figures.

b) You report that NMNAT2 and SCG10 transcripts were not elevated upon depletion of MKK4/7 by RT-PCR. Based on this result, and the turnover data, you conclude that MAPKs influence the turnover rate of NMNAT2 and SCG10. Since this result is important for the overall conclusion of the manuscript, it would be important to also show it in a figure.

eLife. 2017 Jan 17;6:e22540. doi: 10.7554/eLife.22540.016

Author response


[Editors’ note: the author responses to the first round of peer review follow.]

The reviewers recognize that your results differ from those in Yang et al., from the Tessier-Lavigne group but in no way dismiss your results. Rather, they offer suggestions, albeit requiring additional experiments, to parse out MKK4/7 control of SARM activation that in turn regulates the neuroprotective elements NMNAT2 and SCG10:

Although only Reviewer 1 noted this in the reviews below, all three agreed in our discussion that the Bcl-XL overexpression, to enhance neuron viability after transfection with shRNA constructs, is one aspect that could contribute to these differences. Bcl-XL overexpression should be explained and discussed in the text and, ideally, tested.

We appreciate the reviewer’s suggestion and apologize for not more clearly describing all of the prior published work demonstrating that Bcl-XL overexpression is not the explanation for the difference between the findings from the two groups. Both the Tessier-Lavigne group and our groups have published that Bcl-XL overexpression does not influence the SARM1 Wallerian degeneration program. Indeed, the one point of experimental (rather than interpretational) disagreement between our work and the work of Yang et al. relates to the degeneration induced by dimerizing the SARM1-TIR domain. Importantly, Yang et al. state that this degeneration is not influenced by overexpression of Bcl-XL. In the Yang et al. paper, the Tessier-Lavigne group finds that “Treatment of sensory neurons expressing FKBP(F36V)-TIR with AP20187 induced degeneration of distal axons (Figure 4G and H), which appears independent of the apoptotic pathway since it was not affected by genetic deletion of caspase-9 or overexpression of Bcl-xl(data not shown)” (Yang et al., 2015). We also previously demonstrated that Bcl-XL overexpression does not affect axon degeneration induced by activated SARM 1 (Gerdts et al., 2013, Figure 6). We have also previously published that overexpression of Bcl-XL does not influence the progression of axotomy-induced axon degeneration, which is dependent on full-length SARM1 (Vohra et al., 2010, Figure 1). Reviewer one notes that the Tessier-Lavigne group has demonstrated an important role for Bcl-XL in inhibiting axon degeneration, but that is in the paradigm of NGF-deprivation not axotomy. The Tessier-Lavigne group has shown that NGF-deprivation activates a different molecular pathway than is used in the SARM1-dependent Wallerian degeneration pathway (Simon et al., 2012, 2016). We have published a similar finding for the role of Bcl-XL in NGF-deprivation induced axon degeneration (Vohra et al., 2010). Finally, the contradiction between our work and the work of Yang et al. would not be explained by the expression of Bcl-XL even if a role for Bcl-XL had not been previously excluded by the publications above. We find that knockdown of MKK4/7 does not block SARM1-TIR-induced axon degeneration, while Yang et al. does see protection. The lack of protection in our system could not be explained by the expression of a protective factor such as Bcl-XL.

We have now added additional explanation and references in the section where we discuss the Bcl-XL overexpression.

The epistasis experiments are welcome, but the reviewers called for analysis of activation of individual components. They also agree that it would be important to test the effects of reducing JNK activity.

We have addressed these issues via a series of experiments. We asked about MAPK activation by testing whether dimerization of the SARM1-TIR domain is sufficient to activate the MAPK pathway as described by Yang et al. We now show in Figure 2—figure supplement 1 that we also observe activation of MKK4 following SARM1-TIR dimerization. Hence, we do not disagree with Yang et al. that forced dimerization of SARM1-TIR can induce activation of the MAPK stress pathway. We think this reconciles some of the apparent contradiction between our work and the Yang et al. study. What we attempt to do throughout the paper, however, is to assess whether this activation is the functionally relevant activation. We go on to find a downstream function of MAPK signaling (increased levels of NMNAT2 and SCG10), we show that this function is not downstream of SARM1 because it occurs in SARM1 KO neurons, and demonstrate that this function is necessary for the protection afforded by loss of MAPK signaling in our epistasis experiments. We do now expand our model to acknowledge this additional MAPK activation, and while we have no evidence that it is functionally relevant, we do discuss how this activation could serve to promote axon degeneration.

We also perform additional experiments with JNK inhibition as requested. We now show that treatment of DRGs with JNK inhibitor is sufficient to increase the levels of NMNAT2 and SCG10 within two hours (new Figure 3C) and demonstrate that acute treatment with JNK inhibitor slows the turnover rate of NMNAT2 and SCG10 (Figure 5—figure supplement 1). Finally, we show that JNK inhibition, like MKK4/7 inhibition, does not block SARM-TIR induced axon degeneration. All of these findings are fully consistent with our prior results with MKK4/7 inhibition and strengthen the evidence for our model.

All three reviewers were concerned about the conclusion that the MAPK pathway regulates degradation: They ask for clarification on the degradation and turnover analyses, that lead to the conclusion that MKK4/7 promote axonal turnover of NMNAT2 and SCG10 post-injury. Reviewer 2 indicates that the lower rate of protein degradation could result from the degradation components being saturated with the high levels of NMNAT2 and SC10 seen in the MKK4/7/ depleted condition. Reviewer 3 asks whether this is due to axonal turnover depending on concurrent MAP kinase activity, or increased axonal loading overwhelming the normal course of degradation. A suggested experiment would involve increasing the levels of NMNAT2 and SCG10 in cells (to levels comparable to those seen with MKK4/7/ depletion) and show that the rate of degradation is unaltered.

We thank the reviewers for the suggestions. First, we demonstrate that acute treatment with JNK inhibitor slows the turnover rate of survival factors before there is time for a significant increase in the levels of NMNAT2 and SCG10 (Figure 5—figure supplement 1). This is very strong evidence that inhibiting this MAPK pathway is controlling NMNAT2 and SCG10 levels by slowing their turnover.

Second, we performed the experiment requested by the reviewers. We find that when we simultaneously overexpress NMNAT2 and SCG10 (to mimic the effects of MAPK inhibition) their turnover rate is indistinguishable from their turnover rate when wild type levels of protein are present (Figure 5—figure supplement 2). Hence, we have ruled out the hypothesis that the increased levels of survival factors have saturated the protein degradation machinery. Together, these two experiments strongly support our hypothesis that the MAPK pathway controls the levels of these survival factors by regulating their turnover rate.

Reviewer 3 asked for the FRET experiment to directly readout SARM, but believes that this would be challenging, and so we will not hold you to perform this experiment.

We appreciate that the reviewers recognize that this would be beyond the scope of this proposal.

Reviewer #1:

[…] 1) A major methodologic difference with the Yang et al. report is that the current study expresses bclxl in all cultures in which shRNA knock down is performed. (Subsection “Lentivirus Transduction”, "All cultures were treated with lentivirus expressing Bcl-XL to suppress non-specific shRNA toxicity). The authors note that this enhances the viability of neurons transfected with shRNA constructs. However, the Tessier-Lavigne group has reported that bclxl can promote axonal survival and prevent degeneration. Therefore, this overexpression could definitely alter the results throughout the study (all experimental figures with the exception of Figure 4 seem to be affected by this issue).

We addressed this point in detail above, and have included clarification of this topic so that readers will not be confused.

2) The results suggest that MAPK is needed for activation of SARM1, but once activated SARM functions independently of MAPK. IF this is true, then genetic epistasis experiments showing that MAPK is not needed for the activity of a constitutively active SARM, do not indicate that MAPK must be downstream of SARM. I believe there could indeed be a feedback loop. The authors considered, and rejected this possibility. The rejection of this model was based on evidence that MAPK regulates NMNAT2 in the absence of SARM. Again, this result is only problematic if the authors feel that there is a single input into this MAPK cascade.

All of our functional data are consistent with a linear model in which the MAPK pathway negatively regulates NMNAT2 levels to control SARM1 activation and subsequent NAD+ depletion. Because this simple model can explain all of the functional data, this is our preferred model. However, we certainly acknowledge that biology is complicated, and that additional regulatory mechanisms likely exist. We now discuss that SARM1-dependent activation of the MAPK pathway, although not necessary for the regulation of NMNAT2 and SCG10, could play an additional regulatory role in fine-tuning the process of axon degeneration.

3) In Figure 1, NAD and ATP are measured in axonal lysates following axotomy, but are instead measured in lysates of the whole cells after SARM dimerization. It is possible that MKK4/7 only alters NAD and ATP locally in axons, but does so both in response to axotomy or to SARM activation, Therefore the conclusion that MKK4/7 only alter NAD and ATP following axotomy and not following SARM activation is somewhat problematic.

We appreciate the suggestion and performed the suggested experiment. In our original submission we showed that MKK4/7 does not influence total neuronal NAD+ following SARM1-TIR dimerization. We now demonstrate that MKK4/7 do not influence local axonal NAD+ following SARM1- TIR dimerization. This finding is fully consistent with our prior result.

4) I think that genetic epistatis experiments are very useful, but it is also important to examine directly activation of individual components. Does activated SARM stimulate the DLK/Mkk4/JNK pathway? To address this question, the authors should look at phosphorylation or catalytic activity of pathway components as an indicator that the MAPK cascade is activated. This is particularly important since the genetic epistasis experiments are not all consistent, and it is likely that many of the pathway components have multiple functions.

We have discussed this above. We now confirm the finding of Yang et al. that activation SARM1 can activate the MAPK stress pathway. We now incorporate this finding into our Discussion.

Reviewer #2:

[…] 1) The differences in results between this manuscript and the Yang 2015 paper are significant and there does not seem to be any straightforward explanation for this. The Yang 2015 paper shows that both MKK4/7 depletion and JNK1/2/3 depletion prevented active Sarm1-induced axon degeneration. Since the results in his manuscript show that MKK4/7 depletion did not block axon degeneration in the context of direct Sarm activation, the authors should also examine whether similar results are obtained with JNK depletion (or inhibition).

We repeated the SARM1-TIR experiment using JNK inhibitor and find that, like MKK4/7 depletion, JNKi does not block axon degeneration induced by direct SARM1 activation. This result has been incorporated into the Results section and fully supports our model.

2) In Figure 3E, it appears as though MKK4/7 depletion may also decrease Sarm1 levels. Can the authors comment on this observation? If this is indeed the case, then decreasing levels of Sarm1 could be another mechanism by which MKK4/7 depletion may protect axon degeneration.

We thank the reviewer for this observation. After quantifying 6 blots, we find that there is no significant change in SARM1 levels upon depletion of MKK4/7.

3) In Figure 5, the results showing that MKK4/7 depletion decreases the rate of NMNAT2 and SCG10 degradation is not convincing. For example, the lower rate of protein degradation could be because the degradation components are saturated with the high levels of NMNAT2 and SC10 seen in the MKK4/7/ depleted condition. To eliminate that possibility, one would need to increase the levels of NMNAT2 and SCG10 in cells (to levels comparable to those seen with MKK4/7/ depletion) and show that the rate of degradation is unaltered.

We appreciate the experimental suggestion. To address this concern, we have taken two approaches. First, as the reviewer suggested, we have overexpressed NMNAT2 and SCG10 to levels approximately 5 to 8-fold above endogenous levels (Figure 5—figure supplement 2). We find that the turnover rate of the overexpressed protein is comparable to endogenous conditions. Furthermore, we find that acute treatment with JNK inhibitor, just 30 minutes prior to cycloheximide turnover experiments, is sufficient to increase the half-life of NMNAT2 (Figure 5—figure supplement 1). In this experimental paradigm, there is not enough time for extensive buildup of NMNAT2 or other proteins to impact the degradation machinery by their abundance, and instead argues that MAPKs are directly influencing protein turnover rate.

4) Have the authors considered increased transcription or translation as factors that could result in the increased accumulation of NMNAT2 or SCG10 in MKK4/7 depleted conditions? Since the title of this manuscript seems to imply turnover as the main mechanism, they need to be more rigorous to not only show convincing degradation data but also to eliminate the other possibilities.

We find that NMNAT2 and SCG10 transcripts are not elevated upon depletion of MKK4/7 by rt-PCR (measured transcripts from 3 independent experiments). Thus, taken together with the additional turnover data from point 3 above, we are confident to conclude that MAPKs influence the turnover rate of NMNAT2 and SCG10. As such, we think it would be inappropriate to remove ‘turnover’ from the title.

5) In the third paragraph of the subsection “MKK4/7 are necessary for NAD+ loss and axon degeneration after axotomy but not in response to constitutively active SARM1”, the authors conclude that MKK4/7 are "required" for NAD depletion after axotomy. Perhaps it is more accurate to state that MKK4/7 is important for NAD depletion after axotomy (since NAD levels are decreased nearly 50% even in the sh4/7 condition; Figure 1A).

We have changed the text to reflect this change.

Reviewer #3:

[…] a) Although the epistasis is convincing, in general a direct readout of SARM would be very powerful. This would allow testing whether activating or inactivating MAP kinase signaling is sufficient to activate SARM, independently of axon injury. Perhaps this could be done with a FRET reporter for SARM conformation.

We agree that a FRET reporter for SARM1 activation would have numerous experimental applications. We appreciate that the reviewers find this to be beyond the scope of this study.

b) The experiments in cultured cells and flies suggest that MAP kinase signaling is active even in uninjured neurons, and acts to limit levels of axon survival factors. This is a surprising result that needs more discussion. Can MAP kinase signaling be blocked acutely? How quick is the resulting accumulation of NMNAT2 and SCG10?

We include a time course of NMNAT2 and SCG10 levels after treatment with JNK inhibitor in a new Figure 3C. We observe an increase of NMNAT2 and SCG10 levels within two hours of JNK inhibitor treatment.

c) An important conclusion is that MKK4/7 promote axonal turnover of NMNAT2 and SCG10 post-injury. However, in these experiments the initial amount of NMNAT2 and SCG10 is greatly increased. Thus, it is impossible to know whether axonal turnover really depends on concurrent MAP kinase activity, or whether increased axonal loading overwhelms the normal course of degradation. Perhaps these proteins could be overexpressed to mimic what happens in the MKK4/7 knockdown, and then turnover after injury could be measured.

This was the same suggestion made by reviewer 2 and is addressed above.

d) In the final experiment, NMNAT2 is shown to be downstream of MKK4/7, but not SARM. I have concerns about the interpretation. For NMNAT2, the data do show that "NMNAT2 is required for the axonal protection afforded by MKK4/7 knockdown", as stated, but not that "the protective effect of inhibiting MAPK signaling is conferred by elevated levels of NMNAT2" (subsection “MAPK signaling promotes axonal degeneration via regulation of survival factors”, first paragraph). In fact, the proposed model also includes SGC10, and there may be other protective effectors as well.

While our data demonstrate that NMNAT2 is required for the protective effect afforded by MKK4/7 knockdown, we have modified the text to note that SCG10 and other protective factors may also play a role in MAPK-mediate axon degeneration.

[Editors' note: the author responses to the re-review follow.]

Essential revisions:

Reviewer 3 asks that some of the key data be included in the revised manuscript, either in the main or figure supplements. This reviewer believes that including the following data in figures is important, especially as some of the data directly address and sometimes contradict the published data from Yang et al.

a) You repeated the SARM1-TIR experiment using JNK inhibitor and found that, like MKK4/7 depletion, JNKi did not block axon degeneration induced by direct SARM1 activation. In particular, these data should be in the main figures.

This is now included as Figure 2C.

b) You report that NMNAT2 and SCG10 transcripts were not elevated upon depletion of MKK4/7 by RT-PCR. Based on this result, and the turnover data, you conclude that MAPKs influence the turnover rate of NMNAT2 and SCG10. Since this result is important for the overall conclusion of the manuscript, it would be important to also show it in a figure.

This is now included as Figure 5B.


Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

RESOURCES