Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2017 Jan 31;91(4):e02084-16. doi: 10.1128/JVI.02084-16

Promising Role of Toll-Like Receptor 8 Agonist in Concert with Prostratin for Activation of Silent HIV

M A Rochat 1,, E Schlaepfer 1, R F Speck 1
Editor: Frank Kirchhoff2
PMCID: PMC5286885  PMID: 27928016

Abstract

ABSTRACT

The persistence of latently HIV-infected cells in patients under combined antiretroviral treatment (cART) remains the major hurdle for HIV eradication. Thus far, individual compounds have not been sufficiently potent to reactivate latent virus and guarantee its elimination in vivo. Thus, we hypothesized that transcriptional enhancers, in concert with compounds triggering the innate immune system, are more efficient in reversing latency by creating a Th1 supportive milieu that acts against latently HIV-infected cells at various levels. To test our hypothesis, we screened six compounds on a coculture of latently infected cells (J-lat) and monocyte-derived dendritic cells (MDDCs). The protein kinase C (PKC) agonist prostratin, with a Toll-like receptor 8 (TLR8) agonist, resulted in greater reversion of HIV latency than any single compound. This combinatorial approach led to a drastic phenotypic and functional maturation of the MDDCs. Tumor necrosis factor (TNF) and cell-cell interactions were crucial for the greater reversion observed. Similarly, we found a greater potency of the combination of prostratin and TLR8 agonist in reversing HIV latency when applying it to primary cells of HIV-infected patients. Thus, we demonstrate here the synergistic interplay between TLR8-matured MDDCs and compounds acting directly on latently HIV-infected cells, targeting different mechanisms of latency, by triggering various signaling pathways. Moreover, TLR8 triggering may reverse exhaustion of HIV-specific cytotoxic T lymphocytes that might be essential for killing or constraining the latently infected cells.

IMPORTANCE

Curing HIV is the Holy Grail. The so-called “shock and kill” strategy relies on drug-mediated reversion of HIV latency and the subsequent death of those cells under combined antiretroviral treatment. So far, no compound achieves efficient reversal of latency or eliminates this latent reservoir. The compounds may not target all of the latency mechanisms in all latently infected cells. Moreover, HIV-associated exhaustion of the immune system hinders the efficient elimination of the reactivated cells. In this study, we demonstrated synergistic latency reversion by combining agonists for protein kinase C and Toll-like receptor 8 in a coculture of latently infected cells with myeloid dendritic cells. The drug prostratin stimulates directly the transcriptional machinery of latently infected cells, and the TLR8 agonist acts indirectly by maturing dendritic cells. These findings highlight the importance of the immune system and its activation, in combination with direct-acting compounds, to reverse latency.

KEYWORDS: HIV-1, latency-reversing agents, J-lat cells, monocyte-derived dendritic cells, HIV cure, aviremic patients

INTRODUCTION

The HIV-1 pandemic remains a major global health threat. While combined antiretroviral treatment (cART) effectively suppresses HIV replication, the virus rebounds when treatment is interrupted (15), pointing to a reservoir of latently infected cells. Indeed, a replication-competent but silent reservoir in long-lived latently HIV-infected cells is established early after HIV transmission and is not targeted by cART (68).

The latently infected cells are primarily resting memory CD4+ T cells. Latency is maintained by restricting access of the transcriptional machinery to the proviral DNA (913), and epigenetic regulation further constrains the positive Tat feedback loop (14). Moreover, key transcription factors, such as NF-κB (1517) and nuclear factor of activated T cells (NFAT), as well as the transcription elongation factor PTEFb (1822), are tightly sequestered in the resting state.

Latency may be reversed by releasing transcriptional or epigenetic blocks, decreasing the cell activation threshold (PD-1, LAG-3), or enhancing the transcriptional noise (23). The “shock and kill” strategy takes advantage of these (2426). Reactivation of HIV production induces direct or indirect cell death that is mediated by HIV-specific cytotoxic T lymphocytes (CTLs), natural killer (NK) cells (27), or antibody-dependent cellular cytotoxicity (ADCC) under cART (28, 29). This strategy should result in a sterilizing cure. However, clinical trials (e.g., using interleukin-2 [IL-2] [3033] alone or in concert with gamma interferon [IFN-γ] [34], IL-7 [3537], or the CD3 antibody OKT-3) have been disappointing: all patients relapsed upon cART interruption. Moreover, in the case of OKT-3 (38), CD4+ T-cell levels dropped dramatically or even an expansion of the proviral reservoir was observed for IL-7 (36).

Recent oncological clinical trials (3941) have encouraged the in vivo use of protein kinase C agonists (PKCag) in humans. PKCag (i.e., prostratin, a nontumorigenic phorbol ester [4246], bryostatin [47, 48], and ingenol [49, 50]) are potent HIV transcription inducers that release NF-κB, AP1, and PTEFb (51, 52). However, their applications have been limited by their toxicity and difficulty of synthesis. Nonetheless, their promising profile, combined with the generation of potent analogs, might support their clinical development as latency-reversing agents (LRAs) in vivo (53).

Based on the importance of epigenetics for HIV transcription, inhibitors of histone deacetylase (HDACi) are believed to be promising LRAs (5457). One of these, vorinostat, was safe and efficacious in promoting transcription of cell-associated HIV RNA in CD4+ T cells, but no decrease in the number of infected cells was achieved. Another pan-HDACi, panobinostat, induced HIV transcription more efficiently than vorinostat. Intriguingly, the transient decline of total HIV DNA correlated with stimulation of the innate immune system—mainly by activation of NK and plasmacytoid dendritic cells (pDCs) (56). Thus, support from the immune system seems to be needed to clear the latently infected cells, as reversion from HIV latency alone is insufficient to induce cell death (58), most likely because of low viral production (59). Moreover, impaired HIV-specific CTL responses (60, 61) and CTL escape HIV variants (62) in concert with the immaturity of DCs (6365) emphasize the need of reinforcing the immune system, in particular, the HIV-specific CTLs, to deplete the infected cells.

Various promising strategies that target the innate immune system will eliminate cells switching from latent to productive HIV infection. Among the most promising are Toll-like receptors (TLRs), such as TLR9 (66), TLR8 (67), and TLR1/2 (68). TLR7 on DCs (R. Geleziunas, presented at the Keystone Symposium on Molecular and Cellular Biology. Boston, MA, 26 April to 1 May 2016), in particular, has emerged as an approach to induce HIV transcription and direct a cytotoxic immune response. Indeed, TLR triggering modulated DC activity and T helper and macrophage polarization (6971) and displayed various effects on HIV replication (72, 73). Notably, TLR7, -8, and -9 are expressed on DCs, and their stimulation resulted in DC-dependent changes of the microenvironment. TLR signaling could also act on the apoptosis sensitivity of immune and cancer cells (74). Altogether, TLR triggering is a promising multifactorial adjuvant to eliminate the latent reservoir. It induces HIV expression and antiviral cytokine production, which interferes with spreading infection as well as T-cell and NK cell maturation, which might deplete HIV-infected cells.

Here we proposed that concomitant use of transcriptional enhancers and immune response inducers is a potent strategy for reactivating HIV replication. Acting on different transcriptional repression mechanisms is most likely key factor for efficient reversion of HIV latency (75, 76). We tested the hypothesis that prostratin (acting directly on latently infected T cells), in concert with TLR8ag (acting via DCs), disrupts HIV latency (67) and might trigger the priming and restoration of antigen-specific immunity, through costimulatory molecules and IL-12p70 expression (71, 77, 78). Adding TLR8ag might lead to a Th1 supportive milieu crucial to clear the persistent quiescent reservoir in vivo. To explore this possible interplay, J-lat cells were cocultured with monocyte-derived dendritic cells (MDDCs), representing the inflammatory DC compartment (7981), and subsequently challenged with diverse compounds. The reactivation potency was evaluated using long terminal repeat (LTR)-driven enhanced green fluorescent protein (eGFP) expression and the overall outcome by characterizing both players. In a second step, we verified this approach on primary cells from aviremic patients.

RESULTS

Differential potency of LRAs on J-lat clones alone or cocultured with MDDCs.

We first screened various J-lat clones (82) for their signal-to-noise ratios by looking at their LTR-driven eGFP expression when stimulated with prostratin, 5-aza-2′-deoxycytidine (Aza-CdR), or tumor necrosis factor (TNF) ± Aza-CdR (Fig. 1A). Several clones (i.e., clones 6.3, 8.4, 9.2, and 15.4) had good signal-to-noise ratios, and we eventually used clone 9.2 for all experiments.

FIG 1.

FIG 1

Latency-reversing agents demonstrated differential potency on J-lat cell clones or in coculture of J-lat clone 9.2 cells with MDDCs at a 10:1 ratio. (A) A total of 105 J-lat clone cells were stimulated for 24 h with prostratin or TNF with or without Aza-CdR in R-10 medium. The viability of treated J-lat clone cells (upper panel) was determined by the forward scatter/side scatter (FSC/SSC) characteristics. Reversion of latency (lower panel) was assessed by eGFP quantification, using flow cytometry (n = 3; mean ± standard deviation [SD]). (B) J-lat clone 9.2 cells (upper panel) were treated for 24 h and analyzed for their viability and eGFP expression. TNF treatment represented the positive control (n = 4; mean ± standard error of the mean [SEM]). Cocultures of J-lat clone 9.2 cells with MDDCs at a ratio of 10:1 (lower panel) were similarly analyzed. CD40L was designated as the positive control for the coculture setup (n = 6; mean ± SEM; **, P = 0.0072; two-tailed paired t test). The left y axis depicts viability, and the right y axis depicts latency reversion. TNF, 10 ng/ml; CD40L, 50 ng/ml, prostratin, 0.5 μM; TSA, 0.1 μM; SAHA, 10 μM; Aza-CdR, 0.5 μM; TLR2ag, 100 ng/ml; TLR4ag, 20 ng/ml; TLR8ag, 1 μM.

We believe that the immune system and in particular myeloid dendritic cells (mDCs) are key players in HIV cure. They generate a microenvironment potentiating the effects of LRAs and enabling an HIV-specific CTL response. Thus, we designed a coculture of latently infected T cells, represented by J-lat clone 9.2 cells and MDDCs at a ratio of 10:1. Without any exogenous stimuli, this setup did not alter the reactivation latency background of J-lat 9.2 cells but tended to increase inducible costimulator (ICOS) and CTL-associated antigen 4 (CTLA-4) expression, pointing to a potential activation of J-lat cells by the MDDCs (83, 84; data not shown).

Then, we challenged several known LRAs, including PKCag, HDACi, and DNA methyltransferase inhibitor, and various TLR agonists (TLRag) for their ability to reverse latency in J-lat cells alone (Fig. 1B, upper panel) or cocultured with MDDCs (Fig. 1B, lower panel). In J-lat monoculture, HIV was effectively induced by suberoylanilide hydroxyamic acid (SAHA [vorinostat]) and TNF, as previously reported (85). Prostratin, trichostatin A (TSA), and Aza-CdR, as well as TLR2, -4, and -8ag had modest or no effect. The lack of reversion in J-lat cells by TLRs is consistent with their low or absent levels of TLR2, -4, and -8 mRNA expression, which was not altered upon stimulation (data not shown). Strikingly, prostratin in coculture led to greater HIV reactivation than any other compound (Fig. 1B). These data underline the importance of studying potential LRAs and their combinations in a more complex system than pure T-cell cultures. Moreover, the data prompted us to focus primarily on prostratin as an adjunct to immune inducers that act via other immune cells, such as mDCs. Triggering TLR4 and -8 in coculture also induced HIV transcription to a similar level to SAHA.

Prostratin achieved superior HIV latency reversion in coculture, further enhanced by TLR8 agonist.

Prostratin showed a dose-dependent reversion of latency in J-lat 9.2 cells with moderate effects at 1 μM and minimal ones at 0.1 μM (Fig. 2A). Notably, the extent of reversion correlated with cell death rate (Fig. 2B), which is most likely mediated by viral cytopathicity and not due to drug-induced toxicity. The latter explanation is supported by the higher viability of the parental Jurkat cells when exposed to similar concentration of prostratin: i.e., 71% compared to 49% in J-lat 9.2 cells (Fig. 2C).

FIG 2.

FIG 2

Prostratin achieved superior HIV latency reversion in the coculture system and was enhanced by TLR8 agonist. (A) J-lat clone 9.2 cells were stimulated for 24 h with different concentrations of prostratin. The percentage of reactivated cells was quantified by LTR-driven eGFP expression using flow cytometry and is depicted on the right y axis. Viability is illustrated on the left y axis (n = 3). (B) Correlation of eGFP expression with J-lat cell viability (two-tailed Pierson correlation; n = 3; mean ± SEM). (C) Dose-dependent toxicity of prostratin on parental Jurkat T cells (two-tailed paired t test; *, P = 0.033 and 0.0119 for 0.1 and 0.5 μM, respectively, compared to mock; **, P = 0.0053; n = 4; mean ± SEM). (D) Coculture of J-lat clone 9.2 cells and MDDCs at a ratio of 10:1, stimulated with increasing prostratin concentrations with or without TLR8ag at 1 μM. Addition of TLR8ag significantly increased the reactivation potency of prostratin (two-tailed paired t test; **, P = 0.0054; ***, P = 0.0004; ****, P ≤ 0.0001; n = 6; mean ± SEM). (E) Representative viability of J-lat cells from panel D. (F) Representative mean fluorescence intensity (MFI) of the eGFP expression by J-lat cells in the setup shown in panel D (**, P = 0.0098; ***, P = 0.0007; ****, P ≤ 0.0001; n = 6; mean ± SEM). eGFP, a surrogate marker for viral protein production, was monitored using flow cytometry and viability based on the FSC/SSC characteristics.

Adding the immune inducer TLR8ag to prostratin in the coculture system resulted in much greater reversion of latency than with PKCag alone (Fig. 2D). This effect was also seen with other TLR agonists, such as TLR2 and TLR4 agonists (data not shown). Indeed, adding TLR8ag sensitized J-lat cells to lower concentrations of prostratin without any additional toxicity (Fig. 2E). Furthermore, this combination resulted in higher eGFP mean fluorescence intensity (MFI), which suggests stronger HIV transcription and thus viral particle production (Fig. 2F). Additionally, we observed a plateau of efficacy at 0.5 μM prostratin, supporting this concentration for subsequent use.

Effects of prostratin and/or TLR8ag on other latently HIV-infected cell lines.

We wanted to corroborate the data obtained in other T-cell lines. We screened the latently infected T-cell lines 8E5, ACH2, and J1.1. 8E5 cells continuously produced HIV particles as measured by staining for intracellular p24 (data not shown). ACH2 cells showed close to 100% reversion of latency in response to prostratin and TNF at the doses used for the J-lat 9.2 cells (data not shown). Thus, we did not pursue any additional experiments with these two cell lines.

The J1.1 cell monoculture reached a reversion of latency of 61.5% ± 1.99% with TNF and 30.95% ± 0.49% with prostratin (Fig. 3). In the coculture setup, the J1.1. cells were more responsive to prostratin with 42.37% ± 6.28% cells positive for intracellular p24 antigen (Ag) than in the monoculture. However, prostratin in concert with TLR8ag resulted in a similar frequency of reverted cells to TNF alone. Adding the TNF blocker infliximab to the coculture treated with prostratin/TLR8ag recapitulated the findings found in J-lat cells; the remaining latency reversion was greater, although not significantly, than the one observed in cocultures treated with prostratin and infliximab, pointing to the causal role of other soluble factors or cell-cell contact herein. The effects observed with J1.1 were less prominent than those with J-lat 9.2 cells, at the doses established in the latter cell line.

FIG 3.

FIG 3

Effects of prostratin and/or TLR8ag on J1.1 cell lines alone or cocultured with MDDCs at a 10:1 ratio. A total of 105 J1.1 cells (blue bars; n = 3) alone or in coculture with 104 MDDCs (red bars; n = 9) were stimulated for 24 h with prostratin at 0.5 μM, TNF at 10 ng/ml, and TLR8ag at 1 μM with or without 1 μg/ml of infliximab in R-10 medium. Reversion of latency was assessed by intracellular p24 staining and quantified by flow cytometry (two-tailed paired t test; *, P = 0.0359; ****, P ≤ 0.0001; mean ± SEM).

TNF and cell-cell interaction are involved in the enhanced reactivation in coculture.

Using Transwells and infliximab, we explored the mechanisms that led to the increased reversion of latency (Fig. 4A). Indeed, separating the two cell types, as well as inhibiting TNF signaling drastically reduced the synergy of prostratin and TLR8ag up to 70%. A combination of Transwells and infliximab abrogated this positive interplay up to 95%. The remaining latency-reversing activity corresponded to the modest effect of prostratin on J-lat cells. These findings underline the major role of soluble factors and cell-cell contact for the reversion of latency in our model.

FIG 4.

FIG 4

TNF and cell-cell interaction are involved in the enhanced reactivation observed in coculture. (A) Reactivation potency of prostratin and TLR8ag in coculture, using a 0.4-μm-pore Transwell, 1 μg/ml infliximab (TNF inhibitor), and their combination after 24 h of culture (n = 6; mean ± SEM). The percentage of eGFP expressed was normalized on the reactivation of coculture treated with 0.5 μM prostratin and 1 μM TLR8ag per experiment (two-tailed paired t test on the normalized value; **, P = 0.0093 for Transwell; **, P = 0.002 for infliximab; ***, P = 0.0003). (B) Potency of 1 μg/ml of infliximab to inhibit TNF-mediated latency reversion, assessed on J-lat clone 9.2 cells with increasing concentrations (nanograms per milliliter) of TNF (n = 5; mean ± SEM). (C) (Upper panel) Effect of 1-h TLR8ag pretreatment of MDDCs, followed by washing and coculture with J-lat clone 9.2 cells in the presence of prostratin. (Middle panel) Effect of 1-h prostratin prestimulation of MDDCs, followed by washing and coculture with J-lat clone 9.2 cells, in the presence of TLR8ag. (Lower panel) Two-hour TLR8ag pretreatment of MDDCs, washed and cultured for 24 h in R-10 medium, followed by transfer of the supernatant onto J-lat cells and further culture for 24 h. The percentage of eGFP expressed was normalized on the reactivation of coculture treated with 0.5 μM prostratin and 1 μM TLR8ag (n = 6; mean ± SEM). SN, supernatant (two-tailed paired t test on the normalized value; *, P = 0.0342; **, P = 0.0021; ****, P < 0.0001). Results were normalized per experiment. (D) Comparison of the latency reversion upon treatment between J-lat cells alone (n = 10), cells supplemented with the SN from 1-h or 2-h TLR8ag-stimulated MDDCs (n = 14), and in coculture with MDDCs (n = 14). The green dashed line represented the latency reversion induced by the combination of prostratin and TNF on J-lat cells. TNF was used at 10 ng/ml. The upper purple dashed line highlights the enhanced latency reversion when coculture was treated with prostratin and TLR8ag. Addition of infliximab did not abolish this latency reversion, as depicted by the lower purple dashed line.

We verified that the dose of infliximab added to the coculture was sufficient to neutralize all TNF produced by MDDCs. We added increasing amounts of TNF to the J-lat cells while keeping the dose of infliximab constant. A 1-μg/ml dose of infliximab inhibited the reversion of latency in J-Lat cells treated with 100 ng/ml of TNF (Fig. 4B), which is 5-fold more than the maximum of TNF released by TLR8ag-stimulated MDDCs over 24 h (5 to 20 ng/ml [data not shown]). This experiment substantiates the conclusion that TLR8ag-stimulated MDDCs also act by other means, such as cell-cell contact, than TNF on J-lat cells for reverting latency.

Brief exposure of MDDCs to solely TLR8ag was sufficient to mediate potent eGFP expression in J-lat cells consistent with their rapid and efficient maturation (Fig. 4C). The signal was slightly lower than the control and implied a direct role of prostratin in the activation/maturation of MDDCs. Conversely, culture of MDDCs for 1 h with prostratin, followed by washing and adding J-lat cells with TLR8ag, resulted in a reduced response, pointing to the absolute need for prostratin for J-lat reactivation (Fig. 4C). Finally, we explored whether supernatants from MDDCs would have any effect on latency reversion in J-lat cells. The cells were pretreated for 2 h to achieve maximal stimulation, washed, and further cultured without stimuli for 24 h. When the supernatant was transferred onto J-lat cells, we only observed background eGFP expression, explained by the unstable nature of the factors secreted by the MDDCs (Fig. 4C). Furthermore, prostratin and TNF stimulation of J-lat cells or supernatant transfer of TLR8ag-treated MDDCs supplemented with prostratin led to a lower reversion of latency than prostratin and TLR8ag added directly to cocultures (Fig. 4D).

Altogether, these findings demonstrate the role of prostratin, TNF, and cell-cell interaction in the enhanced latency reversion in coculture.

Thus, multiple pathways must be stimulated for a sustained induction of NF-κB and de novo synthesis of Tat, which is required for robust expression of elongated HIV transcripts (86). Prostratin appears to be essential to initiate HIV transcription on J-lat cells, which is further enhanced by the concomitant stimulation by TLR8-matured MDDCs via TNF and costimulatory molecules.

Prostratin and TLR8ag modulated the phenotypic and functional characteristics of MDDCs, but CD80 and -86 and ICOSL had no role in the enhanced reversion of latency in cocultures exposed to TLR8ag and prostratin.

We considered the phenotypic and functional changes of MDDCs essential for understanding the superior latency reversion in response to TLR8ag and prostratin and, especially, for further development of this approach. Prostratin led to an adherent, constellation-like phenotype of MDDCs (data not shown) and induced minor CD80 and CD83 expression at 24 h. In contrast, the percentage and MFI of CD86 were substantially increased within 12 h and remained elevated over the entire observation period of 36 h (Fig. 5A, upper panel [data not shown]). Furthermore, prostratin promoted TNF production as reported previously (45) and a transient MIP1α secretion at 12 h but without any induction of IL-12p70 (Fig. 5B). We also observed increased HLA-DR expression concomitant with DC-SIGN downregulation (Fig. 5C). Therefore, prostratin might restrain spreading infection through DC-SIGN reduction and enhancing antigen presentation by upregulating HLA-DR. These findings highlighted the pleiotropic effects of prostratin in MDDCs that might contribute to a less permissive microenvironment for HIV dissemination.

FIG 5.

FIG 5

Prostratin and TLR8ag modulated the phenotypic and functional characteristics of MDDC, but CD80, -83, and -86 and ICOSL had no role in the enhanced reversion of latency in cocultures exposed to TLR8ag and prostratin. (A) (Upper panels) Kinetics of 105 MDDCs stimulated with prostratin (n = 11; median). (Lower panels) Kinetics of MDDCs treated with TLR8ag (n = 8; median). The percentage of CD80- and 86-expressing cells was monitored up to 36 h by flow cytometry and fluorescent antibodies. (B) Fold change of TNF, MIP1α, and IL-12p70 concentrations in the supernatants of MDDCs treated with TLR8ag or prostratin (n = 6; mean ± SEM). (C) Fold change of mean fluorescence intensity (MFI) of DC-SIGN and HLA-DR to mock-treated MDDCs (two-tailed paired t test; **, P = 0.0021 and 0.0045, respectively; n = 9; mean ± SEM). (D) Neutralizing antibodies (NAb) against CD80 and -86 at 5 μg/ml each and/or infliximab at 15 μg/ml were applied to cocultures stimulated with prostratin and TLR8ag for 24 h. Viability, depicted on the left y axis, and the reactivation, depicted on the right y axis, from J-lat clone 9.2 cells were normalized on the coculture treated with prostratin and TLR8ag (two-tailed paired t test; *, P = 0.0191; ***, P = 0.0001; n = 9; mean ± SEM). Note that 95% of J-lat cells expressed CD28 (data not shown). (E) Comparison of expression of CTLA-4 (n = 6) and ICOS (n = 8) in J-lat cells alone (left panel) or in treated cocultures (right panel) (two-tailed paired t test; *, P = 0.0131; ****, P < 0.0001; mean ± SEM). Prostratin and TLR8ag concentrations were identical to those in Fig. 4.

As expected, TLR8ag triggered rapid upregulation of maturation markers (Fig. 5A, lower panel) and sustained production of TNF (Fig. 5B). Importantly, with the increasing secretion of IL-12p70, TLR8 stimulation might license mDCs to rescue the adaptive immune response from HIV-associated exhaustion. In addition, prostratin and TLR8ag did not antagonize each other (Fig. 5C).

Thus, prostratin and TLR8ag induced a functional maturation of MDDCs, optimal for the reversion of latency. Furthermore, the recruitment of immune cells by MIP-1α, the reduced capture and transmission of HIV virions by mDCs, in combination with IL-12p70 secretion and enhanced major histocompatibility complex (MHC-II) antigen presentation, might promote a Th1 response that contributes to an HIV-restrictive environment.

Next, we tried to identify the receptor-ligand pair involved in the cell-mediated enhanced reversion of latency. We focused primarily on the CD80/86-CD28 axis since these costimulatory molecules were substantially increased on MDDCs treated with prostratin and TLR8ag (Fig. 5A). Strikingly, suppressing the CD80/86 axis with neutralizing antibodies (NAbs) further increased reversion of latency in this setting (Fig. 5D). We explain this result by a preferential interaction of CD80/86 with the inhibitory receptor CTLA-4 (Fig. 5E). Therefore, its blocking potentially removed some inhibitory pressure on the signaling pathways triggered by prostratin and TLR8ag.

The CD28 family member ICOS was also significantly upregulated in prostratin-treated coculture (Fig. 5E), irrespective of TLR8ag. However, blocking inducible costimulator ligand (ICOSL) with up to 10 μg/ml of NAb did not reduce eGFP expression, excluding ICOSL as a relevant costimulatory molecule for latency reversion (data not shown).

Prostratin triggered moderate apoptosis in J-lat cells and had no deleterious effect on MDDCs.

LRAs may induce cell death in the target cells by reversion of latency but also in uninfected cells. Prostratin alone induced moderate apoptosis in J-lat cells, as quantified by active caspase-3 (Fig. 6A). Prostratin or TLR8ag displayed no toxicity on MDDCs (Fig. 6B). Similarly, the combined treatment of prostratin and TLR8ag on coculture did not show any additive or synergistic detrimental effects on J-lat cells (Fig. 6C). Importantly, apoptosis induction was positively correlated with eGFP expression in J-lat cells (Fig. 6D) but was lost in the coculture setup (Fig. 6E). Consistent with its antitumor activity, SAHA triggered a high level of apoptosis in J-lat cells and in MDDCs, as well as in cocultures (Fig. 6A, B, and C). SAHA's apoptosis rate was even higher than its effect on reversion of latency, especially in coculture (Fig. 6D and E), highlighting its potential cellular toxicity.

FIG 6.

FIG 6

Prostratin triggered moderate apoptosis in J-lat cells and shows no deleterious effect on MDDCs. The percentage of cells harboring an active caspase-3 upon treatment is depicted. (A) J-lat cells (n = 5). (B) MDDCs (n = 3). (C) J-lat cells in coculture (n = 6). (D) Correlation of activated caspase-3-positive J-lat cells (left y axis) and corresponding eGFP expression (right y axis) upon treatment (two-tailed Pierson correlation; n = 4). (E) Percentage of active caspase-3 in J-lat cells (left y axis) and corresponding eGFP expression (right y axis) in coculture (n = 9). Prostratin and TLR8ag concentrations were identical to those in Fig. 3. SAHA was used at 1 μM and TNF at 10 ng/ml (mean ± SEM).

Prostratin- and TLR8ag-stimulated cocultures increased moderately but significantly chromatin accessibility, enabling HIV transcription.

Since relaxation of the chromatin is crucial for transcription factor access and for initiation of efficient HIV transcription, we examined the global chromatin relaxation in response to our treatments by measuring histone H3 lysine 9 acetylation (H3K9-ac). Prostratin with and without TLR8ag showed no effect on chromatin relaxation in J-lat cells alone (Fig. 7). In contrast, cocultures stimulated with both compounds led to a significant chromatin relaxation compared to that in the mock-treated coculture. The effect on chromatin relaxation overall was not very prominent, but a given signaling pathway (e.g., TLR8) most likely alters sparse regions of the chromatin (87). Furthermore, the one-shot analysis done at 24 h will not mirror the dynamic changes over time (88). Therefore, the minor changes observed on the overall chromatin remodeling may well be sufficient for enhanced HIV transcription in the context of combined treatment with prostratin and TLR8ag. In contrast, SAHA drastically modified the acetylation status of H3K9 (up to 70%), which was not correlated with the reversion of HIV latency.

FIG 7.

FIG 7

Prostratin- and TLR8ag-stimulated cocultures increased moderately but significantly chromatin accessibility, enabling HIV transcription, shown as a percentage of viable J-lat cells (blue line), eGFP expression (green line), and acetylated lysine 9 of histone H3 (H3K9-ac [red line]) of treated J-lat cells alone (left panel; n = 3) or in coculture (right panel; n = 9) (two-tailed paired t test; **, 0.0025; mean ± SEM). The concentrations of stimuli were identical to those in Fig. 6.

SYK, MEK, and PKCβ mediated the enhanced reversion of latency by prostratin and TLR8ag in coculture.

To assess the signaling pathways involved, we used a library of inhibitors (kindly provided by B. Schaefer). In prostratin/TLR8ag-treated coculture, inhibition of SYK, MEK (1, 2), and PKCβ resulted in the most striking loss of latency reversion (Fig. 8A). This finding is consistent with the central role of SYK in the immune receptor pathway in hematopoietic cells. Furthermore, activation of the PKC pathway via prostratin was demonstrated by the reduced eGFP expression upon PKCβ inhibition. As SYK and PKC signal through MEK/extracellular signal-regulated kinase (ERK)/NF-κB, blocking MEK interferes with both pathways.

FIG 8.

FIG 8

SYK, MEK, and PKCβ mostly mediated the enhanced reversion of latency by prostratin and TLR8ag in cocultures. Reduction of eGFP was observed when J-lat cells alone (blue) or in coculture (red) were pretreated for 1 h with 500 nM signaling pathway inhibitors. The dashed lines represented the maximal reactivation obtained upon stimulation without the inhibitors. (A) Percentage of viability (left y axis) and eGFP expression (right y axis) of J-lat in coculture, pretreated with kinase inhibitors and subsequently stimulated with prostratin and TLR8ag for 24 h (two-tailed paired t test; ****, P < 0.0001; ***, P = 0.0002 for MEK and P = 0.0003 for PKCβ; **, P = 0.0044; *, P = 0.0294; n = 6; mean ± SEM). (B) Detailed inhibition of latency reversion, upon prostratin treatment, for every inhibitor used. (C) Detailed inhibition of latency reversion, upon prostratin and TLR8ag stimulation, for every inhibitor used (SYK, MEK, PKCβ, TBK1, and GSK3 from coculture [red bars] already presented in panel A). The effects of the inhibitors on J-lat 9.2 monoculture are depicted with the black bars and on the coculture with the red bars (n = 3 for J-lat and n = 6 for the coculture; mean ± SEM).

In coculture treated with prostratin, SYK, PKCβ, and MEK were also involved (Fig. 8B, red bars), as well as pyruvate dehydrogenase kinas 1 (PDK1) ± TANK-binding kinase 1 (TBK1) and glycogen synthase kinase 3 (GSK3). The phosphatidylinositol 3-kinase (PI3-kinase) activation appeared not to have any effect on reversion of latency in this setup (Fig. 8B, blue bars). Notably, the serine/threonine kinase TBK1 and GSK3 induce TLR-dependent NF-κB nuclear translocation and TNF synthesis (89), pointing to the prominent contribution of NF-κB. Inhibition of PKCβ and PDK1 in coculture only modestly reduced reversion of latency upon prostratin and TLR8ag treatment, compared to prostratin alone (Fig. 8B and C). We speculated that there were extensive cross-signaling events, creating some redundancy and thus lessening the role of PKCβ and PDK1 in the overall response. We could not detect any involvement of AKT, a downstream substrate of PDK1, or Jun N-terminal kinase (JNK) and p38, involved in TLR and TNF signaling (Fig. 8B and C). This phenomenon might be explained by a SYK-dependent inhibition of JNK and p38 phosphorylation (90). Interestingly, inhibition of phospholipase C (PLC) led to enhanced HIV transcription, especially in prostratin-treated J-lat monoculture (Fig. 8B and C).

Latency reversion in cocultures with cells from aviremic HIV-infected individuals in response to either prostratin ± TLR8ag or CD3/CD28/CD2 stimulation.

Eventually, we examined our strategy using primary cells from HIV-infected individuals with suppressed HIV RNA (Table 1). We performed a coculture of autologous CD4+ T cells and MDDCs. By adding the reverse transcriptase (RT) inhibitors, we detected exclusively the virions emerging from the latent reservoir, and thereby we were able to estimate the potency of the various compounds.

TABLE 1.

Patient characteristics in this study

Patient no. Age (yr) Gender MSMa Initialb:
Finalc:
Duration of HIV infection (mo)d Time aviremic (mo)e
Plasma viral load (copies/ml) CD4 T-cell count (cells/μl) Plasma viral load (copies/ml) CD4 T-cell count (cells/μl)
4 31 Male No 32,000 265 <20 504 139 71
5 33 Female NAf 18,800 922 <20 1,140 133 60
6 64 Male Yes 125,500 117 <20 379 207 195
7 47 Male Yes 10,000,000 176 <20 584 44 34
8 47 Male Yes 15,900 137 <20 386 107 71
9 53 Male Yes 962,500 419 <20 1,112 240 122
a

MSM, men who have sex with men.

b

Plasma viral load and CD4+ T-cell count prior to cART initiation.

c

Plasma viral load and CD4+ T cell count during the blood sampling.

d

Calculated as the time between the infection and the date of blood sampling.

e

Calculated as the time between the first time point with undetectable viral load and the date of blood sampling.

f

NA, not applicable.

The limited number of specimens assessed and the rather large donor- and time-dependent variability of the assay results prompted us to compare the average of mock-treated samples (P = 0.23 between the donors, by analysis of variance [ANOVA]) with all treated samples irrespective of the compound and time point. We observed a significant increase in viral RNA production upon simulation compared to the mock condition (P = 0.0052) (Fig. 9A). In most cases, the increase was most prominent at day 5 after stimulation. Notably, we observed donor-dependent sensitivity to distinct LRAs, which is a well-known phenomenon (91) (Fig. 9B). Even the specimens treated with anti-CD3/CD28/CD2 (positive control) did not result in uniform latency reversion (i.e., donors 4 and 8). We also observed distinct magnitudes in latency reversion with the various LRAs: e.g., in donors 6 and 9, prostratin plus TLR8ag was more potent than either of the compounds alone. On the contrary, in donors 4 and 7, prostratin plus TLR8ag had no effect.

FIG 9.

FIG 9

Latency reversion in cocultures with cells from aviremic HIV-infected individuals in response to either prostratin ± TLR8ag or CD3/CD28/CD2 stimulation. Autologous cocultures of CD4+ T cells (105) and MDDCs (104) from aviremic patients, in quintuplicate, were stimulated with CD3/CD28/CD2 antibodies at 2.5 μl/ml, prostratin, or TLR8ag or combined as described previously, in R-10 medium supplemented with 5 μM AZT and 50 nM efavirenz. Every 2 days, 50 μl of SN per well was collected and pooled per donor and treatment for HIV viral RNA analysis. (A) Average peak values from the mock-treated controls and the peak values from the treated cocultures in copies per milliliter are shown (Mann-Whitney test; **, P = 0.0052). (B) Peak values of HIV RNA from the individual donors in response to the various LRAs. The dashed line represents the average mock values.

We explain this heterogeneous result by donor-specific responsiveness to LRAs, reservoir size, and underlying latency mechanisms.

DISCUSSION

Here, we investigated the efficacy of compounds directly targeting latently infected T cells in concert with innate immune system stimulation. We found superior reversion of latency in a coculture of T cells and MDDCs, in vitro and ex vivo, using cells from aviremic HIV-infected individuals, when exposed to the PKC agonist prostratin and a TLR8 agonist. Soluble factors, in particular TNF, and cell-cell contact contributed to the superior reversion of latency. Notably, the TLR8-mediated increased secretion of IL12p70 might be crucial for restoring antigen-specific CTL activity (92, 93). Therefore, such a combined approach might be very promising in latency reversion and conceivably in restoring adaptive immune responses needed to eliminate latently infected T cells.

The study of latently infected cells is challenging. Their frequency is quite low, they contain a fraction of replication-competent but hardly inducible proviruses (i.e., 1/105 to 106 T cells) (1, 94), and they cannot be segregated from their uninfected counterpart. Moreover, patients' diversity and latently infected cell features, as well as limited blood or tissues sampling, impede screening of LRAs. Therefore, latency T-cell models remain useful for challenging new “shock and kill” strategies. Various latency T-cell models have been generated (85), but they lack the influence of neighboring cells, such as DCs, in the nature and nurture of latently infected cells. We established a coculture model consisting of the HIV latently infected T-cell line J-lat and MDDCs. MDDCs resemble inflammatory DCs (81) and are involved in early pathogen-specific T-cell responses (95). Thus, they may act indirectly on latently infected cells upon activation. We used this model to determine if triggering the DC compartment in concert with LRA had additive or synergistic effects over targeting latently infected cells alone.

We first characterized the latency reversion features of various J-lat clones to established LRAs (Fig. 1A). We found high LRA sensitivity disparity between the clones, which argues for clonal variegation leading to multiple refractory mechanisms to latency reversion (96). Moreover, maximum latency reversion was hardly achieved, These intrinsic features were also observed in primary cells (94).

Then, we compared the potencies of several known LRAs on J-lat clone 9.2 cells alone or cocultured with MDDCs (Fig. 1B). SAHA stood out for its ability to reverse HIV latency in J-Lat cells. In the coculture model, however, this effect was partially lost. This observation is consistent with the immunosuppressive activity of HDAC inhibitors (97) and emphasizes the need to investigate LRAs in more complex settings than only latently infected cell lines. Prostratin, a nontumorigenic phorbol ester, showed some modest latency-reversing activity in J-lat cells alone, as reported previously (51, 75). Notably, prostratin reactivates latent HIV and restricts HIV replication via (i) transient activation of several PKC isoforms (51), leading to availability of NF-κB and cyclin T1 (52), both being limiting factors for latency reversion and (ii) cell surface downregulation of CD4 and CXCR4 and DC-SIGN (43, 98) (Fig. 5C) and upregulation of the HIV restriction factor p21 (99, 100). Intriguingly, in the cocultures, prostratin exhibited a substantially increased number and intensity of eGFP-expressing cells, but the level of apoptosis was similar to that of J-lat cells alone (Fig. 1B). In contrast to SAHA, adding MDDCs reinforced substantially the LR effects of prostratin, leading to MDDC maturation and enhancing latency reversion.

We primarily tested the TLR agonists TLR2, -4, and -8 for their ability to stimulate the MDDCs. They had no effect when added to J-lat cells alone (Fig. 1B), consistent with the lack of TLR2, -4, and -8 mRNA expression even upon treatment (data not shown). In the coculture system, TLR4ag and -8ag displayed potent activity in inducing HIV expression, as judged by the eGFP expression in J-lat cells, but the TLR2ag had only a modest effect (Fig. 1B). TLR4 also triggers a prominent cytokine storm that would exclude its clinical application. In contrast, TLR7 and TLR7/8 agonists have been successfully and safely applied to patients with hepatitis B (101) and C (102) infection and thus are rational candidates to test in concert with prostratin. Notably, TLR8ag beneficially affected various steps leading to the generation of an efficient adaptive immune response (67, 73, 103). Importantly, prostratin with the TLR8ag led to a significantly larger breadth and intensity of HIV latency reversion than prostratin alone (Fig. 2D and F). These findings suggest a reinforcement of signaling events, which might target and reactivate various cell types, harboring diverse HIV transcription blocks in vivo.

We chose another latently HIV infected T-cell line, namely, J1.1 (104), which was obtained by limiting dilution of HIV-1/lymphadenopathy-associated virus (LAV)-infected Jurkat E6 cells, to corroborate the data observed with the J-lat cells. The J1.1 cell line was very responsive to TNF and to the combination of prostratin and TLR8ag at the doses established in the J-lat clone 9.2 cells (Fig. 3). We observed similar effects in coculture, but they were less prominent than those of the J-lat clone 9.2. The different reactivities to LRAs between these cell lines are consistent with the intrinsic sensitivity of most cell models to particular stimuli, as stated by Spina et al. (85).

TNF certainly plays a key role in the reversion of HIV latency in this setup. However, reversion of latency was still observed when excess of NAb against TNF was added (Fig. 4A and B). We found that cell-cell contact contributes to the reversion of latency in coculture. Indeed, the transfer of supernatant from TLR8ag-stimulated MDDCs onto prostratin-treated J-lat cells and the stimulation of J-lat cells with prostratin and TNF did not reach the level of reversion observed in the coculture setup (Fig. 4D). Thus, soluble factors and cell-cell contact contributed to the overall effects observed.

Further detailed characterization revealed that both compounds promoted phenotypical and functional maturation of MDDCs, the effects being more prominent in response to the TLR8ag than to prostratin (Fig. 5). Secreted IL-12p70 and CD83 engagement might drive a Th1 immune response through (i) NK activation, (ii) naive CD8+ T-cell priming, (iii) expansion and survival of antigen-specific CD8+ T memory cells (77, 105108), and (iv) restoration of exhausted CD8+ T cells (92, 93). Intriguingly, the maturation markers CD80 and CD86 were most likely interacting with the inhibitory molecule CTLA-4, as their neutralization resulted in enhanced viability and eGFP expression. Indeed, CTLA-4 was induced on J-lat cells when MDDCs were added (Fig. 5E). Hence, blocking CTLA-4, together with prostratin and TLR8ag treatment, might potentiate the “shock and kill” strategy (109). Similarly, ICOS was upregulated in coculture upon prostratin-mediated T-cell activation. However, increasing concentrations of ICOSL-blocking antibodies did not reverse latency (data not shown), despite ICOSL expression by MDDCs (110). Of note, ICAM1, upregulated by TNF signaling on DCs, was recently associated with HIV reactivation in proliferating CD4+ T cells, in a similar system (111). Since Jurkat cells do not multimerize LFA-1, which is crucial for its activation and interaction with ICAM1, we did not challenge this axis (112).

Activation and latency reversion might proceed in parallel with cell death of the target, as well as in bystander cells. Therefore, promising LRAs should be evaluated for their potential side effects (Fig. 6). As expected, SAHA increased active caspase-3 up to 7-fold in J-lat cells, as reported previously (113, 114). Surprisingly, we observed a similar induction in MDDCs. In contrast, prostratin induced a 3-fold increase of active caspase-3 in J-lat cells and none in MDDCs. Importantly, adding the TLR8ag did not enhance the prostratin-mediated apoptosis.

In sum, the combination of stimuli chosen exhibited no detrimental effect on both cellular players, and the enhanced HIV transcription observed without increasing apoptosis might be optimal for providing an antigenic boost to CTLs.

We next wondered if the combinatorial stimulation of J-lat cells and MDDCs would remove epigenetic blocks by looking at the acetylation status of lysine 9 on histone H3 (H3K9-ac). Upon cell stimulation, transcription factors recruit histone acetyltransferase (HAT) and nucleosome-remodeling complexes. They allow the binding of the transcriptional machinery through chromatin relaxation (115118). Prostratin alone did not induce any H3K9 acetylation of the overall chromatin 24 h after stimulation, while when given together with TLR8ag it resulted in a significant relaxation of the chromatin (Fig. 7). This result endorses the highly dynamic and tailored signaling-induced chromatin-remodeling paradigm. Thus, the combination of those compounds acted at multiple levels to reverse latency, through chromatin accessibility and NF-κB and PTEFb induction in this model (119). On the other hand, SAHA treatment led to a global acetylation pattern, which was not correlated with reversion of latency, highlighting the heterogeneity of the latency mechanisms responsible for HIV latency.

Using a library of signaling inhibitors, we demonstrated here that blocking the non-receptor kinases SYK and MEK drastically reversed the effects on latently HIV-infected cells, triggered by prostratin and TLR8ag (Fig. 8A). Moreover, their signaling appeared crucial for all treatment in J-lat alone as in coculture, indicating their activation by prostratin (Fig. 8A and B). SYK is a key downstream molecule in various immunoreceptor signaling events, in pre-T cells, mature B cells (90, 120, 121), and malignancies (122, 123): e.g., J-lat cells. MEK, belonging to the mitogen-activated protein kinase (MAPK) pathway, bridged the signaling events induced by prostratin to latency reversion in J-lat cells and in coculture.

Various PKC isoforms translocate within the plasma membrane upon prostratin stimulation, such as PKCβ (51). Indeed, we observed a significant, but not complete, contribution of PKCβ on latency reversion in J-lat cells. This highlighted the role of other PKC isoforms, such as novel PKCs (e.g., δ, ε, η, and θ), that participated in the overall response, through NF-κB and PTEFb release (124). Of note, prostratin-treated cocultures showed stronger PKCβ implication than J-lat alone, arguing for multiple effects of prostratin on both cell types (Fig. 8B). Addition of TLR8ag in the coculture drastically reduced the implication of PKCβ, TBK1, and PDK1 in the ultimate outcome, pointing to the collaborative and redundant signaling events involved in this setup (Fig. 8C). Moreover, the downstream effector within the TLR pathway, TBK1 (125), which participates in TNF production, demonstrated its relevance only in the coculture setup. We speculate that the TLR8-mediated MDDCs' maturation and the subsequent interaction with J-lat cells reduced the involvement of PKCβ, TBK1, and PDK1 in the overall response, highlighting collaborative signaling events. Surprisingly, inhibition of phospholipase C reinforced HIV reactivation in all of the setup (Fig. 8A and B). This may reflect its interaction with SYK through LAT in T cells (126, 127), a change in signaling homeostasis, or an unspecific effect of the inhibitor.

Finally, we confirmed the relevance of the approach investigated in primary cells from aviremic patients. First, we demonstrated that latency reversion in response to treatments was not just a stochastic event since the compounds were clearly superior to the mock control (Fig. 9A). Second, the LRAs' potency was donor dependent. Not even the positive control (anti-CD3/CD28/CD2) reversed latency uniformly (Fig. 9B). We also observed striking differences in the magnitude of latency reversion between compounds and donors. Actually, the extent of viral RNA production upon stimulation might be a crucial parameter for achieving the depletion of these cells (59). In particular, prostratin plus TLR8ag excelled in higher latency reversion in two donors than either prostratin or TLR8ag alone. However, prostratin plus TLR8ag had no effect in two others; one of those was not reactivated even by the positive control.

Several parameters might affect the sensitivity of primary latently infected cells to a given LRA, such as the number of latently infected cells, the CD4+ T-cell subset, and the epigenetic status, as well as the presence of inhibitory receptors (128). Since we had been working with plain peripheral blood mononuclear cells (PBMCs) and not enriched lymphocytes and monocytes, obtained by leukapheresis, we might indeed encounter the risk that in some specimens, the number of latently infected cells was too low or the cells were even absent. The number of latently infected cells is very small in humans, with an estimated 1 to 60 provirus-containing cells per million CD4+ T cells (1, 94). Thus, by using 0.5 million CD4+ T cells per condition, we estimated to have between 0.5 and 30 latently infected cells per condition. This could explain part of the variability observed, although HIV reactivation was detected in all of the donors.

Another variable that may affect the outcome is the response of the ex vivo-generated MDDCs to the TLR8ag and their interplay with autologous CD4+ T cells, as well as their survival in the cocultures. Nevertheless, the data generated are very promising and should encourage future studies exploring combination therapies of immunomodulators and LRAs.

In conclusion, we established a novel in vitro coculture system for testing compounds that mediate latency reversion. We showed that the synergistic efficacy of prostratin and TLR8ag in coculture can remove various repressive latency mechanisms through concomitant signaling events and confirmed its applicability to primary cells.

MATERIALS AND METHODS

Antibodies and reagents.

Prostratin (P0077), 5-aza-2′deoxycytidine (Aza-CdR [A3656]), azidothymidine (AZT [A2169]), and efavirenz (SML0536) were purchased from Sigma-Aldrich. Prostratin and Aza-CdR were used at 0.5 μM, AZT at 5 μM, and efavirenz at 50 nM. Recombinant human granulocyte-macrophage colony-stimulating factor (rHuGM-CSF), rHuIL-4, and TNF (10 ng/ml) were obtained from Immunotools (11343127, 11340017 and 113440047, respectively). TLR8ag (3M-002), used at 1 μM, was purchased from 3M Pharmaceuticals (St. Paul, MN). Finally, SAHA, obtained from Cayman (10009929), was used at 1 μM unless otherwise stated in the figure legends. Blocking antibodies CD80 and CD86 (Biolegend [305201 and 305401]) were applied at 5 μg/ml, and infliximab was obtained from R&D Systems (AF-210-NA) and was used at 1 μg/ml for the TNF blocking experiments. The ImmunoCult human CD3/CD28/CD2 T-cell activator (10970) from Stemcell Technologies was used based on the manufacturer's instructions. Flow cytometry antibodies were purchased either from Pharmingen (i.e., active caspase-3–phycoerythrin [PE; 550821], CD80-PE [557227], CD83-PE [556855], CD86-PE [555658]), Biolegend (CTLA-4–allophycocyanin [APC; 349907], ICOS-PE/Cy7 [313519], DC-SIGN-fluorescein isothiocyanate [FITC; 330103], and HLA-DR–APC [307609]), or from Beckman Coulter (p24-RD1 [6604667]). Finally, acetylated lysine-9 of histone H3 (H3K9-ac) antibody was obtained from Abcam (Cambridge, United Kingdom). The signaling inhibitor library, kindly provided by B. Schaefer and mainly originating from AxonMedchem, Selleck, and Sigma-Aldrich, was applied for 1 h at a final concentration of 500 nM on J-lat cells alone before adding the MDDCs in combination with the stimuli.

Cell culture.

J-lat, J1.1, ACH2, and 8E5 cells, obtained from NIH (9848, 1340, 349, and 95, respectively), were cultured in R-10 medium (i.e., RPMI 1640) medium (BioWhittaker) supplemented with 10% fetal calf serum (FCS), 2 mM l-glutamine, and 1% penicillin-streptomycin (Gibco). J-lat and J1.1 cells were both derived from Jurkat cells (82, 104). MDDCs were generated by 7 days of stimulation of monocytes, isolated from healthy donors with CD14 microbeads (Miltenyi [130-050-201]), with 1,000 biologically active units per ml of rHuIL-4 and rHuGM-CSF. J-lat or J1.1 cells (102) were seeded in a 96-well plate with or without 104 MDDCs and cultured/treated for 24 h. J-lat cells and MDDCs were separated in a 24-well plate by applying a Transwell (Millipore, Millicell [PIHP01250]) with a pore size of 0.4 μm. Blocking antibodies CD80 and CD86 were preincubated 1 h before adding J-lat and the treatments. Azide (0.09%), included in the CD80 and -86 blocking antibodies, was added to the mock control.

Patients.

We had access to specimens from HIV-infected patients successfully treated by cART (<20 copies/ml, as measured by the Cobas Amplicor technology; Roche) for more than 4 years (median, 12.5 years) with a median of 584 CD4+ T cells/μl. The use of these specimens was approved by the Ethics Committee of the University Hospital Zurich, and informed consent was obtained from all HIV-1-infected individuals recruited. All experiments were performed in accordance with the relevant guidelines and regulations.

PBMCs were isolated from 30 ml of blood by Ficoll (Axis-Shield PoC AS, Norway) gradient centrifugation, followed by CD8+ T-cell depletion using microbeads (Miltenyi [130-045-201]) and CD14+ cell isolation as previously described. The remaining PBMCs were cryopreserved until MDDC differentiation, and CD4+ T cells were then indirectly isolated (Miltenyi [130-096-533]). Limited blood volume and cell numbers restrained the experiment setup to 105 CD4+ T cells and 104 MDDCs per well in quintuplicate. These autologous cocultures were stimulated with either prostratin, TLR8ag, both combined, or anti-CD3/CD28/CD2 antibodies. AZT and efavirenz were added to all the conditions. At days 2, 5, 7, and 9, 50 μl of supernatant per well was collected, pooled per donor and treatment, and analyzed for HIV RNA copy numbers. Medium was replaced twice a week until the end of the experiment.

Flow cytometry.

J-lat clone 9.2 cells, MDDCs, or both combined were incubated with the cell surface marker antibody at an optimized dilution in fluorescence-activated cell sorter (FACS) buffer (phosphate-buffered saline [PBS] containing 2 mM EDTA, 0.1% sodium azide, and 10% FCS) for 20 min at 4°C. Cells were subsequently washed with FACS buffer and fixed with 1% paraformaldehyde (PFA) in PBS until acquisition. A permeabilization kit (BD Cytofix/Cytoperm [554714]) was used for intracellular staining for active caspase-3, H3K9-ac, and p24 antigen according to the manufacturer's instructions. Stained cells were acquired on a CyAn ADP analyzer (Beckman Coulter), and data were analyzed using FlowJo (v.10.0.8). We defined the live cells by the side scatter/forward scatter (SSC/FSC) gate and then quantified the number of cells by the specific marker of interest.

Cytokine measurements.

Supernatants (SN) of stimulated MDDCs were collected at 6, 12, 24, and 36 h and subjected to quantification of TNF, macrophage inflammatory protein 1α (MIP1α), and IL-12p70. Human cytokines were analyzed using a multiplexed particle-based flow cytometric cytokine assay (129). Cytokine kits were purchased from R&D Systems. The procedures closely followed the manufacturer's instructions. The analysis used a conventional flow cytometer (Guava EasyCyte Plus; Millipore, Zug, Switzerland). The values (picograms per milliliter) obtained were normalized on the mock-treated control.

Viral RNA measurements.

HIV RNA was isolated from 250 μl culture supernatant using the QIAmp viral RNA minikit (Qiagen [52906]). Serial dilutions of PBMC-propagated Yu2, quantified by Cobas Amplicor technology (Roche), were simultaneously isolated and used as standards. Subsequently, viral RNA was reverse transcribed using the iScript Select cDNA synthesis kit (Bio-Rad [170-8897]) in combination with a gene-specific primer (0.25 μM reverse primer TACTAGTAGTTCCTGCTATGTCACTTCC). HIV DNA was amplified using the Maxima Hot Start PCR master mix (Thermo Scientific [K1052]) with 1 μM forward primer (5′-CAAGCAGCCATGCAAATGTTAAAAGA-3′), 0.3 μM probe (5′-6 carboxyfluorescein [FAM]-TGCAGCTTCCTCATTGATGGT-black hole quencher 1 [BHQ1]-3′), and 1 μM the reverse primer mentioned above. The cycling conditions were 95°C for 4 min and then 50 cycles of 95°C for 5 s, 55°C for 5 s, and 60°C for 30 s. Reactions were performed on a Bio-Rad iCycler (170-8740) and analyzed with the IQ5 software (Bio-Rad). Copy numbers (copies per milliliter) were adjusted to the initial volume of supernatant.

Statistics.

The software GraphPad Prism version 5.04 was used for doing statistics. The statistical test employed is indicated in the legends. The two-tailed paired t test was performed on the individual replicates between parameters unless otherwise stated. The Mann-Whitney test and ANOVA were used for the viral RNA peak value statistics. P ≤ 0.5 was considered statistically significant.

ACKNOWLEDGMENTS

We thank the patients for kindly participating in this study. The J-lat clones (9846, 9847, 9848, 9849, and 9850) and J1.1 (1340), 8E5 (95), and ACH2 (349) cell lines were obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH.

This work was supported by the Swiss National Science Foundation (SNF 31003A_135682/1 and 31003A_153248/1).

M.A.R. and R.F.S. elaborated the concept of this study, M.A.R. did all of the experimental work, E.S. executed some experiments and gave conceptual inputs, and M.A.R. and R.F.S. wrote the manuscript.

REFERENCES

  • 1.Chun TW, Carruth L, Finzi D, Shen X, DiGiuseppe JA, Taylor H, Hermankova M, Chadwick K, Margolick J, Quinn TC, Kuo YH, Brookmeyer R, Zeiger MA, Barditch-Crovo P, Siliciano RF. 1997. Quantification of latent tissue reservoirs and total body viral load in HIV-1 infection. Nature 387:183–188. doi: 10.1038/387183a0. [DOI] [PubMed] [Google Scholar]
  • 2.Finzi D, Hermankova M, Pierson T, Carruth LM, Buck C, Chaisson RE, Quinn TC, Chadwick K, Margolick J, Brookmeyer R, Gallant J, Markowitz M, Ho DD, Richman DD, Siliciano RF. 1997. Identification of a reservoir for HIV-1 in patients on highly active antiretroviral therapy. Science 278:1295–1300. doi: 10.1126/science.278.5341.1295. [DOI] [PubMed] [Google Scholar]
  • 3.Chun TW, Stuyver L, Mizell SB, Ehler LA, Mican JA, Baseler M, Lloyd AL, Nowak MA, Fauci AS. 1997. Presence of an inducible HIV-1 latent reservoir during highly active antiretroviral therapy. Proc Natl Acad Sci U S A 94:13193–13197. doi: 10.1073/pnas.94.24.13193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Wong JK, Hezareh M, Gunthard HF, Havlir DV, Ignacio CC, Spina CA, Richman DD. 1997. Recovery of replication-competent HIV despite prolonged suppression of plasma viremia. Science 278:1291–1295. doi: 10.1126/science.278.5341.1291. [DOI] [PubMed] [Google Scholar]
  • 5.Chun TW, Davey RT Jr, Engel D, Lane HC, Fauci AS. 1999. Re-emergence of HIV after stopping therapy. Nature 401:874–875. doi: 10.1038/44755. [DOI] [PubMed] [Google Scholar]
  • 6.Finzi D, Blankson J, Siliciano JD, Margolick JB, Chadwick K, Pierson T, Smith K, Lisziewicz J, Lori F, Flexner C, Quinn TC, Chaisson RE, Rosenberg E, Walker B, Gange S, Gallant J, Siliciano RF. 1999. Latent infection of CD4+ T cells provides a mechanism for lifelong persistence of HIV-1, even in patients on effective combination therapy. Nat Med 5:512–517. doi: 10.1038/8394. [DOI] [PubMed] [Google Scholar]
  • 7.Siliciano JD, Kajdas J, Finzi D, Quinn TC, Chadwick K, Margolick JB, Kovacs C, Gange SJ, Siliciano RF. 2003. Long-term follow-up studies confirm the stability of the latent reservoir for HIV-1 in resting CD4+ T cells. Nat Med 9:727–728. doi: 10.1038/nm880. [DOI] [PubMed] [Google Scholar]
  • 8.Chun TW, Engel D, Berrey MM, Shea T, Corey L, Fauci AS. 1998. Early establishment of a pool of latently infected, resting CD4(+) T cells during primary HIV-1 infection. Proc Natl Acad Sci U S A 95:8869–8873. doi: 10.1073/pnas.95.15.8869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Friedman J, Cho WK, Chu CK, Keedy KS, Archin NM, Margolis DM, Karn J. 2011. Epigenetic silencing of HIV-1 by the histone H3 lysine 27 methyltransferase enhancer of Zeste 2. J Virol 85:9078–9089. doi: 10.1128/JVI.00836-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Williams SA, Chen LF, Kwon H, Ruiz-Jarabo CM, Verdin E, Greene WC. 2006. NF-kappaB p50 promotes HIV latency through HDAC recruitment and repression of transcriptional initiation. EMBO J 25:139–149. doi: 10.1038/sj.emboj.7600900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Verdin E, Paras P Jr, Van Lint C. 1993. Chromatin disruption in the promoter of human immunodeficiency virus type 1 during transcriptional activation. EMBO J 12:3249–3259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Kauder SE, Bosque A, Lindqvist A, Planelles V, Verdin E. 2009. Epigenetic regulation of HIV-1 latency by cytosine methylation. PLoS Pathog 5:e1000495. doi: 10.1371/journal.ppat.1000495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.He G, Margolis DM. 2002. Counterregulation of chromatin deacetylation and histone deacetylase occupancy at the integrated promoter of human immunodeficiency virus type 1 (HIV-1) by the HIV-1 repressor YY1 and HIV-1 activator Tat. Mol Cell Biol 22:2965–2973. doi: 10.1128/MCB.22.9.2965-2973.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Karn J. 2011. The molecular biology of HIV latency: breaking and restoring the Tat-dependent transcriptional circuit. Curr Opin HIV AIDS 6:4–11. doi: 10.1097/COH.0b013e328340ffbb. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Ganesh L, Burstein E, Guha-Niyogi A, Louder MK, Mascola JR, Klomp LW, Wijmenga C, Duckett CS, Nabel GJ. 2003. The gene product Murr1 restricts HIV-1 replication in resting CD4+ lymphocytes. Nature 426:853–857. doi: 10.1038/nature02171. [DOI] [PubMed] [Google Scholar]
  • 16.Verma IM, Stevenson JK, Schwarz EM, Van Antwerp D, Miyamoto S. 1995. Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev 9:2723–2735. doi: 10.1101/gad.9.22.2723. [DOI] [PubMed] [Google Scholar]
  • 17.Nabel G, Baltimore D. 1987. An inducible transcription factor activates expression of human immunodeficiency virus in T cells. Nature 326:711–713. doi: 10.1038/326711a0. [DOI] [PubMed] [Google Scholar]
  • 18.Budhiraja S, Famiglietti M, Bosque A, Planelles V, Rice AP. 2013. Cyclin T1 and CDK9 T-loop phosphorylation are downregulated during establishment of HIV-1 latency in primary resting memory CD4+ T cells. J Virol 87:1211–1220. doi: 10.1128/JVI.02413-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zhou Q, Yik JH. 2006. The Yin and Yang of P-TEFb regulation: implications for human immunodeficiency virus gene expression and global control of cell growth and differentiation. Microbiol Mol Biol Rev 70:646–659. doi: 10.1128/MMBR.00011-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Tyagi M, Pearson RJ, Karn J. 2010. Establishment of HIV latency in primary CD4+ cells is due to epigenetic transcriptional silencing and P-TEFb restriction. J Virol 84:6425–6437. doi: 10.1128/JVI.01519-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Chiang K, Sung TL, Rice AP. 2012. Regulation of cyclin T1 and HIV-1 replication by microRNAs in resting CD4+ T lymphocytes. J Virol 86:3244–3252. doi: 10.1128/JVI.05065-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Hoque M, Shamanna RA, Guan D, Pe'ery T, Mathews MB. 2011. HIV-1 replication and latency are regulated by translational control of cyclin T1. J Mol Biol 410:917–932. doi: 10.1016/j.jmb.2011.03.060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Dar RD, Hosmane NN, Arkin MR, Siliciano RF, Weinberger LS. 2014. Screening for noise in gene expression identifies drug synergies. Science 344:1392–1396. doi: 10.1126/science.1250220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Deeks SG. 2012. HIV: shock and kill. Nature 487:439–440. doi: 10.1038/487439a. [DOI] [PubMed] [Google Scholar]
  • 25.Kulkosky J, Sullivan J, Xu Y, Souder E, Hamer DH, Pomerantz RJ. 2004. Expression of latent HAART-persistent HIV type 1 induced by novel cellular activating agents. AIDS Res Hum Retroviruses 20:497–505. doi: 10.1089/088922204323087741. [DOI] [PubMed] [Google Scholar]
  • 26.Hamer DH. 2004. Can HIV be cured? Mechanisms of HIV persistence and strategies to combat it. Curr HIV Res 2:99–111. [DOI] [PubMed] [Google Scholar]
  • 27.Olesen R, Vigano S, Rasmussen TA, Sogaard OS, Ouyang Z, Buzon M, Bashirova A, Carrington M, Palmer S, Brinkmann CR, Yu XG, Ostergaard L, Tolstrup M, Lichterfeld M. 2015. Innate immune activity correlates with CD4 T cell-associated HIV-1 DNA decline during latency-reversing treatment with panobinostat. J Virol 89:10176–10189. doi: 10.1128/JVI.01484-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Wren LH, Stratov I, Kent SJ, Parsons MS. 2013. Obstacles to ideal anti-HIV antibody-dependent cellular cytotoxicity responses. Vaccine 31:5506–5517. doi: 10.1016/j.vaccine.2013.08.035. [DOI] [PubMed] [Google Scholar]
  • 29.Lee WS, Parsons MS, Kent SJ, Lichtfuss M. 2015. Can HIV-1-specific ADCC assist the clearance of reactivated latently infected cells? Front Immunol 6:265. doi: 10.3389/fimmu.2015.00265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Chun TW, Engel D, Mizell SB, Hallahan CW, Fischette M, Park S, Davey RT Jr, Dybul M, Kovacs JA, Metcalf JA, Mican JM, Berrey MM, Corey L, Lane HC, Fauci AS. 1999. Effect of interleukin-2 on the pool of latently infected, resting CD4+ T cells in HIV-1-infected patients receiving highly active anti-retroviral therapy. Nat Med 5:651–655. doi: 10.1038/9498. [DOI] [PubMed] [Google Scholar]
  • 31.Stellbrink HJ, van Lunzen J, Westby M, O'Sullivan E, Schneider C, Adam A, Weitner L, Kuhlmann B, Hoffmann C, Fenske S, Aries PS, Degen O, Eggers C, Petersen H, Haag F, Horst HA, Dalhoff K, Mocklinghoff C, Cammack N, Tenner-Racz K, Racz P. 2002. Effects of interleukin-2 plus highly active antiretroviral therapy on HIV-1 replication and proviral DNA (COSMIC trial). AIDS 16:1479–1487. doi: 10.1097/00002030-200207260-00004. [DOI] [PubMed] [Google Scholar]
  • 32.Davey RT Jr, Bhat N, Yoder C, Chun TW, Metcalf JA, Dewar R, Natarajan V, Lempicki RA, Adelsberger JW, Miller KD, Kovacs JA, Polis MA, Walker RE, Falloon J, Masur H, Gee D, Baseler M, Dimitrov DS, Fauci AS, Lane HC. 1999. HIV-1 and T cell dynamics after interruption of highly active antiretroviral therapy (HAART) in patients with a history of sustained viral suppression. Proc Natl Acad Sci U S A 96:15109–15114. doi: 10.1073/pnas.96.26.15109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Nunnari G, Leto D, Sullivan J, Xu Y, Mehlman KE, Kulkosky J, Pomerantz RJ. 2005. Seminal reservoirs during an HIV type 1 eradication trial. AIDS Res Hum Retroviruses 21:768–775. doi: 10.1089/aid.2005.21.768. [DOI] [PubMed] [Google Scholar]
  • 34.Lafeuillade A, Poggi C, Chadapaud S, Hittinger G, Chouraqui M, Pisapia M, Delbeke E. 2001. Pilot study of a combination of highly active antiretroviral therapy and cytokines to induce HIV-1 remission. J Acquir Immune Defic Syndr 26:44–55. [DOI] [PubMed] [Google Scholar]
  • 35.Levy Y, Sereti I, Tambussi G, Routy JP, Lelievre JD, Delfraissy JF, Molina JM, Fischl M, Goujard C, Rodriguez B, Rouzioux C, Avettand-Fenoel V, Croughs T, Beq S, Morre M, Poulin JF, Sekaly RP, Thiebaut R, Lederman MM. 2012. Effects of recombinant human interleukin 7 on T-cell recovery and thymic output in HIV-infected patients receiving antiretroviral therapy: results of a phase I/IIa randomized, placebo-controlled, multicenter study. Clin Infect Dis 55:291–300. doi: 10.1093/cid/cis383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Vandergeeten C, Fromentin R, DaFonseca S, Lawani MB, Sereti I, Lederman MM, Ramgopal M, Routy JP, Sekaly RP, Chomont N. 2013. Interleukin-7 promotes HIV persistence during antiretroviral therapy. Blood 121:4321–4329. doi: 10.1182/blood-2012-11-465625. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Sereti I, Dunham RM, Spritzler J, Aga E, Proschan MA, Medvik K, Battaglia CA, Landay AL, Pahwa S, Fischl MA, Asmuth DM, Tenorio AR, Altman JD, Fox L, Moir S, Malaspina A, Morre M, Buffet R, Silvestri G, Lederman MM, ACTG 5214 Study Team. 2009. IL-7 administration drives T cell-cycle entry and expansion in HIV-1 infection. Blood 113:6304–6314. doi: 10.1182/blood-2008-10-186601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.van Praag RM, Prins JM, Roos MT, Schellekens PT, Ten Berge IJ, Yong SL, Schuitemaker H, Eerenberg AJ, Jurriaans S, de Wolf F, Fox CH, Goudsmit J, Miedema F, Lange JM. 2001. OKT3 and IL-2 treatment for purging of the latent HIV-1 reservoir in vivo results in selective long-lasting CD4+ T cell depletion. J Clin Immunol 21:218–226. doi: 10.1023/A:1011091300321. [DOI] [PubMed] [Google Scholar]
  • 39.Shen X, Xiong GL, Jing Y, Xiao H, Cui Y, Zhang YF, Shan YJ, Xing S, Yang M, Liu XL, Dong B, Wang LS, Luo QL, Yu ZY, Cong YW. 2015. The protein kinase C agonist prostratin induces differentiation of human myeloid leukemia cells and enhances cellular differentiation by chemotherapeutic agents. Cancer Lett 356:686–696. doi: 10.1016/j.canlet.2014.10.018. [DOI] [PubMed] [Google Scholar]
  • 40.Morgan RJ Jr, Leong L, Chow W, Gandara D, Frankel P, Garcia A, Lenz HJ, Doroshow JH. 2012. Phase II trial of bryostatin-1 in combination with cisplatin in patients with recurrent or persistent epithelial ovarian cancer: a California Cancer Consortium study. Invest New Drugs 30:723–728. doi: 10.1007/s10637-010-9557-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Gonelli A, Mischiati C, Guerrini R, Voltan R, Salvadori S, Zauli G. 2009. Perspectives of protein kinase C (PKC) inhibitors as anti-cancer agents. Mini Rev Med Chem 9:498–509. doi: 10.2174/138955709787847967. [DOI] [PubMed] [Google Scholar]
  • 42.Jiang G, Dandekar S. 2015. Targeting NF-kappaB signaling with protein kinase C agonists as an emerging strategy for combating HIV latency. AIDS Res Hum Retroviruses 31:4–12. doi: 10.1089/aid.2014.0199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Biancotto A, Grivel JC, Gondois-Rey F, Bettendroffer L, Vigne R, Brown S, Margolis LB, Hirsch I. 2004. Dual role of prostratin in inhibition of infection and reactivation of human immunodeficiency virus from latency in primary blood lymphocytes and lymphoid tissue. J Virol 78:10507–10515. doi: 10.1128/JVI.78.19.10507-10515.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Brooks DG, Hamer DH, Arlen PA, Gao L, Bristol G, Kitchen CM, Berger EA, Zack JA. 2003. Molecular characterization, reactivation, and depletion of latent HIV. Immunity 19:413–423. doi: 10.1016/S1074-7613(03)00236-X. [DOI] [PubMed] [Google Scholar]
  • 45.Kulkosky J, Culnan DM, Roman J, Dornadula G, Schnell M, Boyd MR, Pomerantz RJ. 2001. Prostratin: activation of latent HIV-1 expression suggests a potential inductive adjuvant therapy for HAART. Blood 98:3006–3015. doi: 10.1182/blood.V98.10.3006. [DOI] [PubMed] [Google Scholar]
  • 46.Wolschendorf F, Duverger A, Jones J, Wagner FH, Huff J, Benjamin WH, Saag MS, Niederweis M, Kutsch O. 2010. Hit-and-run stimulation: a novel concept to reactivate latent HIV-1 infection without cytokine gene induction. J Virol 84:8712–8720. doi: 10.1128/JVI.00523-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Martinez-Bonet M, Clemente MI, Alvarez S, Diaz L, Garcia-Alonso D, Munoz E, Moreno S, Munoz-Fernandez MA. 2015. Antiretroviral drugs do not interfere with bryostatin-mediated HIV-1 latency reversal. Antiviral Res 123:163–171. doi: 10.1016/j.antiviral.2015.09.014. [DOI] [PubMed] [Google Scholar]
  • 48.Diaz L, Martinez-Bonet M, Sanchez J, Fernandez-Pineda A, Jimenez JL, Munoz E, Moreno S, Alvarez S, Munoz-Fernandez MA. 2015. Bryostatin activates HIV-1 latent expression in human astrocytes through a PKC and NF-kB-dependent mechanism. Sci Rep 5:12442. doi: 10.1038/srep12442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Pandelo Jose D, Bartholomeeusen K, da Cunha RD, Abreu CM, Glinski J, da Costa TB, Bacchi Rabay AF, Pianowski Filho LF, Dudycz LW, Ranga U, Peterlin BM, Pianowski LF, Tanuri A, Aguiar RS. 2014. Reactivation of latent HIV-1 by new semi-synthetic ingenol esters. Virology 462- 463:328–339. doi: 10.1016/j.virol.2014.05.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Abreu CM, Price SL, Shirk EN, Cunha RD, Pianowski LF, Clements JE, Tanuri A, Gama L. 2014. Dual role of novel ingenol derivatives from Euphorbia tirucalli in HIV replication: inhibition of de novo infection and activation of viral LTR. PLoS One 9:e97257. doi: 10.1371/journal.pone.0097257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Williams SA, Chen LF, Kwon H, Fenard D, Bisgrove D, Verdin E, Greene WC. 2004. Prostratin antagonizes HIV latency by activating NF-kappaB. J Biol Chem 279:42008–42017. doi: 10.1074/jbc.M402124200. [DOI] [PubMed] [Google Scholar]
  • 52.Sung TL, Rice AP. 2006. Effects of prostratin on cyclin T1/P-TEFb function and the gene expression profile in primary resting CD4+ T cells. Retrovirology 3:66. doi: 10.1186/1742-4690-3-66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Beans EJ, Fournogerakis D, Gauntlett C, Heumann LV, Kramer R, Marsden MD, Murray D, Chun TW, Zack JA, Wender PA. 2013. Highly potent, synthetically accessible prostratin analogs induce latent HIV expression in vitro and ex vivo. Proc Natl Acad Sci U S A 110:11698–11703. doi: 10.1073/pnas.1302634110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Archin NM, Cheema M, Parker D, Wiegand A, Bosch RJ, Coffin JM, Eron J, Cohen M, Margolis DM. 2010. Antiretroviral intensification and valproic acid lack sustained effect on residual HIV-1 viremia or resting CD4+ cell infection. PLoS One 5:e9390. doi: 10.1371/journal.pone.0009390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Archin NM, Liberty AL, Kashuba AD, Choudhary SK, Kuruc JD, Crooks AM, Parker DC, Anderson EM, Kearney MF, Strain MC, Richman DD, Hudgens MG, Bosch RJ, Coffin JM, Eron JJ, Hazuda DJ, Margolis DM. 2012. Administration of vorinostat disrupts HIV-1 latency in patients on antiretroviral therapy. Nature 487:482–485. doi: 10.1038/nature11286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Rasmussen TA, Tolstrup M, Brinkmann CR, Olesen R, Erikstrup C, Solomon A, Winckelmann A, Palmer S, Dinarello C, Buzon M, Lichterfeld M, Lewin SR, Ostergaard L, Sogaard OS. 2014. Panobinostat, a histone deacetylase inhibitor, for latent-virus reactivation in HIV-infected patients on suppressive antiretroviral therapy: a phase 1/2, single group, clinical trial. Lancet HIV 1:e13–e21. doi: 10.1016/S2352-3018(14)70014-1. [DOI] [PubMed] [Google Scholar]
  • 57.Lehrman G, Hogue IB, Palmer S, Jennings C, Spina CA, Wiegand A, Landay AL, Coombs RW, Richman DD, Mellors JW, Coffin JM, Bosch RJ, Margolis DM. 2005. Depletion of latent HIV-1 infection in vivo: a proof-of-concept study. Lancet 366:549–555. doi: 10.1016/S0140-6736(05)67098-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Shan L, Deng K, Shroff NS, Durand CM, Rabi SA, Yang HC, Zhang H, Margolick JB, Blankson JN, Siliciano RF. 2012. Stimulation of HIV-1-specific cytolytic T lymphocytes facilitates elimination of latent viral reservoir after virus reactivation. Immunity 36:491–501. doi: 10.1016/j.immuni.2012.01.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Ke R, Lewin SR, Elliott JH, Perelson AS. 2015. Modeling the effects of vorinostat in vivo reveals both transient and delayed HIV transcriptional activation and minimal killing of latently infected cells. PLoS Pathog 11:e1005237. doi: 10.1371/journal.ppat.1005237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Vranjkovic A, Crawley AM, Patey A, Angel JB. 2011. IL-7-dependent STAT-5 activation and CD8+ T cell proliferation are impaired in HIV infection. J Leukoc Biol 89:499–506. doi: 10.1189/jlb.0710430. [DOI] [PubMed] [Google Scholar]
  • 61.Migueles SA, Weeks KA, Nou E, Berkley AM, Rood JE, Osborne CM, Hallahan CW, Cogliano-Shutta NA, Metcalf JA, McLaughlin M, Kwan R, Mican JM, Davey RT Jr, Connors M. 2009. Defective human immunodeficiency virus-specific CD8+ T-cell polyfunctionality, proliferation, and cytotoxicity are not restored by antiretroviral therapy. J Virol 83:11876–11889. doi: 10.1128/JVI.01153-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Deng K, Pertea M, Rongvaux A, Wang L, Durand CM, Ghiaur G, Lai J, McHugh HL, Hao H, Zhang H, Margolick JB, Gurer C, Murphy AJ, Valenzuela DM, Yancopoulos GD, Deeks SG, Strowig T, Kumar P, Siliciano JD, Salzberg SL, Flavell RA, Shan L, Siliciano RF. 2015. Broad CTL response is required to clear latent HIV-1 due to dominance of escape mutations. Nature 517:381–385. doi: 10.1038/nature14053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Sabado RL, O'Brien M, Subedi A, Qin L, Hu N, Taylor E, Dibben O, Stacey A, Fellay J, Shianna KV, Siegal F, Shodell M, Shah K, Larsson M, Lifson J, Nadas A, Marmor M, Hutt R, Margolis D, Garmon D, Markowitz M, Valentine F, Borrow P, Bhardwaj N. 2010. Evidence of dysregulation of dendritic cells in primary HIV infection. Blood 116:3839–3852. doi: 10.1182/blood-2010-03-273763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Buisson S, Benlahrech A, Gazzard B, Gotch F, Kelleher P, Patterson S. 2009. Monocyte-derived dendritic cells from HIV type 1-infected individuals show reduced ability to stimulate T cells and have altered production of interleukin (IL)-12 and IL-10. J Infect Dis 199:1862–1871. doi: 10.1086/599122. [DOI] [PubMed] [Google Scholar]
  • 65.Majumder B, Janket ML, Schafer EA, Schaubert K, Huang XL, Kan-Mitchell J, Rinaldo CR Jr, Ayyavoo V. 2005. Human immunodeficiency virus type 1 Vpr impairs dendritic cell maturation and T-cell activation: implications for viral immune escape. J Virol 79:7990–8003. doi: 10.1128/JVI.79.13.7990-8003.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Winckelmann AA, Munk-Petersen LV, Rasmussen TA, Melchjorsen J, Hjelholt TJ, Montefiori D, Ostergaard L, Sogaard OS, Tolstrup M. 2013. Administration of a Toll-like receptor 9 agonist decreases the proviral reservoir in virologically suppressed HIV-infected patients. PLoS One 8:e62074. doi: 10.1371/journal.pone.0062074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Schlaepfer E, Speck RF. 2011. TLR8 activates HIV from latently infected cells of myeloid-monocytic origin directly via the MAPK pathway and from latently infected CD4+ T cells indirectly via TNF-alpha. J Immunol 186:4314–4324. doi: 10.4049/jimmunol.1003174. [DOI] [PubMed] [Google Scholar]
  • 68.Novis CL, Archin NM, Buzon MJ, Verdin E, Round JL, Lichterfeld M, Margolis DM, Planelles V, Bosque A. 2013. Reactivation of latent HIV-1 in central memory CD4(+) T cells through TLR-1/2 stimulation. Retrovirology 10:119. doi: 10.1186/1742-4690-10-119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Napolitani G, Rinaldi A, Bertoni F, Sallusto F, Lanzavecchia A. 2005. Selected Toll-like receptor agonist combinations synergistically trigger a T helper type 1-polarizing program in dendritic cells. Nat Immunol 6:769–776. doi: 10.1038/ni1223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Schlaepfer E, Rochat MA, Duo L, Speck RF. 2014. Triggering TLR2, -3, -4, -5, and -8 reinforces the restrictive nature of M1- and M2-polarized macrophages to HIV. J Virol 88:9769–9781. doi: 10.1128/JVI.01053-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Schlaepfer E, Speck RF. 2008. Anti-HIV activity mediated by natural killer and CD8+ cells after Toll-like receptor 7/8 triggering. PLoS One 3:e1999. doi: 10.1371/journal.pone.0001999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Schlaepfer E, Audige A, Joller H, Speck RF. 2006. TLR7/8 triggering exerts opposing effects in acute versus latent HIV infection. J Immunol 176:2888–2895. doi: 10.4049/jimmunol.176.5.2888. [DOI] [PubMed] [Google Scholar]
  • 73.Brichacek B, Vanpouille C, Kiselyeva Y, Biancotto A, Merbah M, Hirsch I, Lisco A, Grivel JC, Margolis L. 2010. Contrasting roles for TLR ligands in HIV-1 pathogenesis. PLoS One 5:e12831. doi: 10.1371/journal.pone.0012831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Salaun B, Romero P, Lebecque S. 2007. Toll-like receptors' two-edged sword: when immunity meets apoptosis. Eur J Immunol 37:3311–3318. doi: 10.1002/eji.200737744. [DOI] [PubMed] [Google Scholar]
  • 75.Reuse S, Calao M, Kabeya K, Guiguen A, Gatot JS, Quivy V, Vanhulle C, Lamine A, Vaira D, Demonte D, Martinelli V, Veithen E, Cherrier T, Avettand V, Poutrel S, Piette J, de Launoit Y, Moutschen M, Burny A, Rouzioux C, De Wit S, Herbein G, Rohr O, Collette Y, Lambotte O, Clumeck N, Van Lint C. 2009. Synergistic activation of HIV-1 expression by deacetylase inhibitors and prostratin: implications for treatment of latent infection. PLoS One 4:e6093. doi: 10.1371/journal.pone.0006093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Laird GM, Bullen CK, Rosenbloom DI, Martin AR, Hill AL, Durand CM, Siliciano JD, Siliciano RF. 2015. Ex vivo analysis identifies effective HIV-1 latency-reversing drug combinations. J Clin Invest 125:1901–1912. doi: 10.1172/JCI80142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Hirano N, Butler MO, Xia Z, Ansen S, von Bergwelt-Baildon MS, Neuberg D, Freeman GJ, Nadler LM. 2006. Engagement of CD83 ligand induces prolonged expansion of CD8+ T cells and preferential enrichment for antigen specificity. Blood 107:1528–1536. doi: 10.1182/blood-2005-05-2073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Chatillon JF, Hamieh M, Bayeux F, Abasq C, Fauquembergue E, Drouet A, Guisier F, Latouche JB, Musette P. 2015. Direct Toll-like receptor 8 signaling increases the functional avidity of human CD8+ T lymphocytes generated for adoptive T cell therapy strategies. Immun Inflamm Dis 3:1–13. doi: 10.1002/iid3.43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Serbina NV, Salazar-Mather TP, Biron CA, Kuziel WA, Pamer EG. 2003. TNF/iNOS-producing dendritic cells mediate innate immune defense against bacterial infection. Immunity 19:59–70. doi: 10.1016/S1074-7613(03)00171-7. [DOI] [PubMed] [Google Scholar]
  • 80.Xu Y, Zhan Y, Lew AM, Naik SH, Kershaw MH. 2007. Differential development of murine dendritic cells by GM-CSF versus Flt3 ligand has implications for inflammation and trafficking. J Immunol 179:7577–7584. doi: 10.4049/jimmunol.179.11.7577. [DOI] [PubMed] [Google Scholar]
  • 81.Robbins SH, Walzer T, Dembele D, Thibault C, Defays A, Bessou G, Xu H, Vivier E, Sellars M, Pierre P, Sharp FR, Chan S, Kastner P, Dalod M. 2008. Novel insights into the relationships between dendritic cell subsets in human and mouse revealed by genome-wide expression profiling. Genome Biol 9:R17. doi: 10.1186/gb-2008-9-1-r17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Jordan A, Bisgrove D, Verdin E. 2003. HIV reproducibly establishes a latent infection after acute infection of T cells in vitro. EMBO J 22:1868–1877. doi: 10.1093/emboj/cdg188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Simpson TR, Quezada SA, Allison JP. 2010. Regulation of CD4 T cell activation and effector function by inducible costimulator (ICOS). Curr Opin Immunol 22:326–332. doi: 10.1016/j.coi.2010.01.001. [DOI] [PubMed] [Google Scholar]
  • 84.Witsch EJ, Peiser M, Hutloff A, Buchner K, Dorner BG, Jonuleit H, Mages HW, Kroczek RA. 2002. ICOS and CD28 reversely regulate IL-10 on re-activation of human effector T cells with mature dendritic cells. Eur J Immunol 32:2680–2686. doi: 10.1002/1521-4141(200209)32:9<2680::AID-IMMU2680>3.0.CO;2-6. [DOI] [PubMed] [Google Scholar]
  • 85.Spina CA, Anderson J, Archin NM, Bosque A, Chan J, Famiglietti M, Greene WC, Kashuba A, Lewin SR, Margolis DM, Mau M, Ruelas D, Saleh S, Shirakawa K, Siliciano RF, Singhania A, Soto PC, Terry VH, Verdin E, Woelk C, Wooden S, Xing S, Planelles V. 2013. An in-depth comparison of latent HIV-1 reactivation in multiple cell model systems and resting CD4+ T cells from aviremic patients. PLoS Pathog 9:e1003834. doi: 10.1371/journal.ppat.1003834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Williams SA, Kwon H, Chen LF, Greene WC. 2007. Sustained induction of NF-kappa B is required for efficient expression of latent human immunodeficiency virus type 1. J Virol 81:6043–6056. doi: 10.1128/JVI.02074-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Ahmed AU, Williams BR, Hannigan GE. 2015. Transcriptional activation of inflammatory genes: mechanistic insight into selectivity and diversity. Biomolecules 5:3087–3111. doi: 10.3390/biom5043087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Katan-Khaykovich Y, Struhl K. 2002. Dynamics of global histone acetylation and deacetylation in vivo: rapid restoration of normal histone acetylation status upon removal of activators and repressors. Genes Dev 16:743–752. doi: 10.1101/gad.967302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89.Yu T, Yi YS, Yang Y, Oh J, Jeong D, Cho JY. 2012. The pivotal role of TBK1 in inflammatory responses mediated by macrophages. Mediators Inflamm 2012:979105. doi: 10.1155/2012/979105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Lin YC, Huang DY, Chu CL, Lin YL, Lin WW. 2013. The tyrosine kinase Syk differentially regulates Toll-like receptor signaling downstream of the adaptor molecules TRAF6 and TRAF3. Sci Signal 6:ra71. doi: 10.1126/scisignal.2003973. [DOI] [PubMed] [Google Scholar]
  • 91.Darcis G, Bouchat S, Kula A, Van Driessche B, Delacourt N, Vanhulle C, Avettand-Fenoel V, De Wit S, Rohr O, Rouzioux C, Van Lint C. 14 October 2016. Reactivation capacity by latency-reversing agents ex vivo correlates with the size of the HIV-1 reservoir. AIDS doi: 10.1097/QAD.0000000000001290. [DOI] [PubMed] [Google Scholar]
  • 92.Schurich A, Pallett LJ, Lubowiecki M, Singh HD, Gill US, Kennedy PT, Nastouli E, Tanwar S, Rosenberg W, Maini MK. 2013. The third signal cytokine IL-12 rescues the anti-viral function of exhausted HBV-specific CD8 T cells. PLoS Pathog 9:e1003208. doi: 10.1371/journal.ppat.1003208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93.Halwani R, Boyer JD, Yassine-Diab B, Haddad EK, Robinson TM, Kumar S, Parkinson R, Wu L, Sidhu MK, Phillipson-Weiner R, Pavlakis GN, Felber BK, Lewis MG, Shen A, Siliciano RF, Weiner DB, Sekaly RP. 2008. Therapeutic vaccination with simian immunodeficiency virus (SIV)-DNA + IL-12 or IL-15 induces distinct CD8 memory subsets in SIV-infected macaques. J Immunol 180:7969–7979. doi: 10.4049/jimmunol.180.12.7969. [DOI] [PubMed] [Google Scholar]
  • 94.Ho YC, Shan L, Hosmane NN, Wang J, Laskey SB, Rosenbloom DI, Lai J, Blankson JN, Siliciano JD, Siliciano RF. 2013. Replication-competent noninduced proviruses in the latent reservoir increase barrier to HIV-1 cure. Cell 155:540–551. doi: 10.1016/j.cell.2013.09.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Leon B, Lopez-Bravo M, Ardavin C. 2007. Monocyte-derived dendritic cells formed at the infection site control the induction of protective T helper 1 responses against Leishmania. Immunity 26:519–531. doi: 10.1016/j.immuni.2007.01.017. [DOI] [PubMed] [Google Scholar]
  • 96.Fernandez G, Zeichner SL. 2010. Cell line-dependent variability in HIV activation employing DNMT inhibitors. Virol J 7:266. doi: 10.1186/1743-422X-7-266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97.Akimova T, Beier UH, Liu Y, Wang L, Hancock WW. 2012. Histone/protein deacetylases and T-cell immune responses. Blood 119:2443–2451. doi: 10.1182/blood-2011-10-292003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Gulakowski RJ, McMahon JB, Buckheit RW Jr, Gustafson KR, Boyd MR. 1997. Antireplicative and anticytopathic activities of prostratin, a non-tumor-promoting phorbol ester, against human immunodeficiency virus (HIV). Antiviral Res 33:87–97. doi: 10.1016/S0166-3542(96)01004-2. [DOI] [PubMed] [Google Scholar]
  • 99.Pauls E, Ruiz A, Riveira-Munoz E, Permanyer M, Badia R, Clotet B, Keppler OT, Ballana E, Este JA. 2014. p21 regulates the HIV-1 restriction factor SAMHD1. Proc Natl Acad Sci U S A 111:E1322–E1324. doi: 10.1073/pnas.1322059111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Chen H, Li C, Huang J, Cung T, Seiss K, Beamon J, Carrington MF, Porter LC, Burke PS, Yang Y, Ryan BJ, Liu R, Weiss RH, Pereyra F, Cress WD, Brass AL, Rosenberg ES, Walker BD, Yu XG, Lichterfeld M. 2011. CD4+ T cells from elite controllers resist HIV-1 infection by selective upregulation of p21. J Clin Invest 121:1549–1560. doi: 10.1172/JCI44539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101.Gane EJ, Lim YS, Gordon SC, Visvanathan K, Sicard E, Fedorak RN, Roberts S, Massetto B, Ye Z, Pflanz S, Garrison KL, Gaggar A, Mani Subramanian G, McHutchison JG, Kottilil S, Freilich B, Coffin CS, Cheng W, Kim YJ. 2015. The oral Toll-like receptor-7 agonist GS-9620 in patients with chronic hepatitis B virus infection. J Hepatol 63:320–328. doi: 10.1016/j.jhep.2015.02.037. [DOI] [PubMed] [Google Scholar]
  • 102.Pockros PJ, Guyader D, Patton H, Tong MJ, Wright T, McHutchison JG, Meng TC. 2007. Oral resiquimod in chronic HCV infection: safety and efficacy in 2 placebo-controlled, double-blind phase IIa studies. J Hepatol 47:174–182. doi: 10.1016/j.jhep.2007.02.025. [DOI] [PubMed] [Google Scholar]
  • 103.Mandraju R, Murray S, Forman J, Pasare C. 2014. Differential ability of surface and endosomal TLRs to induce CD8 T cell responses in vivo. J Immunol 192:4303–4315. doi: 10.4049/jimmunol.1302244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 104.Perez VL, Rowe T, Justement JS, Butera ST, June CH, Folks TM. 1991. An HIV-1-infected T cell clone defective in IL-2 production and Ca2+ mobilization after CD3 stimulation. J Immunol 147:3145–3148. [PubMed] [Google Scholar]
  • 105.Beadling C, Slifka MK. 2005. Differential regulation of virus-specific T-cell effector functions following activation by peptide or innate cytokines. Blood 105:1179–1186. [DOI] [PubMed] [Google Scholar]
  • 106.Keppler SJ, Aichele P. 2011. Signal 3 requirement for memory CD8+ T-cell activation is determined by the infectious pathogen. Eur J Immunol 41:3176–3186. doi: 10.1002/eji.201141537. [DOI] [PubMed] [Google Scholar]
  • 107.Ramos HJ, Davis AM, Cole AG, Schatzle JD, Forman J, Farrar JD. 2009. Reciprocal responsiveness to interleukin-12 and interferon-alpha specifies human CD8+ effector versus central memory T-cell fates. Blood 113:5516–5525. doi: 10.1182/blood-2008-11-188458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 108.Trinchieri G. 2003. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat Rev Immunol 3:133–146. doi: 10.1038/nri1001. [DOI] [PubMed] [Google Scholar]
  • 109.Halper-Stromberg A, Lu CL, Klein F, Horwitz JA, Bournazos S, Nogueira L, Eisenreich TR, Liu C, Gazumyan A, Schaefer U, Furze RC, Seaman MS, Prinjha R, Tarakhovsky A, Ravetch JV, Nussenzweig MC. 2014. Broadly neutralizing antibodies and viral inducers decrease rebound from HIV-1 latent reservoirs in humanized mice. Cell 158:989–999. doi: 10.1016/j.cell.2014.07.043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 110.Aicher A, Hayden-Ledbetter M, Brady WA, Pezzutto A, Richter G, Magaletti D, Buckwalter S, Ledbetter JA, Clark EA. 2000. Characterization of human inducible costimulator ligand expression and function. J Immunol 164:4689–4696. doi: 10.4049/jimmunol.164.9.4689. [DOI] [PubMed] [Google Scholar]
  • 111.van der Sluis RM, van Montfort T, Pollakis G, Sanders RW, Speijer D, Berkhout B, Jeeninga RE. 2013. Dendritic cell-induced activation of latent HIV-1 provirus in actively proliferating primary T lymphocytes. PLoS Pathog 9:e1003259. doi: 10.1371/journal.ppat.1003259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 112.Mobley JL, Ennis E, Shimizu Y. 1994. Differential activation-dependent regulation of integrin function in cultured human T-leukemic cell lines. Blood 83:1039–1050. [PubMed] [Google Scholar]
  • 113.Zhou C, Ji J, Shi M, Yang L, Yu Y, Liu B, Zhu Z, Zhang J. 2014. Suberoylanilide hydroxamic acid enhances the antitumor activity of oxaliplatin by reversing the oxaliplatin induced Src activation in gastric cancer cells. Mol Med Rep 10:2729–2735. doi: 10.3892/mmr.2014.2548. [DOI] [PubMed] [Google Scholar]
  • 114.Kai L, Samuel SK, Levenson AS. 2010. Resveratrol enhances p53 acetylation and apoptosis in prostate cancer by inhibiting MTA1/NuRD complex. Int J Cancer 126:1538–1548. doi: 10.1002/ijc.24928. [DOI] [PubMed] [Google Scholar]
  • 115.Agalioti T, Chen G, Thanos D. 2002. Deciphering the transcriptional histone acetylation code for a human gene. Cell 111:381–392. doi: 10.1016/S0092-8674(02)01077-2. [DOI] [PubMed] [Google Scholar]
  • 116.Mahmoudi T, Parra M, Vries RG, Kauder SE, Verrijzer CP, Ott M, Verdin E. 2006. The SWI/SNF chromatin-remodeling complex is a cofactor for Tat transactivation of the HIV promoter. J Biol Chem 281:19960–19968. doi: 10.1074/jbc.M603336200. [DOI] [PubMed] [Google Scholar]
  • 117.Van Lint C, Emiliani S, Ott M, Verdin E. 1996. Transcriptional activation and chromatin remodeling of the HIV-1 promoter in response to histone acetylation. EMBO J 15:1112–1120. [PMC free article] [PubMed] [Google Scholar]
  • 118.Shahbazian MD, Grunstein M. 2007. Functions of site-specific histone acetylation and deacetylation. Annu Rev Biochem 76:75–100. doi: 10.1146/annurev.biochem.76.052705.162114. [DOI] [PubMed] [Google Scholar]
  • 119.Kim YK, Mbonye U, Hokello J, Karn J. 2011. T-cell receptor signaling enhances transcriptional elongation from latent HIV proviruses by activating P-TEFb through an ERK-dependent pathway. J Mol Biol 410:896–916. doi: 10.1016/j.jmb.2011.03.054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 120.Takada Y, Aggarwal BB. 2004. TNF activates Syk protein tyrosine kinase leading to TNF-induced MAPK activation, NF-kappaB activation, and apoptosis. J Immunol 173:1066–1077. doi: 10.4049/jimmunol.173.2.1066. [DOI] [PubMed] [Google Scholar]
  • 121.Mocsai A, Ruland J, Tybulewicz VL. 2010. The SYK tyrosine kinase: a crucial player in diverse biological functions. Nat Rev Immunol 10:387–402. doi: 10.1038/nri2765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 122.Chauhan AK, Moore TL. 2012. Immune complexes and late complement proteins trigger activation of Syk tyrosine kinase in human CD4(+) T cells. Clin Exp Immunol 167:235–245. doi: 10.1111/j.1365-2249.2011.04505.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 123.Grammatikos AP, Ghosh D, Devlin A, Kyttaris VC, Tsokos GC. 2013. Spleen tyrosine kinase (Syk) regulates systemic lupus erythematosus (SLE) T cell signaling. PLoS One 8:e74550. doi: 10.1371/journal.pone.0074550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 124.Fujinaga K, Barboric M, Li Q, Luo Z, Price DH, Peterlin BM. 2012. PKC phosphorylates HEXIM1 and regulates P-TEFb activity. Nucleic Acids Res 40:9160–9170. doi: 10.1093/nar/gks682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 125.Kawai T, Akira S. 2010. The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat Immunol 11:373–384. doi: 10.1038/ni.1863. [DOI] [PubMed] [Google Scholar]
  • 126.Law CL, Sidorenko SP, Chandran KA, Zhao Z, Shen SH, Fischer EH, Clark EA. 1996. CD22 associates with protein tyrosine phosphatase 1C, Syk, and phospholipase C-gamma(1) upon B cell activation. J Exp Med 183:547–560. doi: 10.1084/jem.183.2.547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 127.Jiang Y, Cheng H. 2007. Evidence of LAT as a dual substrate for Lck and Syk in T lymphocytes. Leuk Res 31:541–545. doi: 10.1016/j.leukres.2006.07.010. [DOI] [PubMed] [Google Scholar]
  • 128.Fromentin R, Bakeman W, Lawani MB, Khoury G, Hartogensis W, DaFonseca S, Killian M, Epling L, Hoh R, Sinclair E, Hecht FM, Bacchetti P, Deeks SG, Lewin SR, Sekaly RP, Chomont N. 2016. CD4+ T cells expressing PD-1, TIGIT and LAG-3 contribute to HIV persistence during ART. PLoS Pathog 12:e1005761. doi: 10.1371/journal.ppat.1005761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 129.Vignali DA. 2000. Multiplexed particle-based flow cytometric assays. J Immunol Methods 243:243–255. doi: 10.1016/S0022-1759(00)00238-6. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES