Abstract
Purpose
We have found that expression of γδT cells is increased in pathological mucosa of chronic rhinosinusitis with nasal polyps (CRSwNP) compared with normal nasal mucosa. This increase is correlated with the infiltration of eosinophils in CRSwNP. Here, we investigated the expression of γδT cells, inflammation and tissue remodeling factors as well as their probable relationships in different types of chronic rhinosinusitis (CRS) in China.
Methods
A total of 76 surgical tissue samples that included 43 CRSwNP samples (15 eosinophilic and 28 non-eosinophilic), 17 CRS samples without nasal polyps (CRSsNP), and 16 controls were obtained. Quantitative reverse transcription-polymerase chain reaction (RT-PCR) was used to measure the mRNA expression levels of Vγ1+ γδT cells, Vγ4+ γδT cells, eosinophil cationic protein (ECP), interleukin (IL)-8, transforming growth factor (TGF)-β2, metalloproteinase (MMP)-7, tissue inhibitor of metalloproteinase (TIMP)-4 and hypoxia-inducible factor (HIF)-1α. Enzyme linked immunosorbent assay (ELISA) was used to measure the protein level of ECP and MMP-7 in CRSwNP. The eosinophils were counted and the level of edema was analyzed with HE staining.
Results
The mRNA expression levels of the Vγ1 subset, ECP and MMP-7 were significantly increased in CRSwNP with histological characteristics of eosinophilic infiltration and edema. The expression of the Vγ1 gene in CRSwNP correlated positively with the expression of both ECP and MMP-7. No significant decreases in the mRNA expression levels of TGF-β2, TIMP-4 or HIF-1α were observed in the CRSwNP samples. The expression levels of Vγ1 gene, ECP and MMP-7 were significantly increased in eosinophilic CRSwNP compared to non-eosinophilic CRSwNP.
Conclusions
Our results suggest the associations between Vγ1+ γδT cells, ECP and MMP-7 in CRSwNP, indicating that Vγ1+ γδT cells can induce the eosinophilic inflammation, which has a further effect on the formation of edema.
Keywords: Chronic rhinosinusitis, nasal polyps, γδT cells, inflammation, tissue remodeling
INTRODUCTION
Chronic rhinosinusitis (CRS) is one of the most common chronic diseases, with an estimated prevalence of 12% in the United States.1 CRS has a substantial influence on the quality of life and is a burden to the social economy.2 Clinically, there are 2 types of CRS: chronic rhinosinusitis without nasal polyps (CRSsNP) and chronic rhinosinusitis with nasal polyps (CRSwNP). These different types of CRS have distinct inflammatory features and tissue remodeling patterns. CRSsNP is characterized predominantly by a T-helper type 1 (Th1)-induced neutrophilic inflammation with elevated expressions of transforming growth factor (TGF)-β1 and tissue inhibitors of metalloproteinase (TIMPs), which result in remodeling that includes excessive extracellular matrix (ECM) deposition, interstitial fibrosis, basement membrane thickening and goblet cell hyperplasia without obvious pseudocyst formation.3 CRSwNP is featured by a T-helper type 2 (Th2)-skewed eosinophilic inflammation that involves prominent edema formation and a decreased level of TGF-β1, which lead to fibrosis and increased levels of metalloproteinases (MMPs), which in turn lead to pseudocyst formation.3 According to the inflammatory pattern, CRSwNP is further divided into eosinophilic CRSwNP (Eos CRSwNP) and non-eosinophilic CRSwNP (non-Eos CRSwNP). There are differences between the two subtypes of CRSwNP. Non-Eos CRSwNP is more likely to involve neutrophilic inflammation and fibrosis and shares some of the characteristics of both CRSsNP and Eos CRSwNP.3 The exact mechanisms responsible for the differences remain unclear.
γδT cells are a small but distinctive subset of T cells that were first recognized by Brenner in 1986.4 These cells primarily colonize in the mucosa and skin where they play an important role in immune regulation.4 γδT cells have been suggested to mediate inflammatory cell infiltration and remodeling in a murine model via interleukin (IL)-17A, which has been proven to be a crucial regulator of cardiac fibrosis.5,6,7,8 However, the links between γδT cells, inflammation and tissue remodeling in CRS appear to be unknown.
In our previous study, we found that the expression of γδT cells is elevated in the pathological mucosa of CRSwNP compared with normal nasal mucosa and that γδT cell expression is positively correlated with the infiltration of eosinophils in Eos CRSwNP.9
Previous studies have shown that different subsets of γδT cells play distinct roles. The Vγ1 subset has been demonstrated to promote inflammation particularly due to the enhancement of eosinophilic infiltration via Th2 cytokines and airway hyperresponsiveness (AHR).10 The Vγ4 subset has been demonstrated to suppress inflammation.10 Our studies have indicated that Vγ1+ γδT cells might be a dominant subset in the nasal mucosa of CRSwNP.9 However, whether similar mechanisms are responsible for the pathogenesis of CRS or not remains unclear. Thus, the present work aimed to investigate the relationships between γδT cells, particularly the Vγ1 subset, inflammation and tissue remodeling in different types of CRS.
MATERIALS AND METHODS
Subjects and study design
A total of 76 patients were selected from the inpatients (between 2011 and 2014) of the Department of Otolaryngology-Head and Neck Surgery, the Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, China. The subjects included 17 with CRSsNP, 43 with CRSwNP (15 with Eos CRSwNP and 28 with non-Eos CRSwNP), and 16 control subjects. Detailed characteristics of these subjects are provided in Table 1. The diagnoses and classification of CRS were based on the European Academy of Allergy and Clinical Immunology (EAACI) guidelines (EPOS2012).11 Patients with allergic diseases, fungal rhinosinusitis, or severe pulmonary and cardiac diseases were excluded from this study. None of the enrolled patients had histories of surgery or the use of corticosteroids or antibiotics within the month prior to surgery. The nasal polyps (NPs), diseased ethmoid sinus mucosa or uncinate processes of the patients with CRS were collected during functional endonasal sinus surgery as the case group. The normal nasal mucosa of the inferior turbinate, ethmoid sinus or uncinate process were taken from the patients with deviations of the nasal septum, cerebrospinal fluid rhinorrhea or traumatic optic neuropathy who presented with no sinus inflammation as the control group. All tissue samples were stored as duplicates at -80℃ after rapid freezing in liquid nitrogen; one sample was used for quantitative reverse transcription-polymerase chain reaction (qRT-PCR), and the other was used for histological analysis. CRSwNP was regarded as eosinophilic when the percentage of eosinophils in the tissue exceeded 10% of total infiltrating cells as mentioned elsewhere.12
Table 1. Clinical data of the subjects.
| Characteristics | Control | CRSsNP | Non-Eos CRSwNP | Eos CRSwNP |
|---|---|---|---|---|
| Subjects, n | 16 | 17 | 28 | 15 |
| Age (yr), mean±SD | 34.2±16.0 | 40.9±15.9 | 33.1±16.8 | 42.7±13.8 |
| Sex: female/male, n | 8/8 | 5/12 | 6/22 | 7/8 |
| Smoking, n (%) | 2 (12.5) | 5 (29.4) | 7 (25.0) | 3 (20.0) |
| CT score (Lund-Mackay), mean±SD | 0.8±1.7 | 8.1±3.1 | 11.9±7.0 | 12.3±6.4 |
CRS, chronic rhinosinusitis; CRSsNP, CRS without nasal polyps; non-Eos CRSwNP, non-eosinophilic CRS with nasal polyps; Eos CRSwNP, eosinophilic CRSwNP; n, number; SD, standard deviation; CT, computed tomography.
This study was approved by the Ethical Committee of the Third Affiliated Hospital of Sun Yat-sen University (File No. [2013] 2-9). All patients were informed of the purposes and procedures of the study and provided written informed consent.
Quantitative RT-PCR
The total RNA of each tissue sample was extracted using RNAiso Plus (TaKaRa, Dalian, Japan) and reverse-transcribed to cDNA with random hexamer primers and RT-PCR kits (TaKaRa DDR036S, Dalian, Japan). The Vγ1 and Vγ4 subsets of κ cells and the levels of eosinophil cationic protein (ECP), IL-8, TGF-β2, MMP-7, TIMP-4, hypoxia-inducible factor (HIF)-1α cytokines were detected. PCR was performed with an ABI 7500 FAST instrument (Foster City, CA, USA) using a SYBR Premix Ex Taq kit (TaKaRa DDR420A, Dalian, Japan) with the appropriate primers (Table 2) as reported elsewhere.3,13,14 The relative gene expressions were calculated with the comparative CT method. β2 microglobulin (β2M) was used as the housekeeping gene for normalization, and a no-template sample was used as the negative control.
Table 2. Primers for quantitative RT-PCR analysis.
| Gene | Sequence |
|---|---|
| Vγ1 | (F)TACCTACACCAGGAGGGGAAG |
| Vγ4 | (F)GATTGCTCAGGTGGGAAGACT |
| Cγ | (R)GTTGCTCTTCTTTTCTTGCC |
| ECP | (F)5'-TCGGAGTAGATTCCGGGTG-3' |
| (R)5'-GAACCACAGGATACCGTGGAG-3' | |
| IL-8 | (F)5'-GAATGGGTTTGCTAGAATGTGATA-3' |
| (R)5'-CAGACTAGGGTTGCCAGATTTAAC-3' | |
| TGF-β2 | (F)5'-CTCCTACAGACTTGAGTCACAAC-3' |
| (R)5'-CTCCATAAATACGGGCATGCTCC-3' | |
| MMP-7 | (F)5'-GAGGCATGAGTGAGCTACAGTG-3' |
| (R)5'-CATCTCCTTGAGTTTGGCTTCT-3' | |
| TIMP-4 | (F)5'-TTTTGACTCTTCCCTCTGTGGT-3' |
| (R)5'-CTGTGTAGCAGGTGGTGATTTG-3' | |
| HIF-1α | (F)5'-CAGCCGCTGGAGACACAATC-3' |
| (R)5'-TTTCAGCGGTGGGTAATGGA-3' | |
| β2M | (F)5'-TACACTGAATTCACCCCCAC-3' |
| (R)5'-CATCCAATCCAAATGCGGCA-3' |
RT-PCR, reverse transcription-polymerase chain reaction; Vγ1, Vγ4, subsets of κ cells; Cγ, reverse sequence of both Vγ1 and Vγ4; ECP, eosinophil cationic protein; IL-8, interleukin-8; TGF-β2, transforming growth factor-β2; MMP-7, metalloproteinase-7; TIMP-4, tissue inhibitor of metalloproteinase-4; HIF-1α, hypoxia-inducible factor-1α; β2M, β2 microglobulin.3,13,14
Elisa for ECP and MMP-7 in CRSwNP
Tissue samples were grinded in mortar with liquid nitrogen, then each tissue dry powder was weighed, and 100 µL PBS supplemented with 10% protease inhibitor cocktail (MedChem Express, Shanghai, China) was added per 10 mg tissue. After homogenization, the suspensions were centrifuged at 3,000 rpm for 15 minutes at 4℃. Supernatants were separated and stored at -80℃ until analyzed.
ECP (Cusabio Biotech, CSB-E11729h, Wuhan, China) and MMP-7 (OriGene Technologies, EA100322, Beijing, China) levels were measured with commercially available ELISA kits. The minimal detection limits for these kits are 1.560 and 0.156 ng/mL, respectively. All procedures followed the manufacturer's recommendations. Concentrations of ECP and MMP-7 in the tissue homogenate were normalized to the concentration of total protein.
Histological analysis
For histological analysis, each sample was fixed in 10% neutral buffered formalin and subsequently embedded in paraffin. Paraffin sections (5 mm) were stained with hematoxylin and eosin (HE) dyes. All of the stained sections were examined by 2 independent physicians who were blind to the clinical data. Eosinophils were counted under high-power (HP) magnification (400-fold). Five fields per sample were randomly selected for analysis. The sample was regarded as Eos CRSwNP when the percentage of eosinophils exceeded 10% of the total infiltrating cells.12 The HE-stained sections were used to determine the general pathologic features at 200-fold magnification. According to Hellquist's classification, each tissue sample was classified as edematous, glandular hyperplastic, fibrotic, or atypical based on the remodeling features.15 A 3-point scale was used to semiquantitatively score the level of edema; 0 represented the least amount of edema, and 2 indicated the most extensive edema.16
Statistical analysis
The statistical analyses were performed with SPSS 16.0 (SPSS Inc., Chicago, IL, USA). For the continuous variables, the results are expressed as the medians and interquartile ranges or with Tukey box-and-whisker plots. The Kruskal-Wallis H-test was used to assess the significance of intergroup variability. Two-tailed Mann-Whitney U tests were used for between group comparisons. The differences in proportions between groups were evaluated with χ2 tests. Bonferroni corrections were applied to adjust for multiple comparisons (i.e., α=0.05/3=0.016). Spearman tests were used to examine the correlations. The level of significance was set at P<0.05.
RESULTS
The expression of Vγ1 gene was elevated in the CRSwNP samples
Vγ1 and Vγ4 genes were detected in this study, and the differences between the groups were significant (P=0.005). The expression of Vγ1 gene in the CRSwNP samples was significantly greater than those in the CRSsNP and control samples, and no significant difference between the CRSsNP and control samples was observed (Fig. 1A). Furthermore, as illustrated in Fig. 1B, no significant differences of Vγ4 gene were observed between the groups.
Fig. 1. The relative mRNA expression levels for Vγ1+ κ cells, Vγ4+ κ cells, ECP, IL-8, TGF-β2, MMP-7, TIMP-4, and HIF-1α.
Vγ1, Vγ4, subsets of κ cells; ECP, eosinophil cationic protein; IL-8, interleukin-8; TGF-β2, transforming growth factor-β2; MMP-7, metalloproteinase-7; TIMP-4, tissue inhibitor of metalloproteinase-4; HIF-1α, hypoxia-inducible factor-1α.
The expression of ECP was elevated in CRSwNP
Fig. 1C illustrates the relative expression levels of ECP in the different groups. This level was significantly increased in the CRSwNP samples, and a significant difference between groups was detected (P=0.002). Moreover, the expression of IL-8 varied significantly between groups (P=0.008), and the difference between the CRSsNP and control groups was significant (Fig. 1D). No significant differences between the other groups were observed.
The expression of MMP-7 was increased in the CRSwNP samples
Similarly, significant differences in MMP-7 expression between groups were detected (P=0.003). The relative expression level of MMP-7 in the CRSwNP samples was significantly greater than those of the other two groups (Fig. 1E). Nevertheless, no significant differences were observed when we compared the relative mRNA expression levels of TGF-β2, TIMP-4, and HIF-1α across the groups (Fig. 1F-H).
CRSwNP was primarily characterized by correlated eosinophils infiltration and edema
The inflammatory type of CRSwNP was proven to be associated with eosinophilic infiltration compared to CRSsNP (Fig. 2). First, a significant between-group difference was detected (p<0.001). The eosinophils accounted for a greater percentage of the total inflammatory cells in the CRSwNP samples than in the CRSsNP samples (P=0.038) and the control samples (p<0.001), and the percentage of eosinophils in the CRSsNP samples was also significantly greater than in the control samples (p<0.001; Fig. 3B). Additionally, the proportion of Eos CRSwNP in the CRSwNP samples was 34.9% (15/43), and the proportion of non-Eos CRSwNP was 65.1% (28/43).
Fig. 2. A large amount of eosinophil infiltration in the subepithelial tissue of a CRSwNP sample compared to CRSsNP and control (HE-stained section). (A) CRSwNP: epithelial cell damage and basement membrane thickness (200× magnification). (B) CRSwNP: eosinophils scattered in the subepithelial tissue with pseudocyst formation and edema, a lack of collagen and the disappearance of blood vessels and glands (400× magnification). (C) CRSsNP: lymphocytes and neutrophils scattered with increased collagen and fibrosis (400× magnification). (D) Control: normal nasal mucosa (400× magnification of a control sample).
CRSwNP, chronic rhinosinusitis with nasal polyps; CRSsNP, chronic rhinosinusitis samples without nasal polyps; HE, hematoxylin and eosin.
Fig. 3. Semiquantitative edema scores and eosinophil infiltrations in the different CRS types and controls. (A) Edema: the semiquantitative score of the severity of edema. (B) Eosinophil: the percentage of eosinophils relative to the total inflammatory cells.
CRS, chronic rhinosinusitis.
The semiquantitative edema scores were also assessed. The edema scores of the CRSwNP and CRSsNP samples were significantly greater than those of the control samples (p<0.001 and P=0.001, respectively), and the scores for the CRSwNP samples were greater than those for the CRSsNP samples, although this difference was not statistically significant (Fig. 3A).
Positive correlations were observed between the percentages of eosinophils and edema scores (rs=0.482, p<0.001).
According to the abovementioned Hellquist's classification, the majority of the histological patterns observed in the CRS tissue samples were fibrotic and edematous types, a small number of samples showed the glandular hyperplastic type, and none of the samples showed the atypical type (Fig. 4). The edematous type was more frequently observed in the CRSwNP samples (46.5%) than the CRSsNP samples (29.4%). The proportion of edematous-type CRSwNP was similar to that of fibrotic-type samples (51.2%). Moreover, the primary type of CRSsNP was the fibrotic one (58.8%). When the CRSwNP samples were further classified as non-Eos CRSwNP and Eos CRSwNP according the number of eosinophils as previously mentioned, the edematous type was found to be more frequent among the Eos CRSwNP samples (66.7%) than the non-Eos CRSwNP (35.7%) and CRSsNP samples. The percentage of fibrotic-type Eos CRSwNP (33.3%) was much lower than that of the other 2 groups;, i.e., the non-Eos CRSwNP (60.7%) and CRSsNP more frequently presented as the fibrotic type. There were no significant differences between the groups.
Fig. 4. Hellquist's classification of CRS. HE-stained tissue sections at 200× magnification. (A) Edematous type: subepithelial edema, a lack of collagen, and the disappearance of glands and blood vessels with inflammatory cell infiltration. (B) Fibrotic type: thickened basement membrane, subepithelial collagen deposition, and inflammatory cell infiltration. (C) Glandular hyperplastic type: increased amounts of glands and blood vessels.
CRS, chronic rhinosinusitis; HE, hematoxylin and eosin.
The relationships of κ cells, inflammation and remodeling
The correlations between the percentage of eosinophils and the mRNA expression level of ECP, as well as the mRNA expression levels of ECP and MMP-7 were examined to identify positive correlations, and the results are illustrated in Fig. 5. Similar outcomes were obtained when the same analysis was applied to Vγ1+ κ cells, ECP and MMP-7. The relative expression level of Vγ1 gene was positively correlated with those of ECP and MMP-7.
Fig. 5. Correlations between κ cells, inflammation and remodeling. (A) The correlation coefficient for the relationship of Eos and ECP: rs=0.386, 0.011≤p<0.05. (B) The correlation coefficient for the association between MMP-7 and ECP: rs=0. 418, 0.030≤p<0.05. (C) The correlation coefficient for the association between ECP and Vγ1+ κ cells: rs=0.368, 0.019≤p<0.05. (D) The correlation coefficient for the association between MMP-7 and Vγ1+ κ cells: rs=0.353, 0.032≤ p<0.05. The data (x) regarding the relative mRNA expression levels of ECP, MMP-7 and Vγ1+ κ cells were transformed with same equation {x′=log10 (105x+1)}.
Eos, eosinophils; ECP, eosinophil cationic protein; MMP-7, metalloproteinase-7.
The expression level of Vγ1 gene, ECP and MMP-7 in Eos CRSwNP and non-Eos CRSwNP
The relative mRNA expression level for Vγ1+ κ cells was significantly increased in Eos CRSwNP compared to non-Eos CRSwNP. Moreover, the protein levels of both ECP and MMP-7 in Eos CRSwNP were significantly increased compared to non-Eos CRSwNP (Fig. 6).
Fig. 6. The relative mRNA expression levels for (A) Vγ1+ κ cells, (B) the protein level of ECP, and (C) MMP-7 in Eos CRSwNP compared to non-Eos CRSwNP.
ECP, eosinophil cationic protein; MMP-7, metalloproteinase-7; CRSwNP, chronic rhinosinusitis with nasal polyps; non-Eos CRSwNP, non-eosinophilic CRSwNP.
DISCUSSION
Based on the differential expression of the T cell receptor (TCR), T cells are divided into αβT and κ cell subsets. αβT cells are primarily peripheral blood mononuclear cells, and κ cells account for less than 10% (approximately 3%–5%) of all lymphoid cells in the secondary lymphoid tissues and blood.17 κ cells are a distinctive subset of T cells. Nevertheless, κ cells are much more prevalent in mucosal and epithelial sites. In these sites, κ cells comprise as much as 50% of the total intraepithelial lymphocyte populations.18 These cells play an important role in innate immune responses, which ultimately lead to adaptive immune responses. These cells are the first immune cells that are found in the fetus and provide immunity to newborns prior to the activation of the adaptive immune system.19 Subsets of κ cells have been found in both mice and humans. The distinct subsets of κ cells with different γ and ® TCR chains that colonize specific epithelial locations in diseases of the lungs, intestines, skin, uterus, vagina and tongue need to be identified.17,20,21,22,23,24 As the epithelial cells of nasal mucosa is the first mechanical barrier of the airway, it has a great effect on the mucosal immune system. Therefore, κ cells are likely to act on the pathological process of CRS.
Distinct histological features were present in different types of CRS. Previous studies based on Caucasian patients have suggested that CRSwNP is primarily characterized by eosinophilic inflammation and edematous remodeling patterns.2,25 However, this situation is different from that of Asian patients. Recently, a few studies based on Asians have shown that minor eosinophilic inflammation accounts for the distinctive features of CRSwNP.16,26,27 Moreover, the expanding racial differences that have been reported indicate that Caucasian patients with CRSwNP and comorbid asthma are more common than Chinese patients with both conditions.28 Studies have shown that the NP samples from Caucasians exhibit Th2-skewed and eosinophilic inflammation patterns, and NP samples from Chinese people exhibit both Th1/Th17 and Th2 cell patterns with neutrophilic and eosinophilic inflammation.12,16,27 In the present study, the CRSwNP samples from Chinese patients also exhibited similar characteristics and a greater proportion of non-eosinophilic inflammatory patterns. Moreover, it is noteworthy that evidence indicates that κ cells participate in Th2 immune responses. In contrast, the available data suggest that a small fraction of κ cells act as effective suppressors.10,29,30 Taken together, distinct subsets of κ cells likely produce certain cytokines that induce the infiltration of different inflammatory cells, such as eosinophils and neutrophils. However, the functions and capacities are not yet clear.
Correspondingly, our previous reports proved that κ cell numbers are increased in CRSwNP pathological mucosa and positively correlated with the infiltration of eosinophils. The Vγ1 gene expression is also increased in CRSwNP pathological mucosa.9 A study conducted by Hahn et al.10 demonstrated similar results; these authors found that Vγ1+ κ cells appeared to strongly enhance AHR and airway inflammation, whereas Vγ4+ κ cells unambiguously suppressed AHR. The mRNA expression of Vγ1+ κ cells was proven to positively correlate with that of ECP in CRSwNP in the present study, but the expression of Vγ4+ κ cells was not found to be negatively correlated with either ECP or eosinophils. Again, these findings support the hypothesis that distinct subsets of κ cells can be inhibitors or enhancers depending on the specific γ and ® TCR chains. Additional support for this notion is provided by the increasing number of studies based on murine models or humans that suggest that κ cells mediate inflammatory cell infiltration and remodeling in many diseases, such as liver inflammation and fibrosis, cardiac fibrosis, lung inflammation, asthma, allergic rhinitis, psoriasis and atopic dermatitis.5,6,24,31,32 However, studies of the relationships of κ cells, inflammation and remodeling in CRS are scarce. Hence, additional observations and data are needed to address this question.
Tissue remodeling is a dynamic process that is closely related to the extracellular matrix (ECM). If the balance between the formation and degradation of the ECM is disrupted, the rebuilding process occurs. When the body is attacked by exogenous or endogenous stimulation, the immune system promotes the accumulation and production of inflammatory cells including eosinophils, which are activated to release a variety of proteins and cytokines, including ECP, TGF-β, MMPs, TIMPs and ILs. Eosinophils and ECP have been clearly suggested to initiate the formation of edema. Flood-Page et al.33 showed that anti-IL-5 treatment reduces eosinophils and fibrosis in the airways of asthmatics. Moreover, TGF-β has been indicated to be a key regulator of ECM production and tissue remodeling, whereas MMPs are known to be important regulators of the degradation of the ECM. Matrilysin MMP-7 is upregulated, which disturbs the tissue homeostasis and progresses to the formation of edema. TIMPs act as inhibitors of MMPs. Finally, all of these confounding and multiple regulators may ultimately contribute to tissue remodeling.3,34 Eosinophilic inflammation with the index by ECP can lead to the downregulation of TGF-β1 and TGF-β2, and the decreased expression of TIMP-4. Without the inhibitor of MMPs, the activity of MMP-7 and MMP-9 increased, which promoting degradation of ECM and formation of edema.3,12,35 And vice versa, neutrophilic inflammatory may release IL-8 and lead to the increased expression of TGF-β1 and TGF-β2, as well as TIMP-4, which finally result in the deposition of collagen and fibrosis.3,35 Moreover, studies have shown that under anoxic conditions, HIF-1α distributed in the airway of patients can be activated and lead to epithelial-to-mesenchymal transition.36
The current study revealed that the general histological features of CRSwNP are characterized by correlated edema and eosinophil infiltration, with the increased expressions of Vγ1+ κ cells, ECP, and MMP-7, and a positive correlation between the two. No significant difference in the expressions of Vγ4+ κ cells was observed in the different groups. As previously mentioned, Vγ4 mRNA expression should have decreased. The failure to observe this phenomenon might have been due to the patients themselves or the progression of chronic disease. In long-term CRS, the body has defended against the course of disease and has received some treatment. Furthermore, no significant increases in the mRNA expression levels of TGF-β2, TIMP-4 or HIF-1α were found in the CRSsNP samples in this study, and these results are inconsistent with the results of other studies.3,35 Because the mRNA expression levels of these regulators in mucosa are minimal, and the majority of the CRSwNP samples belonged in the non-eosinophilic subset, there were no substantial differences between the CRSwNP and CRSsNP groups.
Thus, these results indicate that κ cells may play a role in the mechanism of CRS pathogenesis which should not to be ignored. Moreover, these distinct cells appear to mediate eosinophil infiltration and eventually lead to the formation of edema in CRS. However, the detailed mechanisms remain unclear.
It has been suggested that κ cells are activated in the presence of pathogens, antigens and stimulation by damage-associated molecular patterns (DAMPs) because macrophages promote NF-πB signaling that results in the release of IL-23, which is recognized by the corresponding receptor IL-23R of the κ cells and activates nuclear translocator RORγt to produce IL-17A. This process leads to inflammatory cell infiltration or recruitment, which eventually causes edema or fibrosis.5,6,37 IL-17A has been suggested to induce MMPs secretion.36 Several studies have demonstrated that IL-17A upregulates Th2 cell-mediated eosinophilic airway inflammation and plays an important role in the remodeling of nasal polyps.37,38 Additional evidence found in our previous study indicated that the expression of IL-17A is upregulated in CRSwNP. However, the role and the related mechanisms of IL-17A in remodeling have not been fully elucidated. Therefore, all of the current studies have demonstrated the potential significant mechanism by which κ cells are related to inflammation and remodeling in CRS. In addition to benefiting scientific research, these findings provide another pathway for the management and intervention for CRS patients. However, the mechanisms underlying IL-17A production and the roles of IL-17A in inflammation and the early damage and remodeling of the mucosa in CRS remain unclear.
The significance of κ cells in the pathogenesis of CRS and their effects on inflammation and remodeling require further investigations and evidences in murine models and humans.
ACKNOWLEDGMENTS
This study was supported by the Program of National Natural Science Foundation of China (NSFC 81371073) and Science and Technology Planning Project of Guangdong Province, China (2013B021800081).
References
- 1.Blackwell DL, Lucas JW, Clarke TC. Summary health statistics for U.S. adults: national health interview survey, 2012. Vital Health Stat. 2014;10:1–161. [PubMed] [Google Scholar]
- 2.Fokkens WJ, Lund VJ, Mullol J, Bachert C, Alobid I, Baroody F, et al. European position paper on rhinosinusitis and nasal polyps 2012. Rhinology. 2012;50(Suppl 23):1–298. [PubMed] [Google Scholar]
- 3.Shi LL, Xiong P, Zhang L, Cao PP, Liao B, Lu X, et al. Features of air-way remodeling in different types of Chinese chronic rhinosinusitis are associated with inflammation patterns. Allergy. 2013;68:101–109. doi: 10.1111/all.12064. [DOI] [PubMed] [Google Scholar]
- 4.Brenner MB, McLean J, Dialynas DP, Strominger JL, Smith JA, Owen FL, et al. Identification of a putative second T-cell receptor. Nature. 1986;322:145–149. [PubMed] [Google Scholar]
- 5.Yan X, Shichita T, Katsumata Y, Matsuhashi T, Ito H, Ito K, et al. Deleterious effect of the IL-23/IL-17A axis and gammadeltaT cells on left ventricular remodeling after myocardial infarction. J Am Heart Assoc. 2012;1:e004408. doi: 10.1161/JAHA.112.004408. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Li Y, Wu Y, Zhang C, Li P, Cui W, Hao J, et al. γδT cell-derived interleukin-17A via an interleukin-1β-dependent mechanism mediates cardiac injury and fibrosis in hypertension. Hypertension. 2014;64:305–314. doi: 10.1161/HYPERTENSIONAHA.113.02604. [DOI] [PubMed] [Google Scholar]
- 7.Chen D, Luo X, Xie H, Gao Z, Fang H, Huang J. Characteristics of IL-17 induction by Schistosoma japonicum infection in C57BL/6 mouse liver. Immunology. 2013;139:523–532. doi: 10.1111/imm.12105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Hammerich L, Tacke F. Role of gamma-delta T cells in liver inflammation and fibrosis. World J Gastrointest Pathophysiol. 2014;5:107–113. doi: 10.4291/wjgp.v5.i2.107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Li WT, Zhang GH, Li JJ, Chang LH, Wang K, Yang QT. Gammadelta T cell expression and significance in chronic rhinosinusitis. Zhonghua Er Bi Yan Hou Tou Jing Wai Ke Za Zhi. 2013;48:311–315. [PubMed] [Google Scholar]
- 10.Hahn YS, Taube C, Jin N, Sharp L, Wands JM, Aydintug MK, et al. Different potentials of gamma delta T cell subsets in regulating airway responsiveness: V gamma 1+ cells, but not V gamma 4+ cells, promote airway hyperreactivity, Th2 cytokines, and airway inflammation. J Immunol. 2004;172:2894–2902. doi: 10.4049/jimmunol.172.5.2894. [DOI] [PubMed] [Google Scholar]
- 11.Fokkens WJ, Lund VJ, Mullol J, Bachert C, Alobid I, Baroody F, et al. EPOS 2012: European position paper on rhinosinusitis and nasal polyps 2012. A summary for otorhinolaryngologists. Rhinology. 2012;50:1–12. doi: 10.4193/Rhino12.000. [DOI] [PubMed] [Google Scholar]
- 12.Cao PP, Li HB, Wang BF, Wang SB, You XJ, Cui YH, et al. Distinct immunopathologic characteristics of various types of chronic rhinosinusitis in adult Chinese. J Allergy Clin Immunol. 2009;124:478–484. 484.e1–484.e2. doi: 10.1016/j.jaci.2009.05.017. [DOI] [PubMed] [Google Scholar]
- 13.Li Y, Chen S, Yang L, Li B, Chan JY, Cai D. TRGV and TRDV repertoire distribution and clonality of T cells from umbilical cord blood. Transpl Immunol. 2009;20:155–162. doi: 10.1016/j.trim.2008.10.010. [DOI] [PubMed] [Google Scholar]
- 14.Hulin A, Deroanne CF, Lambert CA, Dumont B, Castronovo V, Defraigne JO, et al. Metallothionein-dependent up-regulation of TGF-beta2 participates in the remodelling of the myxomatous mitral valve. Cardiovasc Res. 2012;93:480–489. doi: 10.1093/cvr/cvr337. [DOI] [PubMed] [Google Scholar]
- 15.Hellquist HB. Nasal polyps update. Histopathology. Allergy Asthma Proc. 1996;17:237–242. [PubMed] [Google Scholar]
- 16.Zhang N, Van Zele T, Perez-Novo C, Van Bruaene N, Holtappels G, DeRuyck N, et al. Different types of T-effector cells orchestrate mucosal inflammation in chronic sinus disease. J Allergy Clin Immunol. 2008;122:961–968. doi: 10.1016/j.jaci.2008.07.008. [DOI] [PubMed] [Google Scholar]
- 17.Witherden DA, Havran WL. Molecular aspects of epithelial gammadelta T cell regulation. Trends Immunol. 2011;32:265–271. doi: 10.1016/j.it.2011.03.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Kabelitz D, Wesch D, Hinz T. Gamma delta T cells, their T cell receptor usage and role in human diseases. Springer Semin Immunopathol. 1999;21:55–75. [PubMed] [Google Scholar]
- 19.Sinkora M, Sinkorová J, Holtmeier W. Development of gammadelta thymocyte subsets during prenatal and postnatal ontogeny. Immunology. 2005;115:544–555. doi: 10.1111/j.1365-2567.2005.02194.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Chodaczek G, Papanna V, Zal MA, Zal T. Body-barrier surveillance by epidermal gammadelta TCRs. Nat Immunol. 2012;13:272–282. doi: 10.1038/ni.2240. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Jameson J, Havran WL. Skin gammadelta T-cell functions in homeostasis and wound healing. Immunol Rev. 2007;215:114–122. doi: 10.1111/j.1600-065X.2006.00483.x. [DOI] [PubMed] [Google Scholar]
- 22.Jameson JM, Cauvi G, Witherden DA, Havran WL. A keratinocyte-responsive gamma delta TCR is necessary for dendritic epidermal T cell activation by damaged keratinocytes and maintenance in the epidermis. J Immunol. 2004;172:3573–3579. doi: 10.4049/jimmunol.172.6.3573. [DOI] [PubMed] [Google Scholar]
- 23.Cairo C, Arabito E, Landi F, Casati A, Brunetti E, Mancino G, et al. Analysis of circulating gammadelta T cells in children affected by IgE-associated and non-IgE-associated allergic atopic eczema/dermatitis syndrome. Clin Exp Immunol. 2005;141:116–121. doi: 10.1111/j.1365-2249.2005.02813.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Krug N, Erpenbeck VJ, Balke K, Petschallies J, Tschernig T, Hohlfeld JM, et al. Cytokine profile of bronchoalveolar lavage-derived CD4(+), CD8(+), and gammadelta T cells in people with asthma after segmental allergen challenge. Am J Respir Cell Mol Biol. 2001;25:125–131. doi: 10.1165/ajrcmb.25.1.4194. [DOI] [PubMed] [Google Scholar]
- 25.Meltzer EO, Hamilos DL, Hadley JA, Lanza DC, Marple BF, Nicklas RA, et al. Rhinosinusitis: establishing definitions for clinical research and patient care. J Allergy Clin Immunol. 2004;114:155–212. doi: 10.1016/j.jaci.2004.09.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Kim JW, Hong SL, Kim YK, Lee CH, Min YG, Rhee CS. Histological and immunological features of non-eosinophilic nasal polyps. Otolaryngol Head Neck Surg. 2007;137:925–930. doi: 10.1016/j.otohns.2007.07.036. [DOI] [PubMed] [Google Scholar]
- 27.Zhang N, Holtappels G, Claeys C, Huang G, van Cauwenberge P, Bachert C. Pattern of inflammation and impact of Staphylococcus aureus enterotoxins in nasal polyps from southern China. Am J Rhinol. 2006;20:445–450. doi: 10.2500/ajr.2006.20.2887. [DOI] [PubMed] [Google Scholar]
- 28.Bachert C, Zhang N, Holtappels G, De Lobel L, van Cauwenberge P, Liu S, et al. Presence of IL-5 protein and IgE antibodies to staphylococcal enterotoxins in nasal polyps is associated with comorbid asthma. J Allergy Clin Immunol. 2010;126:962–968. 968.e1–968.e6. doi: 10.1016/j.jaci.2010.07.007. [DOI] [PubMed] [Google Scholar]
- 29.Huang Y, Jin N, Roark CL, Aydintug MK, Wands JM, Huang H, et al. The influence of IgE-enhancing and IgE-suppressive gammadelta T cells changes with exposure to inhaled ovalbumin. J Immunol. 2009;183:849–855. doi: 10.4049/jimmunol.0804104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Jinghong Z, Chaoqian L, Sujuan G, Yi L. Inhaled inactivated-Mycobacterium phlei modulates γδT cell function and alleviates airway inflammation in a mouse model of asthma. Asian Pac J Allergy Immunol. 2013;31:286–291. doi: 10.12932/AP0323.31.4.2013. [DOI] [PubMed] [Google Scholar]
- 31.Lo Re S, Dumoutier L, Couillin I, Van Vyve C, Yakoub Y, Uwambayinema F, et al. IL-17A-producing gammadelta T and Th17 lymphocytes mediate lung inflammation but not fibrosis in experimental silicosis. J Immunol. 2010;184:6367–6377. doi: 10.4049/jimmunol.0900459. [DOI] [PubMed] [Google Scholar]
- 32.Yokozeki H, Watanabe K, Igawa K, Miyazaki Y, Katayama I, Nishioka K. Gammadelta T cells assist alphabeta T cells in the adoptive transfer of contact hypersensitivity to para-phenylenediamine. Clin Exp Immunol. 2001;125:351–359. doi: 10.1046/j.1365-2249.2001.01570.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Flood-Page P, Menzies-Gow A, Phipps S, Ying S, Wangoo A, Ludwig MS, et al. Anti-IL-5 treatment reduces deposition of ECM proteins in the bronchial subepithelial basement membrane of mild atopic asthmatics. J Clin Invest. 2003;112:1029–1036. doi: 10.1172/JCI17974. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Figueiredo CR, Silva ID, Weckx LL. Inflammatory genes in nasal polyposis. Curr Opin Otolaryngol Head Neck Surg. 2008;16:18–21. doi: 10.1097/MOO.0b013e3282f363f1. [DOI] [PubMed] [Google Scholar]
- 35.Li X, Meng J, Qiao X, Liu Y, Liu F, Zhang N, et al. Expression of TGF, matrix metalloproteinases, and tissue inhibitors in Chinese chronic rhinosinusitis. J Allergy Clin Immunol. 2010;125:1061–1068. doi: 10.1016/j.jaci.2010.02.023. [DOI] [PubMed] [Google Scholar]
- 36.Li G, Zhang Y, Qian Y, Zhang H, Guo S, Sunagawa M, et al. Interleukin-17A promotes rheumatoid arthritis synoviocytes migration and invasion under hypoxia by increasing MMP2 and MMP9 expression through NF-kappaB/HIF-1alpha pathway. Mol Immunol. 2013;53:227–236. doi: 10.1016/j.molimm.2012.08.018. [DOI] [PubMed] [Google Scholar]
- 37.Saitoh T, Kusunoki T, Yao T, Kawano K, Kojima Y, Miyahara K, et al. Role of interleukin-17A in the eosinophil accumulation and mucosal remodeling in chronic rhinosinusitis with nasal polyps associated with asthma. Int Arch Allergy Immunol. 2010;151:8–16. doi: 10.1159/000232566. [DOI] [PubMed] [Google Scholar]
- 38.Wakashin H, Hirose K, Maezawa Y, Kagami S, Suto A, Watanabe N, et al. IL-23 and Th17 cells enhance Th2-cell-mediated eosinophilic airway inflammation in mice. Am J Respir Crit Care Med. 2008;178:1023–1032. doi: 10.1164/rccm.200801-086OC. [DOI] [PubMed] [Google Scholar]






