Skip to main content
BioMed Research International logoLink to BioMed Research International
. 2017 Jan 18;2017:4091856. doi: 10.1155/2017/4091856

Antibiotic Resistance of Campylobacter Recovered from Faeces and Carcasses of Healthy Livestock

Akosua B Karikari 1,*, Kwasi Obiri-Danso 2, Enoch H Frimpong 3, Karen A Krogfelt 4
PMCID: PMC5286542  PMID: 28194411

Abstract

Campylobacter is of major significance in food safety and human and veterinary medicine. This study highlighted resistance situation in the area of veterinary public health in Ghana. Using selective mCCDA agar, isolates were confirmed phenotypically on API CAMPY and genotypically by multiplex PCR of IpxA gene. The susceptibility profile of species to common and relevant antibiotics was determined by the Kirby-Bauer disk diffusion method. Cattle, sheep, goat, and pig faecal samples analysed, respectively, yielded 13.2% (16/121), 18.6% (22/102), 18.5% (25/135), and 28.7% (29/101) Campylobacter species while 34.5% (38/110), 35.9% (42/117), 23.9% (32/134), and 36.3% (37/102) were, respectively, recovered from the carcasses. Species identified in faeces were C. jejuni 35.8% (33/92), C. jejuni subsp. doylei 4.3% (4/92), C. coli 47.8% (44/92), and C. lari 12.0% (11/92). Species discovered in carcasses were C. jejuni 83.9% (125/149), C. jejuni subsp. doylei 2.0% (3/149), C. coli 6.0% (9/149), and C. lari 8.1% (12/149). Resistance ranged from 92 to 97% to the β-lactams, 7 to 69% to the quinolones, 0 to 44% to the aminoglycosides, 97 to 100% to erythromycin, 48 to 94% to tetracycline, 45 to 88% to chloramphenicol, and 42 to 86% to trimethoprim/sulfamethoxazole as 0% resistance was observed against imipenem.

1. Introduction

Campylobacter is a key zoonotic pathogen which causes foodborne enteritis with C. jejuni and C. coli being the most isolated species [1]. Campylobacter infections in humans are mainly associated with consumption of undercooked chicken as exposure to farm animals, consumption of pork, improperly cooked beef, raw milk, and untreated water are other transmission routes. The significant contribution of ruminants as important reservoirs of Campylobacter has been established through molecular epidemiological research [2]. Due to growing demand for meat and products of livestock, the possibility of disease transmission from these food animals' sources cannot be dismissed. Increasing antibiotic resistance in Campylobacter from animal sources is well reported globally [3–6]. Resistance has developed to nearly all antibiotics used in veterinary medicine [7].

Livestock production in Ghana currently is changing from free range to commercial productions with increased use of antimicrobials as growth promoters and therapeutic agents. Such practice could increase levels of resistant bacteria in the gut-intestinal flora of animals, such as Campylobacter, and subsequently increase resistance in foods due to faecal contamination during slaughter. In Ghana, regional reports of heightening drug resistance among several pathogens from human sources have been documented [8]; however research on resistance of bacteria from animal sources is very sketchy. The purpose of this study was to highlight resistance trends in the area of veterinary public health. Therefore isolation rate and level of antimicrobial resistance among Campylobacter species from faeces and carcasses of livestock were reported.

2. Materials and Method

2.1. Study Site

The study was conducted at the Kumasi Abattoir. Kumasi is the capital of Ashanti region and the second most populous Metropolis in Ghana. The abattoir supplies Ghanaian markets with slaughtered, processed, and packaged goats, cattle, pigs, and sheep. The daily slaughtering capacity is about 200 cattle, 100 pigs, and 250 sheep and goats. Animals intended for slaughter at the abattoir are transported from different regions within Ghana especially from Yeji in Brong Ahafo and the Northern regions and also from neighbouring countries like Burkina Faso, Mali, and Niger.

2.2. Sample Collection

Fresh faecal samples were collected from individual animals (cattle, pigs, goats, and sheep) from unrelated herds at the Kumasi Abattoir slaughterhouse complex. A single animal was selected at random and about 5 g of faeces was aseptically removed from the bowel after evisceration at the slaughtering line. Samples were collected into sterile ziplock bags, kept on ice and returned to the laboratory for processing. Carcasses of cows, sheep, goats, and pigs being packaged at the abattoir for the markets were randomly swabbed using sterile swab sticks and inoculated into sterile Amies Transport Medium (Copan ESwab sticks, Italy) and transferred to the laboratory on ice. Sampling took place from March 2013 to February 2014.

2.3. Processing, Isolation, and Identification

About 0.2 g of faecal material was plated directly onto mCCDA agar plates (Oxoid CM0698) using sterile swab stick and incubated at 42°C for 48 hrs. Carcass swabs together with the transport media were aseptically transferred into sterile bijou bottles and preenriched with 5 mL of blood-free Campylobacter broth (Oxoid CM0963) supplemented with CCDA selective supplement (Oxoid, SRO 155E) and incubated overnight at 37°C. The overnight enrichment culture was cultured onto mCCDA agar plate and incubated at 42°C for 48 hrs. CampyGen (Oxoid CN0025A) was introduced to provide microaerophilic condition. Colonies showing typical morphology of Campylobacter spp. were subcultured onto Nutrient agar, followed by biochemical tests including Gram stain, oxidase, and catalase. Isolates which were small, curved, catalase, and oxidase positive; Gram negative bacilli were presumed to be Campylobacter spp. The presumed isolates were further subjected to standard phenotypic tests using API CAMPY system (bioMérieux, Marcy l'Etoile, France) to identify to species level.

2.4. Genotyping of Campylobacter Species by Multiplex PCR

2.4.1. DNA Extraction

Genomic DNA was isolated from cultures grown on 5% sheep blood agar (Accumix, AM5014, India) for 24 to 48 h at 37°C under microaerophilic conditions. Cell lysates were prepared by suspending a 10 μL loopful of growth in 100 μL of sterile distilled water in a microcentrifuge tube. The tubes were heated at 100°C for 10 min and subsequently cooled to 4°C. The tubes were centrifuged at 13,000 rpm (Sigma, Germany) for 5 min, and the supernatant was stored at −20°C for further analysis.

2.4.2. Genus-Specific PCR Amplification

The primers of the lpxA gene (DNA Technology, Denmark) were used in this study [9]. Forward primers complementary to the lpxA nucleotide sequence of C. coli (lpxA C. coli), C. jejuni (lpxA C. jejuni), C. lari (lpxA C. lari), and C. upsaliensis (lpxA C. upsaliensis) were used in combination with the reverse primer lpxARKK2m for confirmation of Campylobacter species by multiplex PCR with expected amplicon (fragment) sizes (Table 1). The reaction mixture consisted of 2 μL Taq buffer 10x, 0.7 μL Taq polymerase (Fermentas, UK), forward primer 50 pmol (0.5 μL), 50 pmol (0.5 μL) reverse primer, dNTPs 5 Mm, 0.4 μL, and nuclease free water 12.9 μL, 0.5 μL of each primer, and 1.5 μL of the genomic DNA template. The reaction tubes (20 μL) were placed in the thermal cycler (Thermo PCR, Sprint, USA). The cycle involved initial denaturing at 94°C for 5 min. The denatured DNA was maintained at 94°C for 1 min followed by annealing of primers to the DNA template at 50°C for 1 min; the annealed primers were extended at 72°C for 2 min. This cycle was repeated 30x and a final filling-in at 72°C was carried out for 10 min [9]. The PCR products were run on 1% agarose gel (Sigma, Germany) at 100 V for 45 minutes; the separated PCR products (bands) were visualized with UV imager (Syngene, USA). A 1 kb ladder was used as a molecular size standard. Campylobacter strains obtained from Statens Serum Institute (Denmark) were used as positive control and a negative control was included and examined.

Table 1.

PCR primers of IpxA gene of Campylobacter species used in this study.

Primers Sequence (5′-3′) Size (bp)
IpxA C. coli (F) AGACAAATAAGAGAGAATCAG 391
IpxA C. jejuni (F) ACAACTTGGTGACGATGTTGTA 331
IpxA C. lari (F) TRCCAAATGTTAAAATAGGCGA 233
IpxA C. upsaliensis (F) AAGTCGTATATTTTCYTACGCTTGTGTG 206
IpxARKK2m (R) CAATCATGDGCDATATGASAATAHGCCAT  

F = forward; R = reverse.

2.5. Antibiotic Susceptibility Test

Susceptibility tests were performed by the Kirby-Bauer disk diffusion method on Mueller-Hinton agar (Liofilchem, Italy) supplemented with 5% sheep blood following CLSI guidelines. Antibiotics tested and their corresponding concentrations were ampicillin (10 μg/disc), chloramphenicol (30 μg/disc), ciprofloxacin (5 μg/disc), kanamycin (30 μg/disc), erythromycin (15 μg/disc), gentamicin (10 μg/disc), nalidixic acid (30 μg/disc), tetracycline (30 μg/disc), cephalexin (30 μg/disc), trimethoprim/sulfamethoxazole (25 μg/disc), norfloxacin (10 μg/disc), cefotaxime (30 μg/disc), and imipenem (10 μg/disc). Mueller-Hinton agar plates were inoculated with 0.5 McFarland suspension and incubated under microaerophilic condition at 48°C for 24 hours. The inhibition zones were recorded and interpreted following EUCAST and CLSI breakpoints for Campylobacter. Breakpoints established by EUCAST and CLSI 2013 for Enterobacteriaceae were used to interpret the results of norfloxacin, trimethoprim/sulfamethoxazole, cefotaxime, and kanamycin as CLSI Campylobacter breakpoints for these antibiotics have not yet been established. Quality control was achieved by Escherichia coli (ATCC 25922) and Staphylococcus aureus (ATCC 25923) strains.

2.6. Statistical Analysis

Data were transferred to a Microsoft Excel spreadsheet for analysis. Descriptive analysis was carried out using percentages. Associations were determined using the Chi-square test at a significance level of < 0.05. All statistical tests were two-tailed. Stata 14.0 software was used for statistical analysis.

3. Results

3.1. Prevalence of Campylobacter in Food Animals

Of the cattle, sheep, goat, and pig faecal samples, 16 (13.2%), 22 (18.6%), 25 (18.5%), and 29 (28.7%) were, respectively, characterized as Campylobacter species. From the carcasses of the cattle, sheep, goats, and pigs, 34.5% (38/110), 35.9% (42/117), 23.9% (32/134), and 36.3% (37/102) isolates were positive for Campylobacter (Table 2). There was statistically significant difference in the isolation rate of Campylobacter from faecal and carcass samples of cattle (p < 0.001) and sheep (p = 0.003) but no significant difference in the isolation frequency between that of goats (p = 0.268) and pigs (p = 0.250) (Table 3).

Table 2.

Isolation rate of Campylobacter from faeces and carcasses of animals.

Animal Total
number of samples
Number of Campylobacter spp.
identified N (%)
  Faeces  
Cattle 121 16 (13.2)
Sheep 118 22 (18.6)
Goat 135 25 (18.5)
Pig 101 29 (28.7)

  Carcass  
Cattle 110 38 (34.5)
Sheep 117 42 (35.9)
Goat 134 32 (23.9)
Pig 102 37 (36.3)

Table 3.

Association between isolation rate of faecal and carcass samples of animals.

Source Campylobacter occurrence p value
Faeces Carcass
n (%) n (%)
Cattle 16 (13.2) 38 (34.5) <0.001
Sheep 22 (18.6) 42 (35.9) 0.003
Goat 25 (18.5) 32 (23.9) 0.268
Pig 29 (28.7) 37 (36.3) 0.250

3.2. Distribution of Campylobacter Species in the Various Animals

Faecal content isolates of cattle, sheep, goat, and pigs were 25.0%, 27.2%, 36.0%, and 48.2% C. jejuni, 43.7%, 40.9%, 56.0%, and 48.2% C. coli, and 12.5%, 27.2%, 8.0%, and 3.4% C. lari, respectively. Campylobacter subsp. doylei were recovered from cattle (18.7%) and sheep (4.5%) and none in goats and pigs. The carcasses of cattle, sheep, goats, and pigs were 84.2%, 92.8%, 81.3%, and 75.6% C. jejuni and 2.6%, 2.3%, 18.7%, and 10.8% C. lari. Campylobacter coli were found in cattle (13.1%) and pigs (10.8%) but none in sheep and goats, while C. subsp. doylei were obtained from sheep (4.7%) and pigs (2.7%) but not in goat and cattle samples (Table 4).

Table 4.

Distribution of Campylobacter species in the carcasses and faecal contents of animals.

Source Number of
samples
C. jejuni C. doylei C. coli C. lari
n (%) n (%) n (%) n (%)
Cattle faeces 16 4 (25.0) 3 (18.7) 7 (43.7) 2 (12.5)
Cattle carcass 38 32 (84.2) 0 (0) 5 (13.1) 1 (2.6)
Sheep faeces 22 6 (27.2) 1 (4.5) 9 (40.9) 6 (27.2)
Sheep carcass 42 39 (92.8) 2 (4.7) 0 (0.0) 1 (2.3)
Goat faeces 25 9 (36.0) 0 (0) 14 (56.0) 2 (8.0)
Goat carcass 32 26 (81.3) 0 (0) 0 (0) 6 (18.7)
Pig faeces 29 14 (48.2) 0 (0) 14 (48.2) 1 (3.4)
Pig carcass 37 28 (28.4) 1 (2.7) 4 (10.8) 4 (10.8)

C. doylei = C. jejuni subsp. doylei.

3.3. Molecular Identification and Confirmation of Isolates

The PCR of the (lpxA) gene of Campylobacter confirmed 92 out of 96 faecal and carcass isolates from the various food animals. Multiplex PCR identified 52/92 (56.5%%) as Campylobacter jejuni, 33/92 (35.8%) as Campylobacter coli, and 7/92 (7.6%) as C. lari (Figures 1 and 2). Culture method and API reactions were 95.8% in agreement with the PCR results.

Figure 1.

Figure 1

Multiplex PCR detection of Campylobacter lpxA gene on agarose gel electrophoresis. M = Molecular Marker 1 kb; Lane 2 = C. lari (233 bp); Lane 3 = C. jejuni (331 bp); Lane 4 = C. coli (391 bp); Lanes 1 and 5 = negative control.

Figure 2.

Figure 2

Multiplex PCR detection of Campylobacter lpxA gene of isolates on agarose gel electrophoresis. M = Molecular Marker 1 kb; Lanes 1, 2, 3 5, 6, 15, 16, 17, and 18 = C. jejuni; Lanes 4, 10, 11, and 14 = C. coli; Lane 7 = C. lari.

3.4. Resistance Profile of Faecal Isolates of Animals

Cattle isolates' resistance to erythromycin, chloramphenicol, and trimethoprim/sulfamethoxazole was, respectively, 100%, 88%, 56%, and 81% each to ampicillin and tetracycline. Against the cephalosporins resistance was 75% to cefotaxime and 81% to cephalexin. Resistance to the quinolones was 50% to nalidixic acid, 44% to ciprofloxacin, and 19% to norfloxacin. Resistance to the aminoglycosides was 6% to kanamycin and 0% to gentamicin.

Sheep isolates' resistance was 100% to erythromycin, 86% to trimethoprim/sulfamethoxazole, 91% each to ampicillin and tetracycline, and 55% to chloramphenicol. Against the cephalosporins resistance was 86% to cefotaxime and 91% to cephalexin. Resistance to the quinolones was 50% to ciprofloxacin and 36% each to nalidixic acid and norfloxacin. Against the aminoglycosides, resistance was 18% to kanamycin and 14% to gentamicin.

Goat strains expressed resistance of 100% 88%, 76%, 64%, and 60%, respectively, to erythromycin, ampicillin, tetracycline, chloramphenicol, and trimethoprim/sulfamethoxazole. Against the cephalosporins resistance was 72% to cephalexin and 68% to cefotaxime. Resistance to the quinolones was 28% to ciprofloxacin, 12% to norfloxacin, and 8% to nalidixic acid. Against the aminoglycosides, resistance was 8% to kanamycin and 0% to gentamicin.

Pig isolates showed resistance of 100%, 86%, 83%, 48, and 45%, respectively, to erythromycin, tetracycline, ampicillin, trimethoprim/sulfamethoxazole, and chloramphenicol. Against the cephalosporins resistance was 86% to cephalexin and 62% to cefotaxime. Resistance to the quinolones was 24% to ciprofloxacin, 17% to norfloxacin, and 10% to nalidixic acid. Resistance to the aminoglycosides was 10% each to kanamycin and gentamicin (Table 5). No resistance (0%) was recorded against imipenem; however intermediate susceptibility was observed among strains from all the animals.

Table 5.

Susceptibility patterns of faecal isolates of animals.

Antibiotic Animal
Cattle (N = 16) Sheep (N = 22) Goat (N = 25) Pig (N = 29)
S I R S I R S I R S I R
Nalidixic acid 50 NA 50 64 NA 36 92 NA 8 90 NA 10
Tetracycline 13 6 81 9 0 91 12 12 76 7 7 86
Erythromycin 0 NA 100 0 NA 100 0 NA 100 0 NA 100
Ciprofloxacin 37 19 44 14 36 50 48 24 28 41 35 24
Chloramphenicol 6 6 88 4 41 55 12 24 64 14 41 45
Ampicillin 0 19 81 4 5 91 8 4 88 3 14 83
Cefotaxime 25 0 75 9 5 86 28 4 68 14 24 62
Kanamycin 50 44 6 27 55 18 68 24 8 38 52 10
Gentamicin 62 38 0 68 18 14 80 20 0 86 4 10
Norfloxacin 50 31 19 59 5 36 76 12 12 76 7 17
Trimethoprim/sulfamethoxazole 44 0 56 14 0 86 40 0 60 52 0 48
Cephalexin 19 NA 81 9 NA 91 28 NA 72 14 NA 86
Imipenem 69 31 0 68 32 0 92 8 0 72 28 0

S = sensitive; I = intermediate; R = resistant; NA = intermediate not available, values presented in percentages.

3.5. Resistance Profile of Carcass Isolates of Animals

Cattle isolates showed resistance of 97% each against erythromycin and ampicillin, 87%, 58%, and 42%, respectively, to chloramphenicol, tetracycline, and trimethoprim/sulfamethoxazole. Against the cephalosporins resistance was 97% to cephalexin and 92% to cefotaxime. Resistance to the quinolones was 42% to ciprofloxacin, 21% to norfloxacin, and 13% to nalidixic acid. Against aminoglycosides, resistance was 19% to kanamycin and 18% to gentamicin.

Sheep isolates showed resistance of 100%, 93%, 83%, 52%, and 48%, respectively, to erythromycin, ampicillin, chloramphenicol, trimethoprim/sulfamethoxazole, and tetracycline. Against the cephalosporins resistance was 100% to cefotaxime and 98% to cephalexin. Resistance to the quinolones was 42% to ciprofloxacin, 21% to norfloxacin, and 17% to nalidixic acid. Against the aminoglycosides, resistance was 14% to kanamycin and 12% to gentamicin.

Goat isolates showed resistance of 100%, 97%, 94%, 84%, and 75%, respectively, to erythromycin ampicillin, tetracycline, chloramphenicol, and trimethoprim/sulfamethoxazole. Against the cephalosporins, resistance was 100% to cephalexin and 91% to cefotaxime. Resistance to the quinolones was 69% to nalidixic acid, 62% to ciprofloxacin, and 47% to norfloxacin. Resistance to the aminoglycosides was 44% to kanamycin and 34% to gentamicin.

Pig isolates showed 100%, 97%, 86%, 60%, and 54% resistance, respectively, to erythromycin, ampicillin, chloramphenicol, tetracycline, and trimethoprim/sulfamethoxazole. Against the cephalosporins resistance was 100% to cephalexin and 97% to cefotaxime. Resistance to the quinolones was 51% to nalidixic acid, 35% to ciprofloxacin, and 22% to norfloxacin. Resistance to the aminoglycosides was 0% to kanamycin and 30% to gentamicin.

No resistance (0%) was recorded against imipenem; however intermediate susceptibility was observed among strains from all the animals (Table 6).

Table 6.

Susceptibility pattern of carcass isolates of animals.

Antibiotic Animal
Cattle (N = 38) Sheep (N = 42) Goat (N = 32) Pig (N = 37)
S I R S I R S I R S I R
Nalidixic acid 87 NA 13 83 NA 17 31 NA 69 49 NA 51
Tetracycline 24 18 58 40 12 48 6 0 94 24 16 60
Erythromycin 3 0 97 0 NA 100 0 NA 100 0 NA 100
Ciprofloxacin 34 24 42 38 38 24 19 19 62 49 16 35
Chloramphenicol 5 8 87 3 14 83 6 10 84 3 11 86
Ampicillin 0 3 97 5 2 93 0 3 97 3 0 97
Cefotaxime 8 0 92 0 0 100 9 0 91 0 3 97
Kanamycin 68 13 19 57 29 14 19 37 44 57 43 0
Gentamicin 79 3 18 88 0 12 60 6 34 62 8 30
Norfloxacin 68 11 21 83 10 7 37 16 47 65 13 22
Trimethoprim/sulfamethoxazole 53 5 42 48 0 52 25 0 75 46 0 54
Cephalexin 3 NA 97 2 NA 98 0 NA 100 0 NA 100
Imipenem 76 24 0 81 19 0 84 16 0 76 24 0

S = sensitive; I = intermediate; R = resistant; NA = intermediate not available, values presented in percentages.

3.6. Species-Specific Resistance Profile of Animals

Resistance of C. jejuni strains to the quinolones was 23% to nalidixic acid, 25.5% to norfloxacin, and 40.2% to ciprofloxacin. Against the cephalosporins, resistance was 92.6% and 99.5% to cefotaxime and cephalexin, respectively. Resistance to aminoglycosides was 17.1% to kanamycin and 21.1% to gentamicin. Resistance to erythromycin, ampicillin, chloramphenicol, tetracycline, and trimethoprim/sulfamethoxazole, respectively, was 99.5%, 96.5%, 87.7%, 69.8%, and 58.8%.

Resistance among C. coli strains to the quinolones was 2.9% each to nalidixic acid and norfloxacin and 37.7% to ciprofloxacin. Resistance to the cephalosporins was 66.7% to cefotaxime and 72.5% to cephalexin. Against the aminoglycosides, resistance was 1.4% to gentamicin and 8.7% to kanamycin. Resistance to erythromycin, tetracycline, ampicillin, trimethoprim/sulfamethoxazole, and chloramphenicol, respectively, was 100%, 89.8%, 84%, 71%, and 43.5%.

Resistance of C. lari to the quinolones was 100% to nalidixic acid, 93.3% to ciprofloxacin, and 83.3% to norfloxacin. Against the cephalosporins, resistance was 93.3% to the cefotaxime and 100% to the cephalexin. Resistance to aminoglycosides was 26.7% to gentamicin and 36.7% to kanamycin. Resistance to erythromycin was 100%, to ampicillin and tetracycline 96.7% each, to trimethoprim/sulfamethoxazole 90%, and to chloramphenicol 66.7% (Table 7).

Table 7.

Species-specific resistance profile of strains from food animals.

  C. jejuni = 204 C. coli = 69 C. lari = 30
Antibiotic % resistance % resistance % resistance
Nalidixic acid 23 2.9 100
Cefotaxime 92.6 66.7 93.3
Erythromycin 99.5 100 100
Tetracycline 69.8 89.8 96.7
Kanamycin 17.1 8.7 36.7
Gentamicin 21.1 1.4 26.7
Ampicillin 96.5 84 96.7
Imipenem 0 0 0
Cephalexin 99.5 72.5 100
Ciprofloxacin 40.2 37.7 93.3
Chloramphenicol 87.7 43.5 66.7
Norfloxacin 25.5 2.9 83.3
SXT 58.8 71 90

3.7. Multidrug Resistance (MDR) in Campylobacter Species from Animals

Resistance to three (3) or more antibiotics was defined as multidrug resistance (MDR) in this study. Strains of C. jejuni, C. coli, and C. lari, respectively, showed multidrug resistance of 66.6% (156/234), 20.5% (48/234), and 12.8% (30/234). Multidrug resistance in C. jejuni strains from the animal carcasses was consistently higher than faecal strains across studied animals. Contrastingly, higher MDR was observed in C. coli strains obtained from faecal sources of the animals. With the exception of sheep, the differences in MDR of faecal and carcass strains from pigs (p = 0.000), goats (p = 0.003), and cattle (p = 0.012) were statistically significant.

4. Discussion

The fastidious nature of Campylobacter coupled with its susceptibility to environmental stresses such as heat, drying, and exposure to air often results in damaged cells which hamper their recovery to a greater extent than most bacteria. Again, a viable but nonculturable (VBNC) state exhibited by Campylobacter can result in underestimation or nondetection of the organism by culture-based techniques, yet cells in this state can still infect susceptible hosts [10]. Notwithstanding, Campylobacter have been isolated from animals in different countries at varying rates. Documented range of 5–49% has been reported in sheep and goats [11, 12], 0–80% in cattle, and 50–100% in pigs [13, 14].

In our study, Campylobacter prevalence ranged from 13.2 to 28.7% in faecal samples and from 23.9 to 36.3% in the carcasses and again Campylobacter recoveries from carcasses were more than from faeces. This could be due to contamination of carcasses with intestinal contents during manual skinning, evisceration, carcass washing, and processing at the abattoir. Similarly, A Mpalang et al. [15] recorded 50% Campylobacter prevalence in carcasses compared to 20% in faecal samples. The 13.2% recovery rate from cattle faeces in this study compares to the 12.7% in Ethiopia but is lower than studies in USA (26.7%–29.1%), Finland (31.1%), and Canada (76–95%) [16–19]. Campylobacter contamination in cattle carcasses are generally low; however, Noormohamed and Fakhr [20] reported 78% from beef livers which is higher than the 35.2% obtained in this study. Lower isolation rates have also been reported in different countries [18, 21].

The 18.6% Campylobacter prevalence in sheep faeces is lower than the 23% and 38.0% rates reported in studies in Ghana and Ethiopia, respectively [17, 22], but higher than the 4.5% reported in USA [23]. In sheep carcasses, rates of 11.0% have been reported in Ethiopia which is lower than the 35.9% obtained in this study although a higher rate of 72.2% has been described in Greece [24, 25]. The 18.5% Campylobacter recovery in goat faeces from this study was lower than the 33% and 20% reported by Abrahams et al. [22] and Salihu et al. [11] in studies in Ghana and Nigeria, but higher than the 3.2% reported in USA [15, 23]. Goat meat is not known to be a major source of campylobacteriosis; however, the high utilization of mutton in local Ghanaian dishes may contribute to the increased transmission source. In goat carcasses, Campylobacter contamination rates of 50% and 63.5% have been reported from Congo and Greece, with 9.4% in Ethiopia compared to the 23.9% in our study [15, 24, 25].

Campylobacter prevalence of 28.7% recovered from pig faeces was lower compared to 42.4%, 50%, and 71.4% in studies in Japan, Ethiopia, and Mexico [17, 26, 27]. Geographical distribution of Campylobacter contamination in pig carcasses is fairly low (2.0–25.3%) [20, 27] which is still lower than the 36.3% in this study. Campylobacter contamination in pig carcasses has been documented in various studies [28]. It must be noted that there were no significant differences in contamination rates of the various food animal carcasses which may be as a result of the levels of colonization of slaughter animals, abattoir hygiene, slaughter, and dressing methods [29].

Campylobacter jejuni and C. coli were the most commonly identified species although C. coli were more in faecal samples and C. jejuni were more in carcasses. Similar findings were made by A Mpalang et al. [15] who also recovered more C. coli (26.1%) than C. jejuni (10.1%) from faecal isolates of goats in Ethiopia; 25.9% C. coli and 3.4% C. jejuni in nondiarrhoeic goat faeces have been documented in South Africa [30]. These findings suggest that C. coli are more common in Africa [31]. Campylobacter jejuni dominance in carcasses (83.9%) is comparable to work by Wieczorek et al. [4] and Noormohamed and Fakhr [20]. However, a number of studies have rather shown higher C. jejuni in faecal samples of animals [17, 23, 26].

Although C. coli is the most commonly identified species in pigs [32, 33]; an interesting pattern was discovered in our study where C. jejuni and C. coli isolations were similar (48.2% each) in pig faeces and a rather higher C. jejuni (75.6%) than C. coli (10.8%) in the carcasses. Matthew-Belmar et al. [34] and Kramer et al. [35] recorded more C. jejuni (53.5%) than C. coli (46.5%) from pigs in Grenada and UK, respectively. However, higher C. coli than C. jejuni have been recorded in Nigeria [36], in Ethiopia [17], and in Poland [21]. Other studies do show that C. jejuni may coexist with C. coli in pigs but usually the C. jejuni are always present in 10–100-fold lower numbers than C. coli [37]. In Ghana, most of the farms rear multiple animals and it could be that the pigs may have acquired the C. jejuni from poultry on the same farm [23, 38].

Conventional culture methods and API biochemical reactions of isolates from food animals were 95.8% in agreement with the results of PCR for identification and differentiation of Campylobacter species which is comparable with data from other studies [9, 39]. The bacteriological methods (culture and API) are as reliable as the molecular PCR (IpxA gene) method in detecting Campylobacters from animals.

The limitation in detecting antibiotic resistance in this study was as it is in all studies dependent on culture that the resistance rates were determined according to the bacteria species that were culturable at the time of analysis. Direct PCR on the specimens might be more sensitive but not detecting the actual species where the antibiotic resistance genes are present in.

High levels of resistance were expressed against most of the antibiotics. Faecal and carcass strains showed resistance range of 97–100% to erythromycin which is consistent with work in Nigeria and Spain, where resistance of 81–82.6% to erythromycin has been described [3, 5], but lower rates have been reported in Ethiopia (60.3%) and USA (55%) [6, 20].

Similarly, Ampicillin resistance ranged from 93% to 100% which agrees with studies in India [40] and in Ethiopia, Spain, and USA [3, 6, 20]. Resistance to the cephalosporins ranged from 62 to 97% to cefotaxime and 72 to 100% to cephalexin which is consistent with reports from Ghana (95.8%) and other countries where rates of 95.8–100% have been established [6, 20, 22, 40]. Resistance range of 6–69% was observed in our study against the quinolones which is lower than rates described in USA (100%), Ethiopia (80.5%), Poland (86.8%–88.1%), and Thailand (91–100%) [4, 6, 20, 41] and for the aminoglycosides a range of 0–44% was recorded which is comparable to rates from Poland, Grenada, and Spain [3, 4, 34] but lower than established rates in Nigeria and Ethiopia [5, 6].

Resistance to tetracycline was between 58 and 94% which is consistent with documented rates in Poland, USA, Ethiopia, and Thailand [4, 6, 20, 41] as resistance to chloramphenicol was in the range of 45–88% higher than rates of 61.5% and 67.4% reported against chloramphenicol in Ethiopia and Nigeria, respectively [5, 6]. No resistance was observed against imipenem although intermediate susceptibility was found in both faecal and carcass isolates. Generally, resistant strains were commonly found in cattle and sheep compared to goats and pigs and resistance was also higher in the carcasses than in the faecal isolates.

The extensive application of antibiotics in animal husbandry for therapy, prophylaxis, and growth promotion has often been associated with the spread of resistance. Another factor contributing to the increase and spread of resistance is intensive rearing which promotes clinical infections in animals leading to widespread prophylactic usage of drugs which may be unwarranted. Currently in Ghana livestock production is changing from free range to commercial productions and may have added to the high level resistance currently documented.

Antibiotic use in animal feed as growth promotants also plays a significant role in the spread of resistance. Worldwide, antibiotics are widely used in livestock and poultry for growth promotion to enhance feed utilization and production [14]. In Ghana, 98% of livestock farmers use antibiotics on their farms as growth promoters and in the management of diseases. The antibiotics used are mainly tetracyclines (oxytetracycline, doxycycline, remacycline, and chlortetracycline), sulphadimidine, dihydrostreptomycin, piperazine, albendazole, tylosin, ivermectin, and benzylpenicillin which can lead to possible cross- and co-resistance [42, 43]. In a study in Kumasi, the knowledge of livestock farmers on antibiotics, withdrawal periods, and dosages was very low and farmers usually depended more on fellow farmers than veterinarians for antibiotic knowledge. Poor dosing practices especially when an antibiotic failed to resolve an infection were a common practice. In such cases, different antibiotics were tried and abused until the disease was treated [43].

Also the challenge of distinguishing different antibiotic brands of the same active ingredient resulted in the application of different antibiotic brands of the same active ingredient which saw no improvement in the disease condition [43]. In the Northern Region of Ghana, Addah et al. [44] reported of nonadherence to dosing and withdrawal periods among several livestock farmers. These practices ultimately increase antibiotic residues in faecal content and carcasses of these animals which is evident in the high level resistance established in this study.

5. Conclusion

The study has revealed multidrug resistant Campylobacter species in the faecal content and carcasses of healthy livestock animals in Ghana indicating possible risks of infection to people through consumption of contaminated animal products or by direct contact with animals. Moreover high levels of resistance observed among the Campylobacter species to the common and cheap antibiotics raise uncertainties about their effectiveness in the treatment of animal and human diseases in the study region. It is urgent that extensive education and training are given to livestock farmers on judicious application of antibiotics and a national antibiotic resistance management team setup to monitor and control antibiotic use in both human and veterinary medicine.

Acknowledgments

This study was funded by ADMER (https://www.admerproject.org) for which the authors are grateful. The authors acknowledge the technical support of Nana Aboagye Acheampong of the Department of Theoretical and Applied Biology, Kwame Nkrumah University of Science and Technology. They also thank the management and staff of the Kumasi Abattoir for providing specimens for the study.

Competing Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.

References

  • 1.Scallan E., Hoekstra R. M., Angulo F. J., et al. Foodborne illness acquired in the United States-Major pathogens. Emerging Infectious Diseases. 2011;17(1):7–15. doi: 10.3201/eid1701.P11101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Sahin O., Fitzgerald C., Stroika S., et al. Molecular evidence for zoonotic transmission of an emergent, highly pathogenic Campylobacter jejuni clone in the United States. Journal of Clinical Microbiology. 2012;50(3):680–687. doi: 10.1128/jcm.06167-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Sáenz Y., Zarazaga M., Lantero M., Gastañares M. J., Baquero F., Torres C. Antibiotic resistance in Campylobacter strains isolated from animals, foods, and humans in Spain in 1997–1998. Antimicrobial Agents and Chemotherapy. 2000;44(2):267–271. doi: 10.1128/aac.44.2.267-271.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Wieczorek K., Szewczy K. R., Osek J., Prevalence J. antimicrobial resistance and molecular characterization of Campylobacter jejuni and Campylobacter coli isolated from retail raw meat in Poland. Veterinary Medicine. 2012;57(6):293–299. [Google Scholar]
  • 5.Okunlade A., Ogunleye A. O., Jeminlehin F. O., Ajuwape A. T. Occurrence of Campylobacter species in beef cattle and local chickens and their antibiotic profiling in Ibadan, Oyo State, Nigeria. African Journal of Microbiology Research. 2015;9(22):1473–1479. doi: 10.5897/ajmr2014.7105. [DOI] [Google Scholar]
  • 6.Abamecha A., Assebe G., Tafa B., Wondafrash B. Prevalence of Thermophilic Campylobacter and their Antimicrobial Resistance Profile in Food Animals in Lare District, Nuer Zone, Gambella, Ethiopia. Journal of Drug Research and Development. 2015;1(2) doi: 10.16966/2470-1009.108. [DOI] [Google Scholar]
  • 7.Luangtongkum T., Jeon B., Han J., Plummer P., Logue C. M., Zhang Q. Antibiotic resistance in Campylobacter: emergence, transmission and persistence. Future Microbiology. 2009;4(2):189–200. doi: 10.2217/17460913.4.2.189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Newman M. J., Frimpong E., Donkor E. S., Opintan J. A., Asamoah-Adu A. Resistance to antimicrobial drugs in Ghana. Infection and Drug Resistance. 2011;4(1):215–220. doi: 10.2147/IDR.S21769. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Klena J. D., Parker C. T., Knibb K., et al. Differentiation of Campylobacter coli, Campylobacter jejuni, Campylobacter lari, and Campylobacter upsaliensis by a multiplex PCR developed from the nucleotide sequence of the lipid A gene lpxA. Journal of Clinical Microbiology. 2004;42(12):5549–5557. doi: 10.1128/jcm.42.12.5549-5557.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Murphy C., Carroll C., Jordan K. N. Environmental survival mechanisms of the foodborne pathogen Campylobacter jejuni. Journal of Applied Microbiology. 2006;100(4):623–632. doi: 10.1111/j.1365-2672.2006.02903.x. [DOI] [PubMed] [Google Scholar]
  • 11.Salihu M. D., Junaidu A. U., Oboegbulem S. I., Egwu G. O. Prevalence and biotypes of Campylobacter species isolated from sheep in Sokoto State, Nigeria. International Journal of Animal and Veterinary Advances. 2009:6–9. [Google Scholar]
  • 12.Leblanc Maridor M., Denis M., Lalande F., et al. Experimental infection of specific pathogen-free pigs with Campylobacter: excretion in faeces and transmission to non-inoculated pigs. Veterinary Microbiology. 2008;131(3-4):309–317. doi: 10.1016/j.vetmic.2008.04.008. [DOI] [PubMed] [Google Scholar]
  • 13.Silva J., Leite D., Fernandes M., Mena C., Gibbs P. A., Teixeira P. Campylobacter spp. as a foodborne pathogen: a review. Frontiers in Microbiology. 2011;2, article 200 doi: 10.3389/fmicb.2011.00200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Viola C., DeVincent S. J. Overview of issues pertaining to the manufacture, distribution, and use of antimicrobials in animals and other information relevant to animal antimicrobial use data collection in the United States. Preventive Veterinary Medicine. 2006;73(2-3):111–131. doi: 10.1016/j.prevetmed.2005.09.020. [DOI] [PubMed] [Google Scholar]
  • 15.A Mpalang R. K., Boreux R., Melin P., Akir Ni Bitiang K., Daube G., De Mol P. Prevalence of Campylobacter among goats and retail goat meat in Congo. Journal of Infection in Developing Countries. 2014;8(2):168–175. doi: 10.3855/jidc.3199. [DOI] [PubMed] [Google Scholar]
  • 16.Sato K., Bartlett P. C., Kaneene J. B., Downes F. P. Comparison of prevalence and antimicrobial susceptibilities of Campylobacter spp. isolates from organic and conventional dairy herds in Wisconsin. Applied and Environmental Microbiology. 2004;70(3):1442–1447. doi: 10.1128/aem.70.3.1442-1447.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kassa T., Gebre-Selassie S., Asrat D. Prevalence of thermophilic Campylobacter spp, in food animals in Jimma zone, Southwest Ethiopia. Ethiopian Journal Health Development. 2005;42:83–90. [Google Scholar]
  • 18.Hakkinen M., Heiska H., Hänninen M.-L. Prevalence of Campylobacter spp. in cattle in Finland and antimicrobial susceptibilities of bovine Campylobacter jejuni strains. Applied and Environmental Microbiology. 2007;73(10):3232–3238. doi: 10.1128/aem.02579-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hannon S. J., Taboada E. N., Russell M. L., et al. Genomics-based molecular epidemiology of Campylobacter jejuni isolates from feedlot cattle and from people in Alberta, Canada. Journal of Clinical Microbiology. 2009;47(2):410–420. doi: 10.1128/jcm.01432-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Noormohamed A., Fakhr M. K. A higher prevalence rate of Campylobacter in retail beef livers compared to other beef and pork meat cuts. International Journal of Environmental Research and Public Health. 2013;10(5):2058–2068. doi: 10.3390/ijerph10052058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Wieczorek K., Osek J. Occurrence of Campylobacter on carcasses of slaughtered animals between 2009 and 2013. Bulletin of the Veterinary Institute in Pulawy. 2014;58(4):553–558. doi: 10.2478/bvip-2014-0085. [DOI] [Google Scholar]
  • 22.Abrahams C. A., Agbodaze D., Nakano T., Afari E. A., Longmatey H. E. K. Prevalence and antibiogram of Campylobacter jejuni in domestic animals in rural Ghana. Archives of Environmental Health. 1990;45(1):59–62. doi: 10.1080/00039896.1990.9935926. [DOI] [PubMed] [Google Scholar]
  • 23.Stone D. M., Chander Y., Bekele A. Z., et al. Genotypes, antibiotic resistance, and ST-8 genetic clone in Campylobacter isolates from sheep and goats in grenada. Veterinary Medicine International. 2014;2014:8. doi: 10.1155/2014/212864.212864 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Woldemariam T., Asrat D., Zewde G. Prevalence of Thermophilic Campylobacter species in carcasses from sheep and goats in an abattoir in Debre Zeit area, Ethiopia. Ethiopian Journal of Health Development. 2010;23(3):229–233. doi: 10.4314/ejhd.v23i3.53245. [DOI] [Google Scholar]
  • 25.Lazou T., Houf K., Soultos N., Dovas C., Iossifidou E. Campylobacter in small ruminants at slaughter: prevalence, pulsotypes and antibiotic resistance. International Journal of Food Microbiology. 2014;173:54–61. doi: 10.1016/j.ijfoodmicro.2013.12.011. [DOI] [PubMed] [Google Scholar]
  • 26.Haruna M., Sasaki Y., Murakami M., et al. Prevalence and antimicrobial susceptibility of Campylobacter in broiler flocks in Japan. Zoonoses and Public Health. 2012;59(4):241–245. doi: 10.1111/j.1863-2378.2011.01441.x. [DOI] [PubMed] [Google Scholar]
  • 27.Zaidi M. B., McDermott P. F., Campos F. D., et al. Antimicrobial-resistant Campylobacter in the food chain in Mexico. Foodborne Pathogens and Disease. 2012;9(9):841–847. doi: 10.1089/fpd.2012.1127. [DOI] [PubMed] [Google Scholar]
  • 28.Nesbakken T., Eckner K., Høidal H. K., Røtterud O.-J. Occurrence of Yersinia enterocolitica and Campylobacter spp. in slaughter pigs and consequences for meat inspection, slaughtering, and dressing procedures. International Journal of Food Microbiology. 2003;80(3):231–240. doi: 10.1016/s0168-1605(02)00165-4. [DOI] [PubMed] [Google Scholar]
  • 29.Komba E. V. G., Mdegela R. H., Msoffe P. L. M., Ingmer H. Human and animal campylobacteriosis in Tanzania: a review. Tanzania Journal of Health Research. 2013;15(1) doi: 10.4314/thrb.v15i1.6. [DOI] [PubMed] [Google Scholar]
  • 30.Uaboi-Egbenni P. O., Bessong P. O., Samie A., Obi C. L. Prevalence and antimicrobial susceptibility profiles of Campylobacter jejuni and coli isolated from diarrheic and non-diarrheic goat faeces in Venda region, South Africa. African Journal of Biotechnology. 2011;10(64):14116–14124. doi: 10.5897/ajb10.1662. [DOI] [Google Scholar]
  • 31.LaGier M. J., Joseph L. A., Passaretti T. V., Musser K. A., Cirino N. M. A real-time multiplexed PCR assay for rapid detection and differentiation of Campylobacter jejuni and Campylobacter coli. Molecular and Cellular Probes. 2004;18(4):275–282. doi: 10.1016/j.mcp.2004.04.002. [DOI] [PubMed] [Google Scholar]
  • 32.Payot S., Avrain L., Magras C., Praud K., Cloeckaert A., Chaslus-Dancla E. Relative contribution of target gene mutation and efflux to fluoroquinolone and erythromycin resistance, in French poultry and pig isolates of Campylobacter coli. International Journal of Antimicrobial Agents. 2004;23(5):468–472. doi: 10.1016/j.ijantimicag.2003.12.008. [DOI] [PubMed] [Google Scholar]
  • 33.Ghimire L., Singh D. K., Basnet H. B., Bhattarai R. K., Dhakal S., Sharma B. Prevalence, antibiogram and risk factors of thermophilic Campylobacter spp. in dressed porcine carcass of Chitwan, Nepal. BMC Microbiology. 2014;14(1, article 85) doi: 10.1186/1471-2180-14-85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Matthew-Belmar V., Amadi V. A., Stone D., et al. Antimicrobial resistance profiles of Campylobacter jejuni and Campylobacter coli recovered from feces of young healthy domestic pigs in grenada. International Journal Current Microbiology Applied Science. 2015;4(10):197–206. [Google Scholar]
  • 35.Kramer J. M., Frost J. A., Bolton F. J., Wareing D. R. A. Campylobacter contamination of raw meat and poultry at retail sale: Identification of multiple types and comparison with isolates from human infection. Journal of Food Protection. 2000;63(12):1654–1659. doi: 10.4315/0362-028x-63.12.1654. [DOI] [PubMed] [Google Scholar]
  • 36.Gwimi P. B., Faleke O. O., Salihu M. D., et al. Prevalence of Campylobacter species in fecal samples of pigs and humans from Zuru Kebbi State, Nigeria. International Journal of One Health. 2015;1:1–5. doi: 10.14202/ijoh.2015.1-5. [DOI] [Google Scholar]
  • 37.Jensen A. N., Andersen M. T., Dalsgaard A., Baggesen D. L., Nielsen E. M. Development of real-time PCR and hybridization methods for detection and identification of thermophilic Campylobacter spp. in pig faecal samples. Journal of Applied Microbiology. 2005;99(2):292–300. doi: 10.1111/j.1365-2672.2005.02616.x. [DOI] [PubMed] [Google Scholar]
  • 38.Sharma R., Tiwari K., Belmar V., et al. Prevalence and antimicrobial resistance of Campylobacter species isolated from backyard chickens in Grenada, West Indies. British Microbiology Research Journal. 2016;11(4):1–8. doi: 10.9734/bmrj/2016/21741. [DOI] [Google Scholar]
  • 39.Girgis S. A., Rashad S. S., Othman H. B., Bassim H. H., Kassem N. N., El-Sayed F. M. Antimicrobial susceptibility pattern in Egyptian patients. International Journal Current Microbiology Applied Science. 2014;3:861–875. [Google Scholar]
  • 40.Baserisalehi M., Al-Mahdi A. Y., Kapadnis B. P. Antimicrobial susceptibility of thermophilic Campylobacter spp. isolated from environmental samples. Indian Journal of Medical Microbiology. 2005;23(1):48–51. doi: 10.4103/0255-0857.13874. [DOI] [PubMed] [Google Scholar]
  • 41.Padungtod P., Kaneene J. B., Hanson R., Morita Y., Boonmar S. Antimicrobial resistance in Campylobacter isolated from food animals and humans in northern Thailand. FEMS Immunology and Medical Microbiology. 2006;47(2):217–225. doi: 10.1111/j.1574-695x.2006.00085.x. [DOI] [PubMed] [Google Scholar]
  • 42.Donkor E. S., Newman M. J., Yeboah-Manu D. Epidemiological aspects of non-human antibiotic usage and resistance: implications for the control of antibiotic resistance in Ghana. Tropical Medicine & International Health. 2012;17(4):462–468. doi: 10.1111/j.1365-3156.2012.02955.x. [DOI] [PubMed] [Google Scholar]
  • 43.Osei Sekyere J. Antibiotic types and handling practices in disease management among pig farms in Ashanti Region, Ghana. Journal of Veterinary Medicine. 2014;2014:8. doi: 10.1155/2014/531952.531952 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Addah W., Baah J., Tia S., Okine E. Knowledge and practices of smallholder farmers and herdsmen in the use of acaricides and gastrointestinal anthelminthes in Ghana. Livestock Research for Rural Development. 2009;21(11) [Google Scholar]

Articles from BioMed Research International are provided here courtesy of Wiley

RESOURCES