IncP Plasmid Carrying Colistin Resistance Gene mcr-1 in Klebsiella pneumoniae from Hospital Sewage

ABSTRACT

A Klebsiella pneumoniae strain of sequence type 313 (ST313) recovered from hospital sewage was found carrying the plasmid-borne colistin resistance gene mcr-1, which was bracketed by two copies of the insertion sequence ISApl1 on a 57-kb self-transmissible IncP-type plasmid of a new IncP-1 clade. The carriage of mcr-1 on a self-transmissible broad-host-range plasmid highlights that mcr-1 has the potential to spread beyond the Enterobacteriaceae family.

TEXT

Colistin is the last resort antimicrobial agent for treating infections caused by many Gram-negative bacteria. Recently, a plasmid-borne colistin resistance gene, mcr-1, was found in Escherichia coli and Klebsiella pneumoniae from humans and animals in China (1). Several follow-up studies reported mcr-1-carrying E. coli in many countries in Africa (2), Europe (3–8), Asia (1–3, 9, 10), and North America (9, 11). In addition, mcr-1 has also been found in Kluyvera ascorbata (12) and several species of Salmonella (13–15). All of these findings suggest that mcr-1 has been widely distributed and imposes an emerging threat for clinical management and public and animal health. Here we report an mcr-1-carrying K. pneumoniae that was found during a study screening for the presence of colistin-resistant Enterobacteriaceae in hospital sewage.

K. pneumoniae strain WCHKP1511 was recovered from the influx mainstream of hospital sewage at West China Hospital, Chengdu, in western China, in November 2015. Strain WCHKP1511 grew on ChromAgar orientation agar plates (ChromAgar, Paris, France) containing 4 μg/ml colistin and 64 μg/ml linezolid. Species identification was established by partially sequencing the gyrB gene (16). Strain WCHKP1511 was resistant to colistin (MIC, 8 μg/ml), polymyxin B (MIC, 8 μg/ml), chloramphenicol (MIC, 128 μg/ml), and tetracycline (MIC, 64 μg/ml) but was susceptible to amikacin (MIC, 0.5 μg/ml), ceftazidime (MIC, ≤0.5 μg/ml), cefotaxime (MIC, 0.03 μg/ml), ciprofloxacin (MIC, 0.03 μg/ml), imipenem (MIC, 0.125 μg/ml), and tigecycline (MIC, 1 μg/ml) as determined using the microdilution broth method according to the recommendations of the Clinical and Laboratory Standards Institute (CLSI) (17). WCHKP1511 was susceptible to fosfomycin (MIC, 32 μg/ml) as determined using the agar dilution method according to the recommendations of the CLSI (17). In addition, strain WCHKP1511 was resistant to ampicillin and trimethoprim-sulfamethoxazole, was intermediately resistant to amoxicillin-clavulanate, gentamicin, tobramycin, and nitrofurantoin, and was susceptible to aztreonam, cefazolin, cefepime, cefoxitin, ceftriaxone, ertapenem, levofloxacin, and piperacillin-tazobactam as determined using the Vitek II automated system (bioMérieux, Lyon, France). We used breakpoints defined by the FDA and by EUCAST for tigecycline and colistin, respectively, otherwise, we applied those defined by the CLSI. PCR and sequencing showed that strain WCHKP1511 carried mcr-1 (1, 12). Although mcr-1 has been widely found in E. coli, mcr-1-carrying K. pneumoniae remains uncommon and had been found previously only in eastern China (Jiangsu and Zhejiang provinces) (1, 18).

Strain WCHKP1511 was subjected to 150-bp paired-end whole-genome sequencing with a ca. 200× coverage using the HiSeq 2500 sequencer (Illumina, San Diego, CA, USA). A total of 3,784,972 reads and 567,745,800 clean bases were generated, which were assembled into 275 contigs (230 contigs ≥1,000 bp in length; N50, 67,217 bp) with a 57.46% GC content using the Spades program (19).

WCHKP1511 belonged to sequence type (ST)313, which was determined using the genomic sequence to query the multilocus sequence typing (MLST) database of K. pneumoniae (http://bigsdb.web.pasteur.fr/klebsiella/klebsiella.html). Only one ST313 strain, KML 2185, which was recovered from human blood in the Netherlands in 2007, has been deposited in the K. pneumoniae MLST database. K. pneumoniae strains carrying mcr-1 in Jiangsu province belonged to ST25 (20), while the STs of those in Zhejiang province are unknown. ST313 was not closely related to ST25, as only 2 of 7 alleles were identical between the two STs.

Antimicrobial resistance genes were predicted using ResFinder from the Center for genomic epidemiology (http://genomicepidemiology.org/). In addition to mcr-1, WCHKP1511 had multiple genes mediating resistance to aminoglycosides (aac(3)-Iva, aadA2, aph(3′)-Ia, and aph(4)-I), β-lactams (bla_TEM-135 and a new bla_SHV variant), chloramphenicol (floR), fosfomycin (fosA), quinolones (oqxA and oqxB), sulfonamides (sul2), trimethoprim (dfrA12), and tetracycline (tet[A]) as predicted by ResFinder. The gene bla_TEM-135 encodes a broad-spectrum β-lactamase (21). Of note, although strain WCHKP1511 carried fosA, it was susceptible to fosfomycin, which warrants further investigation. The gene bla_SHV in strain WCHKP1511 is a new variant, which encodes a SHV enzyme with an amino acid difference (Thr14Asn, with the position based on the ATG start codon) from SHV-111, the closest match. The new SHV has been assigned SHV-195 by the NCBI β-lactamase classification system (www.ncbi.nlm.nih.gov/pathogens/submit_beta_lactamase/). As strain WCHKP1511 was susceptible to third-generation cephalosporins, bla_SHV-195 is unlikely to encode an extended-spectrum β-lactamase (ESBL). The complete coding sequence of bla_SHV-195 was cloned into the pBC SK vector (Agilent, Santa Clara, CA, USA), which was electroporated into E. coli DH5α cells. E. coli transformants containing bla_SHV-195 were resistant to ampicillin (MIC, >256 μg/ml) and cephalothin (32 μg/ml) but were susceptible to aztreonam, ceftazidime, cefotaxime, cefoxitin, and imipenem as determined using the broth microdilution method (17). This confirmed that bla_SHV-195 encodes a broad-spectrum β-lactamase rather than an ESBL.

In addition, a bleomycin resistance gene was predicted, designated as ORFble, which was not identified by ResFinder but was identified by the Prokka annotation tool (22) and was confirmed by Protein-BLAST in strain WCHKP1511. The complete coding sequence of ORFble was amplified with primers 1511_ble_BamHI_F (CGCGGATCCTTGGTTCACCATGAAGATG) and 1511_ble_EcoRI_R (CCGGAATTCCGGCCGATTGCTGAACAGATTA), was cloned into the pBC SK vector, and was electroporated into E. coli DH5α cells. ORFble-containing transformants were selected on LB agar plates containing 25 μg/ml chloramphenicol, and the presence of ORFble in transformants was confirmed by PCR and sequencing. However, the MIC (0.25 μg/ml) of zeocin (Thermo Fisher Scientific, Waltham, MA, USA), a bleomycin, against E. coli DH5α transformants containing ORFble was the same as that against DH5α cells as determined using the broth microdilution method (17). This suggests that ORFble did not mediate resistance to bleomycin, and its function remains undetermined.

We carried out conjugation experiments in broth using azide-resistant E. coli strain J53 as the recipient and selected transconjugants using 2 μg/ml colistin plus 150 μg/ml sodium azide. The presence of mcr-1 in transconjugants was confirmed using PCR. In strain WCHKP1511, mcr-1 was transferred to E. coli J53 at a frequency of 10⁻² cells per donor cell by mating, suggesting that mcr-1 was carried by a self-transmissible plasmid, which was assigned pMCR_1511. The sequence of pMCR_1511 was completely circularized with gaps between contigs closed by Sanger sequencing of amplicons from PCRs using primers designed based on available contig sequences. pMCR_KP1511 was 57,278 bp in size and had no known antimicrobial resistance genes other than mcr-1. Unlike the previously described mcr-1-carrying IncI2 plasmid pHNSHP45 (GenBank accession number KP347127) (1), pMCR_KP1511 belonged to the IncP type, a broad-host-range incompatibility group. Plasmid pKH-457-3-BE carrying mcr-1 in E. coli from Belgium was found to have an IncP backbone (3). However, the sequence of pKH-457-3-BE was not available for further analysis. Nonetheless, it has been suggested that pKH-457-3-BE has 99% similarity and 73% coverage with the IncHI2 plasmid pHXY0908 (GenBank accession number KM877269) in Salmonella enterica serotype Typhimurium (8). pMCR_KP1511 had only 6% coverage with pHXY0908, indicating that pMCR_1511 was very different from pKH-457-3-BE, and pKH-457-3-BE may not be a true IncP plasmid but is likely from IncHI2.

pMCR_1511 has the typical IncP-1 plasmid backbone (23) containing trfA encoding the replication initiation protein, two par modules for plasmid partitioning, the two conjugative regions tra (17.6 kb) and trb (12.7 kb), the host-lethal protein-encoding kil genes and their regulator kor (stands for kil-override) genes, and a toxin-antitoxin higA-B system (Fig. 1). The backbone of pMCR_1511 was highly similar (99% identity) to that of plasmid pHNFP671 (GenBank accession number KP324830), which was an IncP plasmid in E. coli isolate FP671 from Guangzhou, China but did not carry mcr-1. IncP-1 plasmid has six assigned clades, i.e., α, β, γ, δ, ε, and ζ, among which β clade has two subclades (β1 and β2) (24). To determine which clade pMCR_1511 belonged to, the sequences of 30 genes belonging to the IncP-1 backbone were retrieved from pMCR_1511, were concatenated and were then aligned to the counterparts of one representative plasmid of each clade, including the β1 and β2 subclades, as described previously (25). Phylogenetic analysis of the IncP-1 plasmid backbone revealed that pMCR_1511 and pHNFP671 belonged to a new IncP-1 clade (see Fig. S1 in the supplemental material).

FIG 1.

Genetic structure of IncP plasmid pMCR_1511 carrying mcr-1 and comparison with IncP plasmid pHNFP671. The regions and genes that are indicated are ORFble (a predicted [but actually not] bleomycin resistance gene), higA-B (encoding a toxin/antitoxin system), mcr-1, kor-par-kli (for plasmid maintenance), tra and trb (the two conjugation-encoding regions), and trfA (encoding the plasmid replication initiation protein). The backbones of the two IncP plasmids are almost identical. Compared to pHNFP671, pMCR_1511 carried two additional regions that contained either mcr-1 or ORFble.

Compared with the sequence of pHNFP671, the sequence of pMCR_1511 has two unique regions (Fig. 1). One of the unique regions harbored mcr-1 and the other contained ORFble. The sequence comparison of pMCR_1511 and pHNFP671 enabled us to analyze the genetic context of mcr-1 in detail. Similar to most genetic contexts available in GenBank, mcr-1 was located downstream of the insertion sequence ISApl1 on pMCR_1511. However, there was another ISApl1 downstream, which was interrupted (see below), and therefore mcr-1 was bracketed by two copies of ISApl1 on pMCR_1511. It is known that ISApl1 generates 2-bp direct target repeats (DR) upon insertion (26) (https://www-is.biotoul.fr/scripts/ficheIS.php?name=ISApl1). The 2-bp flanking sequences of the region bracketed by the two copies of ISApl1 were identical (AC) (Fig. 2). When the region formed by the two copies of ISApl1 and one of the 2-bp flanking sequences was subtracted artificially, the joined sequence perfectly matched that of an open reading frame (orf) with unknown function on plasmid pHNFP671. Therefore, it proved that the 2-bp sequence was truly a DR generated by ISApl1 rather than a coincidence, and the two copies of ISApl1 formed a composite transposon to mobilize the mcr-1 gene. A very recent analysis revealed that the ISApl1-formed composite transposon carrying mcr-1 was found on either the chromosome or a plasmid (IncH or unknown Inc groups) of seven E. coli strains (27). The ISApl1-formed composite transposons carrying mcr-1 are found at different locations, which are also different from the location on pMCR_1511, in the seven E. coli strains and are flanked by 2-bp DRs in five strains (27). The previous analysis (27) and the findings in the present study suggest that the ISApl1-formed composite transposon is a common vehicle for mediating the spread of mcr-1.

FIG 2.

Genetic context of mcr-1 on pMCR_1511. The genetic contexts of mcr-1 on the IncI2 plasmid pHNSHP45 (GenBank accession number KP347127) and the corresponding region on the IncP plasmid pHNFP671 (GenBank accession number KP324830) are shown for comparison. The orfs that encode hypothetical proteins with unknown functions are indicated in white, except that the one disrupted by the ISApl1-formed composite transposon on pMCR_1511 is shown in black (Δ1 and Δ2). Other genes shown are nikB (encoding relaxase of the plasmid), ydgA (DNA topoisomerase III), ydfA (transcriptional regulator), parA (resolvase), bla_TEM (shown as a white arrow in Tn3), and traB (conjugative protein). The 2-bp direct repeat (GA) abutting the ISApl1-mcr-1-pho region on pHNSHP45 and the 2-bp direct repeat (AC) abutting the ISApl1-formed composite transposon on pMCR_1511 are shown. On pMCR_1511, the ISApl1 downstream of mcr-1 was interrupted by Tn3, which was interrupted by IS26.

The ISApl1 downstream of mcr-1 on pMCR_1511 was interrupted by the insertion of Tn3 with the characteristic 5-bp DR (Fig. 2). The Tn3 was also disrupted by IS26 and most of the Tn3 was absent, which may result from the action of IS26. It is well known that the insertion of IS26 can lead to the deletion of the adjacent sequence of the insertion site (28). Alternatively, the insertion of the second IS26 and the recombination between the two copies of IS26 might eliminate the intervening region, resulting in the loss of most of Tn3. Although Tn3 interrupted the ISApl1 downstream of mcr-1, the right-end inverted repeat (IRR) of ISApl1 remained intact (Fig. 2). The transposase encoded by the ISApl1 upstream of mcr-1 had the potential to recognize the IRR of the downstream ISApl1 and thus mobilize the region bracketed by the two copies of ISApl1.

In conclusion, the plasmid-borne colistin resistance gene mcr-1 was found in a K. pneumoniae of an infrequently encountered ST isolated from hospital sewage. mcr-1 was carried by a self-transmissible IncP plasmid, which is a broad-host-range type of plasmid with the potential to mediate the dissemination of mcr-1 from the Enterobacteriaceae to other Gram-negative bacteria, such as Pseudomonas aeruginosa. mcr-1 was bracketed by two copies of ISApl1, which formed a composite transposon and represented a common mechanism for mediating the mobilization of mcr-1.

Accession number(s).

Sequencing reads and the whole-genome shotgun sequencing project of K. pneumoniae strain WCHKP1511 have been deposited into DDBJ/EMBL/GenBank under accession numbers SRR3170679 and LSMF00000000, respectively. The sequence of pMCR_1511 has been deposited into DDBJ/EMBL/GenBank under accession number KX377410.