Skip to main content
Internal Medicine logoLink to Internal Medicine
. 2016 Dec 15;55(24):3579–3584. doi: 10.2169/internalmedicine.55.7107

An Epidemiological Analysis of Summer Influenza Epidemics in Okinawa

Satoko Sunagawa 1,2, Yoshikazu Iha 1, Katsuya Taira 3, Sho Okano 3, Takeshi Kinjo 1, Futoshi Higa 1, Kazufumi Kuba 4, Masao Tateyama 1, Katsunori Nakamura 2, Shota Nakamura 5, Daisuke Motooka 5, Toshihiro Horii 5, Gretchen L Parrott 1, Jiro Fujita 1
PMCID: PMC5283956  PMID: 27980256

Abstract

Objective This study evaluates the difference between winter influenza and summer influenza in Okinawa.

Methods From January 2007 to June 2014, weekly rapid antigen test (RAT) results performed in four acute care hospitals were collected for the surveillance of regional influenza prevalence in the Naha region of the Okinawa Islands.

Results An antigenic data analysis revealed that multiple H1N1 and H3N2 viruses consistently co-circulate in Okinawa, creating synchronized seasonal patterns and a high genetic diversity of influenza A. Additionally, influenza B viruses play a significant role in summer epidemics, almost every year. To further understand influenza epidemics during the summer in Okinawa, we evaluated the full genome sequences of some representative human influenza A and influenza B viruses isolated in Okinawa. Phylogenetic data analysis also revealed that multiple H1N1 and H3N2 viruses consistently co-circulate in Okinawa.

Conclusion This surveillance revealed a distinct epidemic pattern of seasonal and pandemic influenza in this subtropical region.

Keywords: influenza, pandemic, antigen test, subtropical region, epidemiology

Introduction

The seasonal patterns of human influenza in temperate regions have been well documented; however, the seasonal patterns in tropical and subtropical areas are not as simple or as well pronounced as those in temperate regions around the world. It has been demonstrated that in subtropical areas such as Taiwan, Hong Kong, and Singapore, influenza epidemics are observed throughout the year (1). The Okinawan islands are located in the southernmost part of Japan (latitude 26° N), where the climate is also subtropical.

In Okinawa, several episodes of influenza epidemics occur during the summer season (2-5). This report describes the results of an eight-year surveillance of influenza incidence in the Naha region of Okinawa Island. In addition, to further understand influenza epidemics during the summer in Okinawa, we compared the types of viruses obtained in the winter season with the types of viruses obtained in the summer seasons. Furthermore, full genome sequences of representative human influenza A and influenza B were evaluated to demonstrate the differences between viruses with the same antigenic determinants.

Materials and Methods

Study population and influenza antigen tests

Patients with influenza-like symptoms visiting one of the four general hospitals within the cities of Naha and Urasoe, Okinawa, between January 2007 and December 2014 were included in this study. Intranasal or throat swab specimens were obtained when influenza was clinically suspected by physicians. Rapid antigen tests (RATs) using the nasal or throat swab samples were then performed to diagnose influenza A or B infection. This diagnostic procedure is part of conventional clinical practice. The RAT results were anonymously collected from the hospitals by the Clinical Laboratory Center of the Medical Association of Naha City, Okinawa. The investigation period included the H1N1 2009 pandemic (H1N1pdm) in Okinawa.

Virus isolation

Nasopharyngeal specimens from influenza patients were collected at sentinel medical facilities before the initiation of influenza therapy. The samples were kept at 4℃ at the medical facilities and transferred to the microbiology division of the Okinawa Prefectural Institute of Health and Environment for influenza virus isolation and growth. After viral culture, supernatants (200 μL) of nasopharyngeal swabs were inoculated into Madin-Darby canine kidney (MDCK) cells, with 1 mL of maintenance medium, containing trypsin at a concentration of 5.0 μg/mL, per well in 24-well plates. The plates were incubated at 35℃ in a 5% CO2 atmosphere for 1 week to assess the cytopathic effects. All of the isolates were typed and subtyped by the hemagglutination inhibition assay.

Genomic analysis

RNA extraction

The analyzed samples were unlinked and anonymous in the Osaka Prefectural Institute of Public Health. This study was approved by the ethics review committee of both the Osaka Prefectural Institute of Public Health and Osaka University. Viruses were propagated in MDCK cells. The supernatants were suspended in TRIzol LS Reagent (Life Technologies, Carlsbad, CA, USA) for 60 minutes. Total RNA was extracted using a PureLink™ RNA Mini Kit (Life Technologies) in accordance with the manufacturer's instructions. Contaminating DNA was eliminated with DNAase I (Life Technologies).

One-step reverse transcription-PCR (RT-PCR)

Total RNA was subjected to One-step RT-PCR using SuperScript III/Platinum Taq HiFi One-step RT-PCR Kit (Life Technologies) to detect the receptor-binding site within the hemagglutinin (HA) molecule. The primers used were as follows: forward primer, 59-416TTGAAAGGTTTGAGATATTC435-39; reverse primer, 59-784CTAGTGTCCAGTAATAGTTC765-39. RNA was extracted using a QIAamp viral RNA Mini kit (QIAGEN Inc., Valencia, CA, USA). A 140-μL volume of virus suspension from the infected culture or embryonated egg yielded a volume of 60 μL of extracted RNA.

Genomic shotgun sequencing and data analysis

Extracted RNA from the supernatant of MDCK culture was subjected to direct metagenomics shotgun sequencing. The RNA samples were reverse transcribed with Superscript III (Life Technologies) and converted to double-stranded DNA using the Klenow Fragment (New England Biolabs Inc., Ipswich, MA, USA). The resulting DNA was treated with Nextra XT DNA Library Prep Kit (Illumina, San Diego, CA, USA). Genomic shotgun sequencing was performed on MiSeq (Illumina). The sequence reads assigned to influenza viruses were collected and assembled using the CLC genomics work bench software program (QIAGEN Inc.).

Review of literature

We reviewed articles concerning summer influenza through MEDLINE (key words: influenza and summer). Articles not listed in the MEDLINE and those written in languages other than English were excluded.

Results

The number of positive cases of influenza A and B infection identified each week from January 2007 to December 2014 are shown in Fig. 1. From January 2007 to December 2014, samples from 180,752 patients were tested with RATs. During the same time period, 46,192 cases (25.6% of those tested) were positive for influenza virus antigen. Most cases were diagnosed as influenza A (37,994 cases; 21.0%) but some (8,198 cases; 4.5%) were diagnosed as influenza B infection.

Figure 1.

Figure 1.

Incidence of influenza A and B from 2007 to 2014 in four participating hospitals in the Naha region of Okinawa, Japan. Green designates the number of rapid antigen tests performed, blue designates the number of positive results for influenza A virus, and red designates the number of positive results for influenza B.

From January 2007 to December 2014, peaks were observed in 6 (75%) of the 8 summer seasons. In 2007, influenza was detected in both winter and summer, with the summer outbreak composed of influenza A and B. A small outbreak of influenza B infection also occurred in April 2008. Intense epidemic peaks were also noted in August 2009 and December 2009. These two epidemic peaks were caused by the influenza A/H1N1 2009 pandemic (H1N1pdm) and therefore appear quite different from typical seasonal influenza epidemics. Following the pandemic, in the summer 2010, influenza was not prominent. In 2011, 2013, and 2014, summer influenza was mainly caused by the influenza B virus. In 2012, summer influenza was again caused by a combination of influenza A and B.

The number of influenza virus isolates recovered in the winter season (50w-8w) and summer season (23w-35w) at the microbiology division of the Okinawa Prefectural Institute of Health and Environment are shown in Table 1. From December 2006 to August 2015, a total of 441 and 776 influenza viruses were collected during winter and summer seasons, respectively. Across all winter seasons, the numbers of influenza A/H1N1, A/H1N1pdm, A/H3N2, and B virus isolates were 35, 211, 168, and 27, respectively. However, across all summer seasons, the number of influenza A/H1N1, A/H1N1pdm, A/H3N2, and B virus isolates were 10, 598, 98, and 70, respectively.

Table 1.

Types of Influenza Virus Cultured in Okinawa.

A/H3N2 A/H1N1 A/H1N1pdm B
(2006)-2007 Winter (50w-8w) 13 0 - 0
2007 Summer (23w-35w) 0 10 - 2
(2007)-2008 Winter (50w-8w) 0 13 - 0
2008 Summer (23w-35w) 5 0 - 6
(2008)-2009 Winter (50w-8w) 11 22 - 2
2009 Summer (23w-35w) 41 0 588 2
(2009)-2010 Winter (50w-8w) 0 0 83 0
2010 Summer (23w-35w) 6 0 6 9
(2010)-2011 Winter (50w-8w) 12 0 105 0
2011 Summer (23w-35w) 7 0 0 17
(2011)-2012 Winter (50w-8w) 57 0 0 10
2012 Summer (23w-35w) 36 0 0 13
(2012)-2013 Winter (50w-8w) 23 0 0 9
2013 Summer (23w-35w) 0 0 3 7
(2013)-2014 Winter (50w-8w) 38 0 23 5
2014 Summer (23w-35w) 0 0 1 8
(2014)-2015 Winter (50w-8w) 14 0 0 1
2015 Summer (23w-35w) 3 0 0 6
SUM 263 45 809 91

The annual analysis of winter infections showed a combination of A/H1N1 (including A/H1N1pdm), A/H3N2, and B viruses in 2009 and 2014, A/H1N1pdm and A/H3N2 viruses in 2011, and A/H3N2 and B viruses in 2012, 2013, and 2015. However, in 2007 and 2010, only A/H3N2 or A/H1N1pdm, respectively, were circulating in our data population (Table 1). The annual analysis of summer infections showed mixed circulation of A/H1N1 and B viruses in 2007; A/H3N2 and B viruses in 2008, 2011, 2012, and 2015; A/H1N1, A/H3N2, and B viruses in 2009 and 2010; and A/H1N1pdm virus and B viruses in 2013 and 2014 (Table 1).

Based on the evidence demonstrated in Table 1, the virus type in the winter was frequently similar to the previous summer pattern. In addition, influenza viruses cultured during the winter and summer of the same year had antigenic differences, except in 2012. Furthermore, influenza B virus was observed consistently and with a higher incidence in the summer seasons, except for the summer of 2009, where A/H1N1pdm dominated. Interestingly, in 2012, the A/H3N2 virus demonstrated equal incidence during winter and summer.

Genomic analysis (Fig. 2)

Figure 2.

Figure 2.

A genomic analysis of the hemagglutinin gene of A/H3N2 viruses obtained in Okinawa.

This study utilized 28 human A/H3N2 influenza virus isolates. A genomic analysis of the samples derived from the same time period revealed that influenza outbreaks may not contain closely related viruses, in Okinawa. However, A/H3N2 (Jun 17/2008) was more closely related to A/H3N2 (Jan 23/2009) than any other sequence. Additionally, A/H3N2 (Aug 20/2012) more closely resembled A/H3N2 (Jan 10/2013) than any other sequence. Taken together, these data suggest that even though the antigenic type was the same, the genomic patterns of summer viruses diverge from previous winter viruses and more closely resemble the viruses detected during the following winter seasons.

Review of the literature (Table 2)

Table 2.

Summary of Summer Influenza Reported from Several Countries.

Nation Virus types Background References
Taiwan A+B Subtropical city 6
China(Jingzhou) A+B Hospitalized adults and adolescents 7
China(Hong Kong) A+B Subtropical city 8
Mexico A(H1N1pdm) School 9
China(Hong Kong) A+B Subtropical city 10
China(Hong Kong) A+B Subtropical city 11
China(Shanghai) A+B Influenza-like illness 12
15 countries A(H5N1) Avian influenza 13
China A Childhood viral acute respiratory infections 14
China Influenza Respiratroy viruses found in children and adults 15
China(Hong Kong) Influenza Elderly patients 16
China A(H7N9) Avian influenza 17
England A+B Influenza and other respiratory viruses 18
Australia A(H1N1pdm) Seroprevalence 19
China A+B Subtropical cities 20
Pakistan A+B Acute respiratory illness 21
China A+B Hospitalization 22
China A Childhood viral acute respiratory infections 23
China A+B Influenza-like illness 24
Taiwan A Moleular epidemiology 25
China A+B Geographic divisions 26
137global locations A+B Global map 27
Japan A(H3N2)+A(H1N1)+B Epidemic 5
Australia A(H3N2)+A(H1N1)+B Epidemic 28
Okinawa A(H3N2)+A(H1N1pdm)+B Influenza-like illness 4
Italy B Travellers to Italy from Lebanon, Senegal, and Uzbekistan 29
Okinawa A+B Epidemic 3
Okinawa A(H3N2)+A(H1N1)+B Epidemic 2
France A(H3N2) Nursing home 30
Japan A(H3)+B Epidemic 31
Vietnam A(H3N2)+A(H1N1)+B Epidemic 32
East and Southwest Asia - Epidemic 1
Japan A(H3N2) Hospital 33
Australia A(H3N2) Prison 34
Australia A(H3N2) Nursing home 35
United Kingdom A(H3N2) Young children 36
USA A(H3N2) Tourists in Yukon and Alaska 37
Australia A Trans-Tasmanian cruise 38
USA and Canada A(H3N2) Cruise ships 39
USA A(H3N2) Nursing home 40
Northern Ireland B School 41

*related to travel, **epidemic in restricted insititutes

There are many reports regarding summer influenza (1-41). Recently, there have been several reports concerning summer influenza from the southern parts of China in multiple climatic environments (7, 8, 10-12, 14-17, 20, 22-24, 26). Summer influenza has also been reported from other subtropical areas such as, Mexico (9), Pakistan (21), Taiwan (6, 25) and Vietnam (32). Epidemics of summer influenza in Japan have been reported in Okinawa (2-5), Hokkaido (31), and Nara (33). In older reports, influenza epidemics in summer were observed primarily as a result of travel (29, 37-39) or as small, contained outbreaks (30, 33-35, 40). Furthermore, in recent articles, it has been demonstrated that summer influenza can be a frequent cause of acute respiratory infections in children and adults (4, 12-16, 18, 21-24).

Discussion

In subtropical areas, it is well-known that influenza pandemics frequently occur in the summer season. In addition, there are several reports concerning summer influenza from the southern parts of China. However, the mechanism behind summer influenza epidemics has not been clarified. As demonstrated in this study, summer epidemics of influenza were frequently observed in the subtropical area of Okinawa, Japan. Furthermore, it has been demonstrated that summer influenza was one of the main causes of acute respiratory infections in children and adults in summer seasons (4, 12-16, 18, 21-24), especially in subtropical areas. Influenza B viruses have been proven to play an important role in summer epidemics and therefore more research should be devoted to determining the molecular correlates or environmental factors causing summer respiratory infections.

Our data also show that the types of influenza viruses obtained in winter are different from those obtained during the summer. A genomic analysis showed that the H3N2 viruses obtained in winter season were genetically different from those cultured in summer. The observed genomic patterns further suggest that summer viruses diverge from the previous winter viruses and more closely resemble the viruses detected in the following winter seasons, providing further proof that subtropical areas of Asia are an important breeding ground for emerging influenza strains.

The impact of the H1N1 2009 pandemic on subtropical and tropical regions is of interest. In the summer of 2009, a new influenza virus produced a significant pandemic in Okinawa. This evidence supports the idea when new and more virulent viruses emerge, significant epidemics can result, regardless of the season.

The data shown in Table 2 indicate that summer influenza has been reported quite frequently recently, especially in subtropical cities. In previous reports, epidemics were found to be related to travel (29, 37-39) or occurred in restricted institutions (30, 31, 34, 35, 40). However, recently, epidemics of the H5N1 avian influenza (13), H7N9 avian influenza (17), and A/H1N1pdm (4, 9, 19) have been reported. Very recently, Hsieh et al. reported on virus types circulating in Taiwan (6). In addition, Zheng et al. reported virus types circulating in Jingzhou, China (7). Surprisingly, the virus types detected in Okinawa are very closely related to those detected in Taiwan (6) and Hong Kong (11) but not in Jingzhou, China (7) or in Pakistan (21), suggesting that the viruses detected in Okinawa might be derived from Taiwan or Hong Kong, or vice-versa.

In conclusion, antigenic and phylogenetic data analyses revealed that influenza viruses consistently co-circulate in Okinawa, causing both summer and winter epidemics. More research is needed to determine the molecular components that cause virulence on a pandemic scale. Our analysis showed that new phylogenetic lineages and antigenic variants emerging in summer were likely to be the progenitors of the epidemic strains during the following traditional winter flu season. Okinawan flu samples might provide important clues for predicting which strains of influenza virus will spread globally.

The authors state that they have no Conflict of Interest (COI).

References

  • 1.Park AW, Glass K. Dynamic patterns of avian and human influenza in east and southeast Asia. Lancet Infect Dis 7: 543-548, 2007. [DOI] [PubMed] [Google Scholar]
  • 2.Suzuki Y, Taira K, Saito R, et al. Epidemiologic study of influenza infection in Okinawa, Japan, from 2001-2007: changing patterns of seasonality and prevalence of amantadine-resistant influenza A virus. J Clin Microbiol 47: 623-629, 2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Higa F, Naka M, Tateyama M, et al. Epidemiology of influenza from 2007 to 2008 in the Naha area, Okinawa prefecture: surveillance of rapid antigen test results. Jpn J Infect Dis 62: 399-401, 2009. [PubMed] [Google Scholar]
  • 4.Nakamura M, Taira K, Tsukagoshi H, et al. Detection of various respiratory viruses in patients with influenza-like illness before and after emergence of the 2009 pandemic H1N1 influenza virus in Okinawa. Jpn J Infect Dis 64: 87-89, 2011. [PubMed] [Google Scholar]
  • 5.Iha Y, Higa F, Sunagawa S, et al. Effect of climatic conditions on epidemic patterns of influenza in Okinawa, Japan, during the pandemic of 2009: surveillance of rapid antigen test results. Jpn J Infect Dis 65: 295-300, 2012. [DOI] [PubMed] [Google Scholar]
  • 6.Hsieh YH, Huang HM, Lan YC. On temporal patterns and circulation of influenza virus strains in Taiwan, 2008-2014: implications of 2009 pH1N1 pandemic. PLoS One 11: e0154695, 2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Zheng J, Huo X, Huai Y, et al. Epidemiology, seasonality and treatment of hospitalized adults and adolescents with influenza in Jingzhou, China, 2010-2012. PLoS One 11: e0150713, 2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Chan PK, Tam WW, Lee TC, et al. Hospitalization incidence, mortality, and seasonality of common respiratory viruses over a period of 15 years in a developed subtropical city. Medicine (Baltimore) 94: e2024, 2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Tamerius J, Viboud C, Shaman J, Chowell G. Impact of school cycles and environmental forcing on the timing of pandemic influenza activity in Mexican states, May-December 2009. PLoS Comput Biol 11: e1004337, 2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Yang L, Chan KH, Suen LK, et al. Age-specific epidemic waves of influenza and respiratory syncytial virus in a subtropical city. Sci Rep 5: 10390, 2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Yang L, Chan KH, Suen LK, et al. Impact of the 2009 H1N1 pandemic on age-specific epidemic curves of other respiratory viruses: A comparison of pre-pandemic, pandemic and post-pandemic periods in a subtropical city. PLoS One 10: e0125447, 2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Fu Y, Pan L, Sun Q, et al. The clinical and etiological characteristics of influenza-like illness (ILI) in outpatients in Shanghai, China, 2011 to 2013. PLoS One 10: e0119513, 2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Mathur MB, Patel RB, Gould M, et al. Seasonal patterns in human A (H5N1) virus infection: analysis of global cases. PLoS One 9: e106171, 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Chen JF, Sun BC, Yuan J, Zhang RS, Ou XH. Surveillance of influenza virus during 2010-2012 in Changsha, China. Southeast Asian J Trop Med Public Health 45: 319-325, 2014. [PubMed] [Google Scholar]
  • 15.Zhang D, He Z, Xu L, et al. Epidemiology characteristics of respiratory viruses found in children and adults with respiratory tract infections in southern China. Int J Infect Dis 25: 159-164, 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lee SS, To KW, Wong NS, Choi KW, Lee KC. Comparison of the characteristics of elderly influenza patients in two consecutive seasons. Int J Infect Dis 24: 40-42, 2014. [DOI] [PubMed] [Google Scholar]
  • 17.Liu J, Xiao H, Wu Y, et al. H7N9: a low pathogenic avian influenza A virus infecting humans. Curr Opin Virol 5: 91-97, 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Zhao H, Green H, Lackenby A, et a. A new laboratory-based surveillance system (Respiratory DataMart System) for influenza and other respiratory viruses in England: results and experience from 2009 to 2012. Euro Surveill 19: pii=20680, 2014. [DOI] [PubMed] [Google Scholar]
  • 19.McVernon J, Laurie K, Faddy H, et al. Seroprevalence of antibody to influenza A(H1N1)pdm09 attributed to vaccination or infection, before and after the second (2010) pandemic wave in Australia. Influenza Other Respir Viruses 8: 194-200, 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Tan Y, Lam TT, Wu C, et al. Increasing similarity in the dynamics of influenza in two adjacent subtropical Chinese cities following the relaxation of border restrictions. J Gen Virol 95(Pt 3): 531-538, 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Badar N, Bashir Aamir U, Mehmood MR, et al. Influenza virus surveillance in Pakistan during 2008-2011. PLoS One 8: e79959, 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Yu H, Huang J, Huai Y, et al. The substantial hospitalization burden of influenza in central China: surveillance for severe, acute respiratory infection, and influenza viruses, 2010-2012. Influenza Other Respir Viruses 8: 53-65, 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Chen Z, Zhu Y, Wang Y, et al. Association of meteorological factors with childhood viral acute respiratory infections in subtropical China: an analysis over 11 years. Arch Virol 159: 631-639, 2014. [DOI] [PubMed] [Google Scholar]
  • 24.Lin J, Kang M, Zhong H, et al. Influenza seasonality and predominant subtypes of influenza virus in Guangdong, China, 2004-2012. J Thorac Dis 5(Suppl 2): S109-S117, 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lin JH, Chiu SC, Lin YC, et al. Exploring the molecular epidemiology and evolutionary dynamics of influenza A virus in Taiwan. PLoS One 8: e61957, 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Zou J, Yang H, Cui H, et al. Geographic divisions and modeling of virological data on seasonal influenza in the Chinese mainland during the 2006-2009 monitoring years. PLoS One 8: e58434, 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Bloom-Feshbach K, Alonso WJ, Charu V, et al. Latitudinal variations in seasonal activity of influenza and respiratory syncytial virus (RSV): a global comparative review. PLoS One 8: e54445, 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kelly HA, Grant KA, Tay EL, Franklin L, Hurt AC. The significance of increased influenza notifications during spring and summer of 2010-11 in Australia. Influenza Other Respir Viruses 7: 1136-1141, 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Gerna G, Percivalle E, Piralla A, Rognoni V, Marchi A, Baldanti F. Surveillance of influenza virus B circulation in Northern Italy: summer-fall 2008 isolation of three strains and phylogenetic analysis. New Microbiol 32: 405-410, 2009. [PubMed] [Google Scholar]
  • 30.Gaillat J, Dennetière G, Raffin-Bru E, Valette M, Blanc MC. Summer influenza outbreak in a home for the elderly: application of preventive measures. J Hosp Infect 70: 272-277, 2008. [DOI] [PubMed] [Google Scholar]
  • 31.Kikuchi M, Yamamoto M, Yoshida Y, Miyashita T, Fujita K. Epidemics of influenza from winter to summer in the 2005/06 season in Sapporo, Japan. Jpn J Infect Dis 60: 152-153, 2007. [PubMed] [Google Scholar]
  • 32.Nguyen HL, Saito R, Ngiem HK, et al. Epidemiology of influenza in Hanoi, Vietnam, from 2001 to 2003. J Infect 55: 58-63, 2007. [DOI] [PubMed] [Google Scholar]
  • 33.Yonezawa Y, Inoue Y, Kitahori Y, Nakano M. An influenza AH3 outbreak in a hospital, Nara Prefecture, Japan, in summer 2005. Jpn J Infect Dis 59: 62-63, 2006. [PubMed] [Google Scholar]
  • 34.Ferson MJ, Morgan K, Robertson PW, Hampson AW, Carter I, Rawlinson WD. Concurrent summer influenza and pertussis outbreaks in a nursing home in Sydney, Australia. Infect Control Hosp Epidemiol 25: 962-966, 2004. [DOI] [PubMed] [Google Scholar]
  • 35.Wolf DG, Rekhtman D, Kerem E, et al. A summer outbreak of influenza A virus infection among young children. Clin Infect Dis 39: 595-597, 2004. [DOI] [PubMed] [Google Scholar]
  • 36.Young LC, Dwyer DE, Harris M, Guse Z, Noel V, Levy MH, Prison Influenza Outbreak Investigation Team . Summer outbreak of respiratory disease in an Australian prison due to an influenza A/Fujian/411/2002(H3N2)-like virus. Epidemiol Infect 133: 107-112, 2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Uyeki TM, Zane SB, Bodnar UR, Alaska/Yukon Territory Respiratory Outbreak Investigation Team, et al. Large summertime influenza A outbreak among tourists in Alaska and the Yukon Territory. Clin Infect Dis 36: 1095-1102, 2003. [DOI] [PubMed] [Google Scholar]
  • 38.Ferson M, Paraskevopoulos P, Hatzi S, Yankos P, Fennell M, Condylios A. Presumptive summer influenza A: an outbreak on a trans-Tasman cruise. Commun Dis Intell 24: 45-47, 2000. [DOI] [PubMed] [Google Scholar]
  • 39.Miller JM, Tam TW, Maloney S, et al. Cruise ships: high-risk passengers and the global spread of new influenza viruses. Clin Infect Dis 31: 433-438, 2000. [DOI] [PubMed] [Google Scholar]
  • 40.Kohn MA, Farley TA, Sundin D, Tapia R, McFarland LM, Arden NH. Three summertime outbreaks of influenza type A. J Infect Dis 172: 246-249, 1995. [DOI] [PubMed] [Google Scholar]
  • 41.Forsyth JR. Summer outbreak of influenza type-B. Lancet 1: 1400-1401, 1962. [DOI] [PubMed] [Google Scholar]

Articles from Internal Medicine are provided here courtesy of Japanese Society of Internal Medicine

RESOURCES