Expression of Ca_v1.3 calcium channel in the human and mouse colon: posttranscriptional inhibition by IFNγ

Abstract

It has been hypothesized that apically expressed L-type Ca²⁺ channel Ca_v1.3 (encoded by CACNA1D gene) contributes toward an alternative TRPV6-independent route of intestinal epithelial Ca²⁺ absorption, especially during digestion when high luminal concentration of Ca²⁺ and other nutrients limit TRPV6 contribution. We and others have implicated altered expression and activity of key mediators of intestinal and renal Ca²⁺ (re)absorption as contributors to negative systemic Ca²⁺ balance and bone loss in intestinal inflammation. Here, we investigated the effects of experimental colitis and related inflammatory mediators on colonic Ca_v1.3 expression. We confirmed Ca_v1.3 expression within the segments of the mouse and human gastrointestinal tract. Consistent with available microarray data (GEO database) from inflammatory bowel disease (IBD) patients, mouse colonic expression of Ca_v1.3 was significantly reduced in trinitrobenzene sulfonic acid (TNBS) colitis. In vitro, IFNγ most potently reduced Ca_v1.3 expression. We reproduced these findings in vivo with wild-type and Stat1^−/− mice injected with IFNγ. The observed effect in Stat1^−/− suggested a noncanonical transcriptional repression or a posttranscriptional mechanism. In support of the latter, we observed no effect on the cloned Ca_v1.3 gene promoter activity and accelerated Ca_v1.3 mRNA decay rate in IFNγ-treated HCT116 cells. While the relative contribution of Ca_v1.3 to intestinal Ca²⁺ absorption and its value as a therapeutic target remain to be established, we postulate that Ca_v1.3 downregulation in IBD may contribute to the negative systemic Ca²⁺ balance, to increased bone resorption, and to reduced bone mineral density in IBD patients.

inflammatory bowel disease (IBD) is one of the chronic gastrointestinal disorders associated with osteopenia and osteoporosis. The relative risk of developing bone fractures in patients with IBD is 40% higher than in the general population, and the reported prevalence of osteopenia and osteoporosis among IBD patients ranges from 22 to 77% and 17 to 41%, respectively (6, 29). The pathogenesis of osteopenia/osteoporosis in IBD is complex and multifactorial and includes malnutrition, malabsorption, low body mass index, use of corticosteroids, smoking, increasing age, and the type of IBD (Crohn's disease vs. ulcerative colitis) (15, 22). One of the possible mechanisms contributing to bone loss in IBD is impaired mineral homeostasis either from decreased intestinal absorption and/or low renal reabsorption of calcium, thus creating a negative Ca²⁺ balance. In support of this, Huybers et al. (18) demonstrated that in a mouse model of Crohn’s-like ileitis (TNF^ΔARE mice), both duodenal and renal Ca²⁺ absorptive epithelia displayed a significant downregulation of the key Ca²⁺ transport protein genes: TRPV6 (transient receptor potential vanilloid 6), calbindin-D_9K, and PMCA1b (ATP2B1, ATPase plasma membrane Ca²⁺ transporting 1) in the gut, and calbindin-D_28K, and NCX1 (SLC8A1, Na⁺/Ca²⁺ exchanger) in the kidney. These changes were accompanied with reduced trabecular and cortical bone thickness and volume in TNF^ΔARE mice (18). Furthermore, we showed that in several models of experimental colitis both tumor necrosis factor (TNF) and interferon-γ (IFNγ) reduce the expression and activity of Klotho in the renal distal convoluted tubules, where it normally supports renal Ca²⁺ reabsorption by stabilizing the transient receptor potential vanilloid 5 (TRPV5) channel on the apical membrane of distal tubule epithelial cells (31, 33). In the distal convoluted tubules, the impaired apical Ca²⁺ transport was accompanied by decreased activity of the basolateral NCX1 Na⁺/Ca²⁺ exchanger, which was transcriptionally inhibited by IFNγ via a Stat1-dependent mechanism (30), collectively leading to increased urinary calcium wasting (31).

In the gut, Ca²⁺ absorption is fairly complex and involves both transcellular pathway involving apical TRPV6, cytosolic calbindin-D_9K, and basolateral Pmca1b Ca²⁺ pump, as well as a less dynamically regulated paracellular route (9). More recently, another player was postulated to contribute to the intestinal Ca²⁺ absorption, Ca_v1.3 (CACNA1D), an apical L-type channel (19). Outside the gut, this channel is expressed in cochlea inner hair cells and enterochromaffin cells, where it aids in hearing and catecholamine secretion, respectively. Interestingly, inhibition of Ca_v1.3 channels may play a protective role against neurodegeneration in dopaminergic neurons such as in Parkinson disease. Although little is known about its function in the intestine, it is known to be expressed and active in both human and rodent gastrointestinal tracts. In contrast to other channels such as TRPV6 that work under a hyperpolarized setting, Ca_v1.3 is hypothesized to contribute to an alternative, TRPV6-independent, route of intestinal Ca²⁺ absorption. TRPV6 plays a more dominant role under the polarizing conditions between meals, whereas Ca_v1.3 plays a dominant role under postprandial depolarizing conditions, such as during digestion, when nutrients and luminal Ca²⁺ are abundant (19). Interestingly, a review of microarray data of colonic gene expression in IBD patients deposited in GEO database (11) indicated relatively consistent downregulation of Ca_v1.3 mRNA expression; one of the best-designed studies with sigmoid colon biopsies of ulcerative colitis patients and their healthy twins showed decreased Ca_v1.3 mRNA expression in seven of ten monozygotic twins with ulcerative colitis compared with their discordant siblings (21).

In this study, we investigated the segmental differences in Ca_v1.3 expression in the murine and human gut and the effects of colitis and associated inflammatory mediators on the expression of colonic Ca_v1.3. We found that epithelial expression of Ca_v1.3 is significantly reduced in the epithelial cells in the inflamed colon and that IFNγ is a key mediator in the posttranscriptional downregulation of this channel in both in vivo and in vitro models of inflammation. We propose that the concomitant reduction in the expression of major intestinal and renal Ca²⁺ channels and transporters, including Ca_v1.3, likely contributes to the negative systemic Ca²⁺ balance and increased bone resorption associated with IBD.

MATERIALS AND METHODS

Mice and experimental colitis.

Wild-type and Stat1^−/− mice on 129S6/SvEv background were purchased from Taconic Farms (Hudson, NY). TNBS colitis was induced in 10- to 12-wk-old mice by intracolonic single dose administration of trinitrobenzene sulfonic acid (TNBS, Sigma Aldrich) (2.5 mg/mouse dissolved in 50% ethanol). Control mice received equivalent volume of PBS enema. All mice were euthanized 5 days later. The TNBS model was selected based on our previously published changes in bone metabolism and density and systemic Ca²⁺ homeostasis (30, 31, 35). Body weight changes were monitored daily after the induction of colitis. Colonic inflammation was assessed based on histological changes as well as levels of proinflammatory cytokine expression in the distal colon. Wild-type (WT) or Stat1-deficient mice were injected with PBS or recombinant mIFNγ (50,000 units/mouse ip; Peprotech, Rocky Hill, NJ) daily for 3 days. On the fourth day, colons were harvested for Ca_v1.3 mRNA and protein analysis by qPCR and Western blotting, respectively. Colonic segments were collected, flushed with PBS, and opened longitudinally on nitrocellulose membrane. For histological evaluation, tissues were fixed in 10% buffered formalin (Fisher Scientific) and embedded in paraffin. Samples were cut into 5-µm-thick sections and stained with hematoxylin and eosin. The animal use protocol was reviewed and approved by the University of Arizona Institutional Animal Care and Use Committee.

Ca_v1.3 tissue expression profiling by real-time RT-PCR.

Total RNA was isolated from the mouse kidney (whole), duodenum, jejunum, ileum, and proximal and distal colon (mucosal scrapings) using TRIzol reagent (Invitrogen//ThermoFisher, Carlsbad, CA). We reverse-transcribed 250 ng of total RNA using the cDNA synthesis qScript (Quanta Biosciences, Beverly, MA) or Transcriptor Universal cDNA Master kit (Roche). qPCR reactions for Ca_v1.3 mRNA as well as endogenous reference gene (TATA box binding protein, TBP) were set up using commercially available TaqMan primers (Applied Biosystems/ThermoFisher; Grand Island, NY), PerfeCTa qPCR Super Mix (Quanta Biosciences), and cDNA (10% of the real-time reaction). Data were analyzed and expressed as a relative fold change of the gene expression, normalized to TBP gene and relative to normalized Cq value (cycle at which the curvature of the amplification curve is maximal) obtained from the kidney (2^−ΔΔCt) as indicated. TissueScan Human Major Tissue qPCR Arrays (HMRT102) were purchased from OriGene (Rockville, MD). HMRT102 contains prenormalized cDNA from 48 human tissues. Two duplicate plates were analyzed: one with manufacturer-provided GAPDH primers using PerfeCTa SYBR Green SuperMix (Quanta Biosciences), the second with a commercial TaqMan primer/probe set obtained from Applied Biosystems. Data were processed in a manner consistent with mouse Ca_v1.3 mRNA and were normalized to renal Ca_v1.3 expression.

Immunofluorescence.

Colonic sections were harvested and fixed in 10% neutral buffered formalin (Fisher Scientific). Fixed tissues were embedded in paraffin and cut into 5-μm-thick tissue sections. After deparaffinization and rehydration, antigen retrieval was performed by heating the slides in citrate buffer (10 mm sodium citrate, 0.05% Tween 20, pH 6.0). After washing in phosphate-buffered saline (PBS), the slides were blocked for 1 h in 10% normal chicken serum in PBS containing Tween 20 (0.1%) (PBST). Next, sections were incubated with primary mouse monoclonal antibody directed against Ca_v1.3α1 pore-forming subunit (NeuroMab clone N38/8, 1:100 dilution, UC Davis/NIH NeuroMab Facility, Davis, CA) in PBST containing 3% BSA, overnight at 4°C. After three washes in PBST, the slides were incubated with the chicken anti-goat conjugated with AlexaFluor-647(6 μg/ml in PBST, Invitrogen). After three washes with PBST, slides were mounted with a drop of mounting medium with DAPI (Molecular Probes, Life Technologies). The slides were visualized under the microscope (EVOS FL Auto, Life Technologies). NeuroMab clone N38/8 is a well-validated monoclonal antibody against Ca_v1.3α₁ that showed no signal in the retina of Ca_v1.3α₁^−/− mice and clear single band in WT mice (38), ~50% reduced signal in the cardiomyocytes of Ca_v1.3α₁^+/− mice (16) and loss of immunoreactivity for Ca_v1.3α₁ by immunostaining and Western blotting in patients with somatic mutations in Ca_v1.3α₁-encoding CACNA1D gene in the adrenal aldosterone-producing adenomas (2).

Cells and treatment.

HCT116, human colonic adenocarcinoma was obtained from American Type Culture Collection (ATCC, Manassas, VA; ATCC CCL-247). Cells were cultured in McCoy's 5a Modified Medium with 10% fetal bovine serum and antibiotics (50 U/ml of penicillin and 50 µg/ml streptomycin; GIBCO/ThermoFisher). Cells were treated for 24 h with control medium or media supplemented with IFNγ (100 U/ml), IL1β (2 ng/ml) and TNFα (10 ng/ml) individually or in combination (cytomix; all from Peprotech). To inhibit de novo transcription, cells were treated with actinomycin D (ActD; Sigma-Aldrich; St. Louis, MO) or with an equivalent volume of DMSO.

Western blotting.

Mucosal scrapings of PBS or IFNγ-treated mice were homogenized in RIPA buffer containing protease inhibitor cocktails and sonicated to shear DNA. The cleared lysates were mixed 1:1 with Laemmli sample buffer with 2-mercaptoethanol, separated by gradient SDS-polyacrylamide gel electrophoresis (TGX gels, Bio-Rad; 30 μg/lane), and transferred to nitrocellulose membranes (Bio-Rad). Membranes were blocked with Tris-buffered saline (TBS) containing 0.05% Tween-20 (Sigma-Aldrich) and 5% wt/vol dry milk powder (Bio-Rad). The was followed by incubation with one of the following antibodies: anti-Ca_v1.3α₁ NeuroMab clone N38/8 or anti-GAPDH mouse monoclonal antibody (MA5-15738, Pierce) in 2.5% blocking buffer overnight at 4°C. They were then washed with TBS containing 0.05% Tween-20, incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Cell Signaling) at room temperature for 1 h and developed using Super Signal West Pico HRP substrate (Pierce). Images were acquired using G:Box gel doc system (Syngene; Cambridge, UK).

Cloning of the murine Ca_v1.3 via gene promoter, transfection, and reporter assays.

The sequence of the murine CACNA1D gene promoter relative to its predicted transcription start site was obtained from the Eukaryotic Promoter Database (EPD) of experimentally validated promoters for selected model organisms developed and maintained by the Swiss Institute for Bioinformatics (10). Transcription start site was identified in position −481 relative to the start codon based (reference sequence NM_001083616.2). C57BL/6 mouse genomic DNA was used to amplify four fragments of the promoter region with 5′ ends at −1,183 nt (forward primer GCGGTACCCCTCTTTGAGCAAGGAGCAC, KpnI adapter underlined), −1,139 nt (GCGGTACCAATTCACGCTGAGCCTTTTG), −498 nt (GCGGTACCCTCCCCCAGGTGTGAGAGT), and the reverse primer at position +362 nt relative to the transcription start site, and −138 nt upstream of the start codon (GCCTCGAGCGCTTCAGCAGGGGGTGG, XhoI adapter underlined). The first two constructs varied primarily by the absence of a putative Stat1 binding site (TTCCCAGAAACAT) at position −1,162/−1,150 nt. All reporter constructs were created in pGL3-basic vector with Firefly luciferase as a reporter (Promega, Madison, WI) and sequenced on both strands to confirm fidelity. Promoterless pRL-null with Renilla luciferase (Promega) was cotransfected into HCT116 cells as an internal control. At 24 h posttransfection, cells were treated with recombinant human IFNγ (100 U/ml) for another 24 h. Relative luciferase activity assay was performed with Dual Luciferase kit (Promega) and tube luminometer (FB12; Zylux, Maryville, TN).

RESULTS

Expression of Ca_v1.3 in the mouse and human gastrointestinal tract.

RNA was isolated from the naive mouse kidneys or whole-thickness intestinal segments from duodenum, jejunum, ileum, and proximal and distal colon and analyzed for Ca_v1.3 mRNA expression by qPCR. Ca_v1.3 transcript was readily detected in all intestinal segments. In the small intestine, we observed a decreasing gradient of expression along the longitudinal axis, with a significant increase in Ca_v1.3 mRNA expression in the proximal and distal colon (Fig. 1A). qPCR analysis of human cDNA also showed readily detectable Ca_v1.3 mRNA in all segments analyzed, with the highest expression detected in the sigmoid/rectum (Fig. 1B). Therefore, our data appear contrary to published semiquantitative assessment of Ca_v1.3α1 expression in the rat by immunofluorescence by Morgan et al. (24), who reported the highest level of expression in the distal jejunum and proximal ileum and very low expression in the colon. Contrary to nuclear labeling reported by Morgan et al. using polyclonal antibody raised against peptide 809–825, expression of Ca_v1.3α1 pore-forming subunit detected in the colon with a monoclonal antibody was not observed in the nucleus (Fig. 1, A and B). At lower magnification and higher exposure settings, Ca_v1.3α1 expression was detectable in the surface epithelial and upper crypt cells, along with scattered lamina propria cells (possibly resident immune cells) and in the submucosa (muscularis mucosae or cells of the myenteric plexus) (Fig. 1C). More detailed analysis would be required to identify nonepithelial cells expressing Ca_v1.3α1 in the colon. At higher magnification and lower exposure settings, apical expression of Ca_v1.3α1 appeared to be dominant in the colon (Fig. 1D). Ca_v1.3 expression in the human colon is also supported by immunohistochemical detection data in the Human Protein Atlas (34), as exemplified in Fig. 1E (image credit: Human Protein Atlas; http://www.proteinatlas.org/ENSG00000157388-CACNA1D/tissue/colon). CACNA1D data from Human Protein Atlas have been generated with a Prestige Antibody Powered by Atlas Antibodies produced by Sigma (HPA020215) against 136 aa human recombinant protein, most suitable for human detection.

Fig. 1.

Expression of Ca_v1.3 in the murine and human gastrointestinal tract. qPCR detection of Ca_v1.3 mRNA expression in different segments of the mouse (normalized to TBP) (A) and human (normalized to GAPDH) (B) gastrointestinal tract. In both species, renal expression was used as a calibrator. C and D: immunofluorescent detection of Ca_v1.3 in the mouse colon. Red, Ca_v1.3; blue, nuclei (DAPI). E: Ca_v1.3 protein expression in the human colon (image credit: Human Protein Atlas (34); cropped image from http://www.proteinatlas.org/ENSG00000157388-CACNA1D/tissue/colon).

Decreased colonic epithelial expression of Ca_v1.3 in experimental colitis.

To assess the effects of experimental colitis on the expression of Ca_v1.3, we induced colitis by intrarectal administration of TNBS in ethanol as described earlier (30, 31). TNBS induced characteristic colitis with significant mucosal immune infiltration, submucosal edema, and focal loss of surface epithelium (Fig. 2A). Expression of Ca_v1.3α1 analyzed using qPCR from RNA isolated from whole-thickness colonic specimens was significantly reduced by ~50% (Fig. 2B). Immunofluorescence analysis of Ca_v1.3α1 protein expression in the colonic mucosa showed a dramatic reduction in expression in the epithelial cells, with concomitant increase in fluorescence within the putative immune cells infiltrating the lamina propria and submucosa. (Fig. 3). This increased expression of Ca_v1.3α1 in nonepithelial compartment may indicate a significantly underestimated difference in Ca_v1.3 transcript level analyzed in whole-thickness RNA preparations.

Fig. 2.

Mucosal expression of Ca_v1.3 mRNA in experimental colitis. A: representative hematoxylin and eosin staining of colonic mucosa from control and TNBS-treated mice. B: qPCR detection of Ca_v1.3 mRNA expression in the colonic mucosa of control and TNBS-treated mice. N = 3 for control, N = 5 for TNBS. *P = 0.02, Student's t-test.

Fig. 3.

Mucosal expression of Ca_v1.3 protein in experimental colitis. Immunofluorescent detection of Ca_v1.3 in the mouse colon. Red, Ca_v1.3; blue, nuclei (DAPI).

IFNγ inhibits colonic epithelial expression of Ca_v1.3 via and STAT1-independent posttranscriptional mechanism.

To address the mechanism of reduced expression of Ca_v1.3 during intestinal inflammation, Ca_v1.3-expressing HCT116 colonic adenocarcinoma cells were treated with IL1β, IFNγ, and TNFα individually or in combination (cytomix) for 24 h, and Ca_v1.3 mRNA was analyzed by qPCR. Among the three cytokines tested, IFNγ was the only one that significantly inhibited Ca_v1.3 mRNA expression (Fig. 4A). No additive or synergistic effects were observed when the three cytokines were used in combination (Fig. 4A). Since the canonical IFNγ signaling is driven by STAT1-dependent modulation of gene transcription, we tested whether this pathway is critical for the observed decrease in Ca_v1.3 mRNA expression in vivo. To this end, we treated WT and Stat1^−/− C57BL/6 mice with recombinant IFNγ by three daily intraperitoneal injections and tested Ca_v1.3 mRNA and protein expression in the colon by qPCR and Western blotting, respectively. IFNγ induced a decrease in Ca_v1.3 expression similar that observed in TNBS colitis (Fig. 4B). There was no difference in the response to IFNγ in WT and Stat1-deficient mice, thus suggesting a STAT1-independent mechanism of Ca_v1.3 inhibition (Fig. 4B).

Fig. 4.

Effects of proinflammatory cytokines on Ca_v1.3 mRNA and protein expression in vitro and in vivo. A: qPCR analysis of Ca_v1.3 mRNA expression in HCT116 colonic adenocarcinoma cells treated for 24 h with IFNγ (100 U/ml), IL1β (2 ng/ml), and TNFα (10 ng/ml) individually or in combination (cytomix). Data were analyzed with 1-way ANOVA followed by Fisher PLSD post hoc test. *Differences between respective treatment and control (Ctrl; P < 0.05). B: colonic expression of Ca_v1.3 mRNA and protein in WT or Stat1^−/− mice injected with PBS or IFNγ (50,000 units/mouse ip daily for 3 days). qPCR data normalized to PBS-injected controls for each genotype. *Differences between respective treatment and control (P < 0.05). Western blotting summary with a representative image of Ca_v1.3 and β-actin expression; P value of Student's t-test indicated.

To further verify whether the effects of IFNγ repress active transcription of Ca_v1.3 gene, we treated HCT116 cells with ActD to inhibit de novo transcription and with or without of IFNγ for 24 h. In this experimental scenario, IFNγ reduced the steady-state level of Ca_v1.3 mRNA by ~50% (Fig. 5A), similar to that observed in non-ActD-treated cells (Fig. 4A). Moreover, none of the cloned Ca_v1.3 gene promoter fragments, spanning the region of −251 nt to −1,553 nt relative to the putative transcription start site, were affected by IFNγ treatment in HCT116 cells transiently transfected with the respective reporter construct (Fig. 5B).

Fig. 5.

Posttranscriptional mechanism of reduced Ca_v1.3 mRNA expression in HCT116 cells treated with IFNγ. A: HCT116 cells were treated with ActD to inhibit de novo transcription and treated with 100 U/ml of IFNγ for 24 h. *Differences between IFNγ and control (P < 0.05). B: 4 deletion constructs of the cloned murine Ca_v1.3 gene promoter in Firefly luciferase (Luc) reporter vector pGL-basic (Promega), or promoterless vector, were cotransfected with Renilla luciferase vector pRL-null into HCT116 cells and treated with control medium or with 100 U/ml of IFNγ for 24 h. All tested promoter constructs were functional, but no significant effects of IFNγ were detected.

Since all the performed experiments suggested a posttranscriptional regulation of Ca_v1.3 mRNA expression by IFNγ, we tested Ca_v1.3 transcript stability/decay over time in ActD-treated HCT116 cells treated with PBS (control) or IFNγ over a period of 24 h. qPCR analysis of Ca_v1.3 and GAPDH (internal control) indicated that IFNγ led to faster Ca_v1.3 transcript decay (Fig. 6), suggesting that the mechanism responsible for the reduced expression of Ca_v1.3 by IFNγ in vitro, and likely during experimental colitis in vivo, involves transcript degradation and not reduced gene transcription.

Fig. 6.

IFNγ accelerates Ca_v1.3 mRNA decay in colonic epithelial cells. HCT116 cells were treated with ActD to inhibit de novo gene transcription in control or IFNγ-supplemented medium (100 U/ml). Cells were harvested at 2, 4, 8, 12, and 24 h into treatment and expression of Ca_v1.3 mRNA was analyzed by qPCR. qPCR data were normalized to GAPDH transcript, with time “zero” as the calibrator. A t-test at individual time points was used for statistical analysis. *Differences between IFNγ and control (P < 0.05).

DISCUSSION

The concept of negative systemic calcium balance as a contributor to metabolic changes in the bone and to a decreased bone mineral density in IBD is based in decreased Ca²⁺ intake (dairy avoidance and vitamin D insufficiency) and inhibition of epithelial Ca²⁺ transport in the intestine and kidneys (15). In this scenario, homeostatic mechanisms geared toward maintenance of steady circulating Ca²⁺ levels may lead to an increased skeletal Ca²⁺ resorption at the expense of bone mineral density. Combined deficits in intestinal and renal Ca²⁺ transport and the direct effects of inflammatory mediators on bone metabolism are likely the key contributors to osteopenia and osteoporosis of chronic inflammation.

The relative contributions of transcellular and paracellular pathways to total Ca²⁺ absorption are somewhat controversial and are subject to modulation by the amount and concentration of luminal ionized Ca²⁺, which depend on Ca²⁺ intake, bioavailability from complex foods, e.g., dietary fibers, local solubility and luminal pH, or transit time in a particular segment. The conventional view is that ~85% of total intestinal Ca²⁺ transport occurs in jejunum and ileum through a weakly regulated paracellular route driven by high luminal Ca²⁺ concentrations through tight junctions, and linear within the range of 5–200 mM Ca²⁺. Active intestinal Ca²⁺ transport is thought to occur predominantly in duodenum and proximal jejunum. This highly regulated and vitamin D₃-sensitive transcellular transport occurs via combined actions of apical TRPV6 channel, cytosolic buffer and Ca²⁺ shuttle calbindin D9_K, and basolateral PMCA1b calcium pump and is predominant at low luminal Ca²⁺ concentrations (up to ~5 mM). When dietary Ca²⁺ is restricted in between meals (semistarvation), the intestine becomes more polarized. Such circumstances favor TRPV6, with maximal opening for Ca²⁺ at −60 and −150 mV (19). More recently, it has been proposed that TRPV6 and an L-type Ca_v1.3 Ca²⁺ channel may have complementary roles in Ca²⁺ entry into the intestinal epithelial cell (19). In this scenario, Ca_v1.3 plays a dominant role under depolarizing conditions observed during digestion (maximum opening for Ca²⁺ at −20 to −10 mV), mainly when luminal nutrients and Ca²⁺ are abundant (9, 19).

While reliable human studies on intestinal Ca²⁺ absorption in IBD are lacking, in a mouse model of Crohn’s-like ileitis (TNFα-overexpressing TNF^ΔARE mice), duodenal Ca²⁺ absorptive epithelia displayed significant downregulation of TRPV6, calbindin D9_K, and PMCA1b calcium pump (18). These alterations were accompanied by increased bone resorption, as shown by reduced trabecular and cortical bone thickness and volume and by increased total deoxypyridinoline in the serum of TNF^ΔARE mice (18). The same report also showed that key components of renal Ca²⁺ reabsorption, calbindin D28_K and basolateral Na⁺/Ca²⁺ exchanger NCX1, were also reduced (18). Our group has further dissected the effects of experimental colitis on the renal Ca²⁺ handling. We showed that increased urinary Ca²⁺ wasting is mediated by TNFα- and IFNγ-dependent inhibition of Klotho, which led to hypersialylation of apical TRPV5 Ca²⁺ channel, cytokine-induced TRPV5 endocytosis, its UBR4-dependent ubiquitination, and proteasomal degradation (31, 33). We also described the mechanism responsible for the reduced expression and activity of NCX1 exchanger responsible for basolateral exit of Ca²⁺ in the renal epithelial cells (30).

The effects of intestinal inflammation on intestinal epithelial Ca_v1.3 expression have not been investigated despite its postulated importance in the net dietary Ca²⁺ absorption (19). Also, the expression of Ca_v1.3 channel in the murine and human gut has not been systematically studied. Our qPCR analysis of Ca_v1.3 mRNA expression along the mouse and human intestinal tract indicated that, although the transcript is readily detectable in all segments, its highest expression is in the distal segments, proximal and distal colon in mouse, and sigmoid/rectum in human samples. Colonic Ca_v1.3 expression has also been demonstrated in rats, where it was elevated in a model of diarrhea-predominant irritable bowel disease (37). We further demonstrated that experimental colitis is associated with decreased expression of Ca_v1.3 mRNA and protein in the epithelial cells, and provided evidence that IFNγ may be the key cytokine that induces posttranscriptional loss of Ca_v1.3 transcript stability. Interestingly, in the colon, reduced epithelial Ca_v1.3 expression was accompanied with higher expression of the channel in the infiltrating immune cells. The identity of the cells highly expressing Ca_v1.3 in the inflamed mucosa is not clear at this point. It also remains unclear what is the mechanisms that alters Ca_v1.3 mRNA stability in epithelial cells while allowing its continuous expression in the mucosal immune cells, which presumable are similarly exposed to IFNγ in situ in mucosal inflammation. Both murine and human Ca_v1.3 mRNA have a highly conserved binding site for miR-3064-5p microRNA. Also, while Ca_v1.3 mRNA appears to have to canonical AU-rich elements in its 3′ end, it has a uniquely high number (21 in the entire transcript) of the GAIT elements (gamma interferon activated inhibitor of ceruloplasmin mRNA translation), which contribute to translational inhibition (25). While GAIT complex formation may contribute to reduced Ca_v1.3 protein level in the intestinal epithelial cells, it has not been conclusively linked to mRNA stability; thus the precise mechanism of reduced Ca_v1.3 mRNA remains to be elucidated.

Historically, colon has not been considered as a significant contributor to the total Ca²⁺ absorption. However, the colonic and ileal sojourn time are very similar (in rats 184 and 187 min, respectively) (7), and colonic expression of TRPV6, calbindin D9_K, and PMCA1b has been described (1, 14, 17, 32, 36). Dependence of calcium absorption in the colon on vitamin D₃ has also been shown (12, 13, 20, 28). Interestingly, during vitamin D deficiency, prevalent in IBD patients (8), net Ca²⁺ absorption was higher in the rodent proximal or distal colon than in the jejunum or ileum (12). In Caco-2 colonocytes, Ca_v1.3 calcium channel was exclusively required for prolactin-stimulated calcium transport (26). With this fragmentary information, the precise impact of Ca_v1.3 activity on net intestinal Ca²⁺ absorption remains to be fully established. However, it is conceivable that reduced Ca_v1.3 expression during chronic colitis contributes to total losses of dietary and systemic Ca²⁺ resulting from reduced expression and activity of other intestinal and renal epithelial Ca²⁺ transporters. The totality of these phenomena may explain the largely negative results of clinical trials with calcium supplementation in pediatric IBD patients and adult IBD patients treated with corticosteroids (3, 5) and may explain the reported lack of correlation between calcium intake and bone density status in premenopausal women with IBD (4). Moreover, decreased expression of Ca_v1.3 may have other unforeseen consequences for the function of colonocytes. It has been recently described in cardiomyocytes, that the COOH terminus of Ca_v1.3 translocates to the nucleus where it functions as a transcriptional regulator (23). One of its targets is the myosin II regulatory light chain protein, required to maintain the stability of myosin II and cellular integrity and involved in regulating cell adhesion, migration, and division (27, 37). It remains to be elucidated whether similar transcriptional effects of Ca_v1.3 occur in the intestinal epithelial cells.

GRANTS

This research was funded by NIH/NIDDK 4R37DK033209 (to F. K. Ghishan).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

V.M.R., P.R.K., and F.K.G. conceived and designed research; V.M.R., M.M.G., and N.A.P. performed experiments; V.M.R., M.M.G., and N.A.P. analyzed data; V.M.R. and P.R.K. interpreted results of experiments; V.M.R. and P.R.K. prepared figures; M.M.G. and P.R.K. drafted manuscript; M.M.G., P.R.K., and F.K.G. approved final version of manuscript; P.R.K. edited and revised manuscript.