Skip to main content
Toxicological Sciences logoLink to Toxicological Sciences
. 2016 Nov 11;155(2):474–484. doi: 10.1093/toxsci/kfw226

Editor’s Highlight: CCR2 Regulates Inflammatory Cell Accumulation in the Lung and Tissue Injury following Ozone Exposure

Mary Francis *, Angela M Groves *, Richard Sun *, Jessica A Cervelli *, Hyejeong Choi *, Jeffrey D Laskin †, Debra L Laskin *,1
PMCID: PMC5291213  PMID: 27837169

Abstract

Ozone-induced lung injury is associated with an accumulation of activated macrophages in the lung. Chemokine receptor CCR2 mediates the migration of inflammatory monocytes/macrophages to sites of tissue injury. It is also required for monocyte egress from the bone marrow. In the present studies, we analyzed the role of CCR2 in inflammatory cell trafficking to the lung in response to ozone. Treatment of mice with ozone (0.8 ppm, 3 h) resulted in increases in proinflammatory CCR2+ macrophages in the lung at 24 h, as well as proinflammatory CD11b + Ly6CHi and iNOS+ macrophages at 24 and 48 h. Mannose receptor+ anti-inflammatory macrophages were also observed in the lung 24 and 48 h post-ozone. Loss of CCR2 was associated with reduced numbers of proinflammatory macrophages in the lung and decreased expression of the proinflammatory cytokines, IL-1β and TNFα. Decreases in anti-inflammatory CD11b + Ly6CLo macrophages were also observed in lungs of CCR2−/− mice treated with ozone, whereas mannose receptor+ macrophage accumulation was delayed; conversely, CX3CL1 and CX3CR1 were upregulated. Changes in lung macrophage subpopulations and inflammatory gene expression in CCR2−/− mice were correlated with reduced ozone toxicity and oxidative stress, as measured by decreases in bronchoalveolar lavage protein content and reduced lung expression of heme-oxygenase-1, 4-hydroxynonenal and cytochrome b5. These data demonstrate that CCR2 plays a role in both pro- and anti-inflammatory macrophage accumulation in the lung following ozone exposure. The fact that ozone-induced lung injury and oxidative stress are reduced in CCR2−/− mice suggests more prominent effects on proinflammatory macrophages.

Keywords: ozone, inflammatory macrophages, CCR2, lung injury, oxidative stress.


Ozone is a ubiquitous urban air pollutant and a major public health concern, especially in the elderly and in individuals with existing lung disease (Ciencewicki et al., 2008; Uysal and Schapira, 2003). Ozone causes oxidation of membrane lipids and proteins resulting in damage to the respiratory epithelium and the alveolar epithelial layer (Mudway and Kelly, 2000; Pryor and Church, 1991). This is associated with an accumulation of inflammatory macrophages in the lung, which have been implicated in the pathogenesis of ozone toxicity (Hollingsworth et al., 2007; Laskin et al., 2011). Macrophage trafficking to sites of tissue injury depends on chemokines released at these sites and chemokine receptors present on responding cells (Duque and Descoteaux, 2014; Melgarejo et al., 2009). One of the most potent chemokines identified for monocytes and macrophages is macrophage chemotactic protein (MCP)-1 or CCL2, which acts by binding to the chemokine receptor, CCR2, present on responding cells. CCL2 levels have been shown to be elevated in lungs of rodents after exposure to pulmonary irritants including ozone, nitrogen dioxide, silica, bleomycin, and diesel exhaust, a response correlated with a macrophage-rich pulmonary inflammatory response (Johnston et al., 2000; Liang et al., 2012; Provoost et al., 2012; Rose et al., 2003; Williams et al., 2007). Moreover, mice genetically deficient in CCR2 or treated with a CCR2 antagonist, exhibit significantly reduced recruitment of macrophages to the lung in a number of experimental disease models (Han et al., 2015; Lin et al., 2008, 2011; Okuma et al., 2004; Osterholzer et al., 2013; Provoost et al., 2012; Shen et al., 2011; Yang et al., 2010). The CCL2/CCR2 signaling pathway has also been implicated in inflammation-driven lung diseases in humans including asthma, idiopathic pulmonary fibrosis, chronic obstructive pulmonary disease, acute respiratory distress syndrome, and bronchiolitis obliterans (Barnes, 2008; Belperio et al., 2001; Moore et al., 2001, 2013; Yadav et al., 2010).

In the present studies, we analyzed the role of CCR2 in macrophage trafficking to the lung from the bone marrow in response to ozone-induced injury. Our findings that inflammatory macrophage accumulation in the lung is blunted in mice lacking CCR2, and that this is correlated with reduced injury and oxidative stress provide novel insights into inflammatory mechanisms contributing to tissue injury induced by ozone. These data may be useful in the development of new strategies for reducing lung injury induced by air pollutants, and potentially for other inflammatory lung diseases.

MATERIALS AND METHODS

Animals and exposures

Female specific pathogen-free C57BL6/J wild type (WT) and B6.129S4-Ccr2tm1lfc/J (CCR2−/−) mice (8–11 weeks; 17–22 g) were obtained from The Jackson Laboratories (Bar Harbor, Maine). Animals were housed in filter-top microisolation cages and maintained on food and water ad libitum. Animals received humane care in compliance with the institution’s guidelines, as outlined in the Guide for the Care and Use of Laboratory Animals, published by the National Institutes of Health. All animal protocols were approved by the Rutgers University Institutional Animal Care and Use Committee. Animals were exposed to air or to ozone (0.8 ppm) for 3 h in a whole body Plexiglas chamber. Ozone was generated from oxygen gas via an ultraviolet light generator (Gilmont Instruments, Barrington, Illinois) and mixed with air. The ozone concentration inside the chamber was continuously monitored using a Photometric ozone analyzer (Teledyne Instruments, Thousand Oaks, California). Over the course of the 3 h ozone exposure period, the average ozone concentration was 0.8 ppm, temperature, 23°C, and humidity 42%. Animals were euthanized 24–72 h after exposure by intraperitoneal injection of pentobarbital (200 mg/kg).

Bronchoalveolar lavage collection and analysis

Bronchoalveolar lavage (BAL) was collected by slowly instilling and withdrawing 1 ml of PBS into the lung 3 times through a cannula in the trachea. BAL fluid was centrifuged (300 × g, 8 min), supernatants collected, aliquoted, and stored at −80 °C until analysis. The lung was then removed and instilled 5 times with 1 ml PBS while gently massaging the tissue. Lavage fluid was centrifuged (400 × g, 6 min, 4 °C), the cell pellet resuspended in 1 ml of PBS and combined with the first BAL lavage cell suspension. Cells were washed twice with PBS, resuspended in 200 μl of staining buffer (PBS containing 2% FCS and 0.02% sodium azide), and viable cells enumerated using a hemocytometer with trypan blue dye exclusion. Total protein was quantified in cell-free BAL fluid using a BCA Protein Assay kit (Pierce Biotechnologies Inc., Rockford, Illinois) with bovine serum albumin as the standard. Samples from 8 mice per treatment group were analyzed in triplicate at 560 nm on a Vmax MAXline microplate reader (Molecular Devices, Sunnyvale, California).

Preparation of blood and bone marrow cells

Blood was collected from the inferior vena cava and red cells lysed in buffer (7.5% NH4Cl, 200 mM TrisHCl, pH 7.2). Bone marrow cells were harvested by flushing the femurs with 10–20 ml of ice cold PBS using a 20 G needle; cells were then repeatedly aspirated with a pipet to disrupt clumps and centrifuged (400 × g, 6 min, 4 °C). Blood cells and bone marrow cells were washed twice in PBS and viable cells enumerated as described above.

Flow cytometric analysis

Cells were incubated for 10 min at 4 °C with anti-mouse CD16/32 (1:200, clone 93; Biolegend, San Diego, California) to block non-specific binding and then with FITC-conjugated anti-mouse CD11b (1:200, clone M1/70; Biolegend), PE-conjugated anti-mouse Ly6C (1:200, clone HK1.4; Biolegend), PE/Cy7-conjugated anti-mouse F4/80 (1:200, clone BM8; Biolegend), AF700-conjugated anti-mouse CD11c (1:200, clone N418; Biolegend), and AF647-conjugated anti-mouse Ly6G (1:200, clone 1A8; Biolegend) antibodies or appropriate isotypic controls for 30 min at 4 °C followed by incubation with eFluor 780-conjugated fixable viability dye for 30 min at 4 °C (1:1000, eBioscience, San Diego, California). In some experiments, blood and bone marrow cells were incubated with AF647-conjugated anti-mouse CCR2 (1:100, clone SA203G11; Biolegend), followed by eFluor 780-conjugated fixable viability dye. Cells were then analyzed on a Gallios flow cytometer (Beckman Coulter, Brea, California). Data were analyzed using Beckman Coulter Kaluza version 1.2 software. Viable cells were initially analyzed for expression of CD11b, followed sequentially by Ly6G, Ly6C, F4/80, and CD11c. Inflammatory cell subpopulations were identified as described previously (Sunil et al., 2015).

Immunohistochemistry

A separate group of animals (n = 3 mice/treatment group) was used for this analysis. The lung was fixed in situ via the trachea with PBS containing 3% paraformaldehyde and 2% sucrose solution. After overnight incubation at 4 °C, the tissue was washed 3 times in PBS/2% sucrose, transferred to 50% ethanol, and then embedded in paraffin. Tissue sections (5 μm) were deparaffinized with xylene (4 min, ×2) followed by decreasing concentrations of ethanol (100%–50%) and then, water. Following antigen retrieval using citrate buffer (10.2 mM sodium citrate, pH 6.0) and quenching of endogenous peroxidase with 3% H2O2 for 10 min, sections were incubated for 2 h at room temperature (RT) with 10%–100% normal goat or rabbit serum to block non-specific binding. This was followed by overnight incubation at 4 °C with rabbit antibody to inducible nitric oxide synthase (iNOS, 1:1000; Abcam), mannose receptor-1 (1:1500; Abcam), ADAM17/TACE (1:50; R&D Systems, Minneapolis, Minnesota), cytochrome b5 (Cypb5, 1:250; Abcam, Cambridge, Massachusetts) or heme oxygenase-1 (HO-1, 1:500; Enzo Life Sciences, Farmingdale, New York), or with goat anti-4-hydroxynoneal (4-HNE, 1:100; Abcam) antibody, or appropriate IgG controls (ProSci, Poway, California). Sections were then incubated with biotinylated secondary antibody (Vector Labs, Burlingame, California) for 30 min at RT. Binding was visualized using a Peroxidase Substrate Kit DAB (Vector Labs). At least 5 random lung sections from each animal were analyzed.

Immunofluorescence

Lungs were inflated with OCT medium (ThermoFisher Scientific, Wilmington, Delaware) containing 30% sucrose, and then snap frozen in liquid nitrogen-cooled isopentane and embedded. Tissue sections (6 μm) were fixed in 90% acetone/10% methanol and air dried. After blocking with 10% bovine serum albumin (Sigma-Aldrich, St. Louis, Missouri), sections were stained with AF647-conjugated anti-mouse CCR2 (1:100, clone SA203G11; Biolegend, San Diego, California). Images were acquired using a Leica TCS SP5 confocal microscope (Leica Microsystems, Wetzlar, Germany). Identical laser power, gain, and offset settings were used for all analyses. The number of CCR2+ macrophages was quantified microscopically in 3 randomly selected fields from 3 mice/treatment group; magnification 630×).

Real-time PCR

Total RNA was isolated from the lung using an RNeasy kit (Qiagen, Valencia, California). RNA purity and concentration were measured using a NanoDrop spectrophotometer (ThermoFisher Scientific). RNA was converted into cDNA using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, California). Standard curves were generated using serial dilutions from pooled randomly selected cDNA samples. Real-time PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems) on a ABI Prism 7900HT Sequence Detection System (Applied Biosystems). All PCR primer pairs were generated using Primer Express 2.0 (Applied Biosystems) and synthesized by Integrated DNA Technologies (Coralville, Iowa). Gene expression changes were normalized to GAPDH. Forward and reverse primer sequences used were: TNFα, AGGGATGAGAAGTTCCCAAATG and TGTGAGGGTCTGGGCCATA; IL-1β, AGTTGACGGACCCCAAAAGAT and GGACAGCCCAGGTCAAAGG; iNOS, GGCAGCCTGTGAGACCTTTG and TGAAGCGTTTCGGGATCTG; CX3CR1, TCGGTCTGGTGGGAAATCTG and GGCTTCCGGCTGTTGGT; CX3CL1, GCACAGGATGCAGGGCTTAC and TGTCAGCCGCCTCAAAACT; NUR77, TCTGCTCAGGCCTGGTACTACA and ATGTTGTCAATCCAATCACCAAAG; GAPDH, TGAAGCAGGCATCTGAGGG and CGAAGGTGGAAGAGTGGGAG.

Statistical analysis

Data were analyzed using 2-way ANOVA, followed by Tukey’s post-hoc analysis. A P value of ≤.05 was considered statistically significant.

RESULTS

In initial studies, we evaluated the effects of ozone on the accumulation of CCR2+ cells in the lung by confocal microscopy. Relatively low numbers of CCR2+ cells were noted in lungs of air exposed WT mice (Figure 1). Treatment of mice with ozone resulted in an increase in CCR2+ cells in the lung, a response which peaked 24 h post-exposure. Increased numbers of CCR2+ monocytes were also observed in the blood 24 h postozone, with no effect on bone marrow monocytes at any postexposure time examined (Figure 2).

FIG. 1.

FIG. 1

Effects of ozone on CCR2+ cells in the lung. Sections, prepared 24–72 h after exposure of WT mice to ozone or to air, were stained with AF647-conjugated anti-mouse CCR2 antibody. CCR2+ cells in randomly selected fields from 3 mice/treatment group were enumerated microscopically at 630×. Bars, mean ± SE (n = 3 mice/treatment). aSignificantly different (P <0.05) from air exposed animals.

FIG. 2.

FIG. 2

Effects of ozone on blood and bone marrow monocyte CCR2 expression. Cells, collected 24–72 h after exposure of WT mice to ozone or to air, were immunostained with antibodies to CCR2 and analyzed by flow cytometry as described in the “Materials and Methods” section. Representative histograms from 3 to 4 mice/treatment group are shown.

Next we used CCR2−/− mice to assess the role of CCR2 in inflammatory cell trafficking from the bone marrow to the lung in response to ozone-induced injury. Loss of CCR2 was associated with a significant reduction in CD11b+ inflammatory cells in the lung at all times following ozone exposure (Table 1). To determine if this was specific for inflammatory cell subpopulations, we analyzed expression of Ly6G, Ly6C, F4/80, and CD11c on CD11b+ cells (Sunil et al., 2015). Mature (F4/80 + CD11c+) infiltrating macrophages (CD11b + Ly6G-) were identified as Ly6CHi proinflammatory or Ly6CLo anti-inflammatory (Figures 3 and 4). Treatment of mice with ozone resulted in an increase in the percentage of Ly6CHi proinflammatory macrophages in the lungs of WT mice, most notably at 24 h; these cells were significantly reduced in CCR2−/− mice (Figure 4). We also noted that the percentage of Ly6CLo anti-inflammatory macrophages was significantly greater in lungs of air-exposed CCR2−/− mice, than in lungs of WT mice; these cells were also reduced after ozone exposure (Figure 4).

TABLE 1.

Effects of Loss of CCR2 on Ozone-Induced Increases in CD11b+ Myeloid Cells in the Lung

% CD11b+ Cells
WT CCR2−/−
Air 1.6 ± 0.3 0.5 ± 0.1
24 h 4.7 ± 1.0 1.4 ± 0.3b
48 h 11.2 ± 1.3a 1.0 ± 0.1b
72 h 5.1 ± 1.4 1.5 ± 0.2b

BAL cells, collected 24–72 h after exposure of WT and CCR2–/– mice to ozone or to air, were immunostained with antibodies to CD11b and analyzed by flow cytometry as described in the Materials and Methods. Values are the mean ± S.E (n=10 mice/treatment group).

aSignificantly different (P<0.05) from air.

bSignificantly different (P<0.05) from WT.

FIG. 3.

FIG. 3

Effects of loss of CCR2 on ozone-induced increases in CD11b+ infiltrating macrophages in the lung. BAL cells, collected 24–72 h after exposure of WT and CCR2−/− mice to ozone or to air, were stained with antibodies to CD11b, Ly6G, Ly6C, and F4/80, CD11c or isotypic controls, and analyzed by flow cytometry as described in the “Materials and Methods” section. Representative dot plots from 10 mice/treatment group are shown. The percentage positive cells in each quadrant are indicated.

FIG. 4.

FIG. 4

Effects of loss of CCR2 on lung macrophage subpopulations responding to ozone. BAL cells, collected 24–72 h after exposure of WT and CCR2−/− mice to ozone or to air, were stained with antibodies to CD11b, Ly6G, Ly6C, and F4/80 or isotypic controls, and analyzed by flow cytometry. Bars, mean ± SE (n = 10 mice/treatment). aSignificantly different (P <0.05) from air-exposed animals; bSignificantly different (P < 0.05) from WT. ND, not detected.

Ozone-induced increases in proinflammatory Ly6CHi macrophages in the lung were correlated with increased numbers of proinflammatory iNOS+ macrophages in histological sections, and with upregulation of iNOS gene expression at 24 h and 48 h post-exposure (Figures 5 and 6, Table 2 and Supplementary Figure 1). Loss of CCR2 significantly blunted these responses. Following ozone exposure, mannose receptor+ anti-inflammatory macrophages also increased in the lung within 24 h (Figure 7 and Table 2; Supplementary Figure 2); this response was delayed in CCR2−/− mice. The effects of loss of CCR2 on ozone-induced inflammatory gene expression was also analyzed. In WT mice, the proinflammatory cytokines, TNFα and IL-1β were upregulated in the lung 24 h post-ozone. Loss of CCR2 significantly reduced the response to ozone at 24 h postexposure (Figure 6). In contrast, IL-1β expression was greater in CCR2−/− mice, when compared with WT mice at 72 h postexposure; IL-1β was also greater in air exposed CCR2−/− mice. In WT mice, expression of the proresolution transcription factor NUR77 was upregulated in the lung 24 h and 48 h postozone. NUR77 expression was significantly greater in air-exposed CCR2−/− mice, when compared with WT mice. Exposure of CCR2−/− mice to ozone resulted in decreased NUR77 expression. At 72 h postozone, NUR77 expression was increased in CCR2−/− mice relative to WT mice. CX3CL1 and CX3CR1 are involved in anti-inflammatory monocyte/macrophage trafficking. In CCR2−/− mice, but not WT mice, ozone caused a significant increase in expression of CX3CR1 at 24 and 48 h post-exposure and in CX3CL1 at 24, 48 and 72 h postexposure. CX3CL1 was also significantly increased in air-exposed CCR2−/− mice relative to WT mice. Expression of ADAM17, a protein important in CX3CL1 release (Garton et al., 2001), was upregulated in lungs of WT mice 24 h following ozone exposure (Figure 8 and Table 2; Supplementary Figure 3); in air-exposed CCR2−/− mice, ADAM17 was constitutively upregulated, however, ozone had no significant effect on its expression.

FIG. 5.

FIG. 5

Effects of loss of CCR2 on ozone-induced iNOS expression. Lung sections, prepared 24–72 h after exposure of WT and CCR2−/− mice to ozone or to air, were stained with antibody to iNOS. Binding was visualized using a peroxidase DAB substrate kit. Arrows indicate lung macrophages. Representative sections from 3 mice/treatment group are shown. Original magnification, 600×.

FIG. 6.

FIG. 6

Effects of CCR2 on ozone-induced gene expression. Lungs, collected 24–72 h after exposure of WT and CCR2−/− mice to ozone or to air, were analyzed by real-time PCR. Data were normalized to GAPDH. Bars, mean ± SE (n = 3 mice/treatment). aSignificantly different (P <0.05) from air-exposed animals; bSignificantly different (P < 0.05) from WT.

TABLE 2.

Semiquantitative Analysis of Immunohistochemistry

Time Post-ozone Exposure (h)
Air 24 48 72
WT mice
 iNOS % 0.0 ± 0.0 30 ± 3.2a 19.7 ± 3.3a 1.3 ± 0.3
Intensity 0.0 ± 0.0 2.2 ± 0.7a 1.5 ± 0.8 0.0 ± 0.0
 Mannose receptor % 0.0 ± 0.0 34.0 ± 4.9a 20.0 ± 2.1 12.0 ± 3.5
Intensity 0.0 ± 0.0 2.7 ± 0.8a 2.5 ± 0.8a 2.2 ± 0.2a
 ADAM17 % 6.3 ± 1.9 52.3 ± 4.3a 26.3 ± 0.9 12.3 ± 1.5
Intensity 0.2 ± 0.2 2.8 ± 1.0a 1.7 ± 0.1 1.3 ± 0.2
 Cypb5 % 0.0 ± 0.0 26.0 ± 6.7 92.3 ± 5.8a 1.3 ± 0.3
Intensity 0.0 ± 0.0 2.3 ± 0.8a 3.0 ± 0.8a 0.0 ± 0.0
 4-HNE % 0.0 ± 0.0 92.7 ± 6.4a 15.7 ± 2.3 6.3 ± 0.9
Intensity 0.0 ± 0.0 2.8 ± 0.5a 1.3 ± 0.1 1.5 ± 0.2
 HO-1 % 0.0 ± 0.0 33.0 ± 8.0 16.7 ± 4.4 18.3 ± 4.4
Intensity 0.0 ± 0.0 2.0 ± 0.7a 1.7 ± 0.7a 1.7 ± 0.0a
CCR2−/− mice
 iNOS % 0.0 ± 0.0 1.3 ± 0.9 3.0 ± 1.0 0.0 ± 0.0
Intensity 0.0 ± 0.0 0.0 ± 0.0b 0.8 ± 0.0b 0.0 ± 0.0
 Mannose receptor % 0.0 ± 0.0 1.3 ± 0.3 30.7 ± 3.5 25.3 ± 2.6
Intensity 0.0 ± 0.0 0.0 ± 0.0b 2.8 ± 0.2a 2.8 ± 0.0a
 ADAM17 % 50.7 ± 13.5b 27.0 ± 6.2 22.0 ± 3.1 40.0 ± 16.0
Intensity 2.0 ± 0.3b 1.8 ± 0.3 2.0 ± 0.2 2.7 ± 0.2
 Cypb5 % 0.0 ± 0.0 7.7 ± 1.5 7.7 ± 2.6b 0.0 ± 0.0
Intensity 0.0 ± 0.0 1.0 ± 0.5 1.3 ± 0.4a,b 0.0 ± 0.0
 4-HNE % 0.0 ± 0.0 0.0 ± 0.0b 0.0 ± 0.0 0.0 ± 0.0
Intensity 0.0 ± 0.0 0.0 ± 0.0b 0.0 ± 0.0 0.0 ± 0.0
 HO-1 % 9.7 ± 2.0 10.3 ± 3.5 11.3 ± 4.2 10.3 ± 0.9
Intensity 0.7 ± 0.2b 0.5 ± 0.2b 0.7 ± 0.2 0.8 ± 0.0

Values are means ± SE, n=3 mice. Lung sections, prepared 24–72 h after exposure of wild type (WT) and CCR2–/– mice to ozone or to air, were immunostained with antibodies to iNOS, mannose receptor, ADAM17, Cypb5, 4-HNE, or HO-1. Binding was visualized using a Vectastain kit. The percentage (%) of macrophages positively staining for each of the antibodies was calculated relative to 100 macrophages present from at least 5 sections/mouse (n=3 mice/treatment group; magnification x400). Data were analyzed by a two-way ANOVA. Positively stained cells were assigned a staining intensity score on a scale of 0=no staining, 1=light staining, 2=medium staining, 3=dark staining. Staining intensity data were analyzed by Kruskal-Wallis nonparametric one-way ANOVA followed by Mann-Whitney rank sum post hoc test.

aSignificantly different (P<0.05) from air.

bSignificantly different (P<0.05) from WT.

FIG. 7.

FIG. 7

Effects of loss of CCR2 on ozone-induced mannose receptor expression. Lung sections, prepared 24–72 h after exposure of WT and CCR2−/− mice to ozone or to air, were stained with antibody to mannose receptor. Binding was visualized using a peroxidase DAB substrate kit. Arrows indicate alveolar macrophages. Representative sections from 3 mice/treatment group are shown. Original magnification, 600×.

FIG. 8.

FIG. 8

Effects of loss of CCR2 on ozone-induced expression of ADAM17. Lung sections, prepared 24–72 h after exposure of WT and CCR2−/− mice to ozone or to air, were stained with antibody to ADAM17. Binding was visualized using a peroxidase DAB substrate kit. Representative sections from 3 mice/treatment group are shown. Original magnification, 600×.

In further studies, we determined if changes in inflammatory cell subpopulations in the lungs of CCR2−/− mice were associated with alterations in ozone-induced injury and oxidative stress. Treatment of WT mice with ozone resulted in a significant increase in BAL protein content, a marker of alveolar epithelial injury (Bhalla, 1999) (Figure 9). This was blunted in CCR2−/− mice at 48 h post-exposure. Similarly, ozone-induced increases in the oxidative stress marker, Cypb5 (Menoret et al., 2012), and the lipid peroxidation end product, 4-HNE (Kirichenko et al., 1996), were reduced in lungs of CCR2−/− mice, when compared with WT mice (Figures 10 and 11 and Table 2; Supplementary Figure 4). Additionally, ozone-induced upregulation of the antioxidant, HO-1 was attenuated in lungs of CCR2−/− mice at 24 and 48 h post-exposure (Figure 12 and Table 2; Supplementary Figure 4).

FIG. 9.

FIG. 9

Effects of loss of CCR2 on ozone-induced alterations in BAL protein. BAL was collected 24–72 h after exposure of WT and CCR2−/− mice to ozone or to air. Cell-free supernatants were analyzed in triplicate for protein using a BCA protein assay kit. Bars, mean ± SE (n = 10 mice/treatment group). aSignificantly different (P <0.05) from air-exposed animals; bSignificantly different (P < 0.05) from WT.

FIG. 10.

FIG. 10

Effects of loss of CCR2 on ozone-induced expression of cytochrome b5. Lung sections, prepared 24–72 h after exposure of WT and CCR2−/− mice to ozone or to air, were stained with antibody to cytochrome b5. Binding was visualized using a peroxidase DAB substrate kit. Representative sections from 3 mice/treatment group are shown. Original magnification, 600×.

FIG. 11.

FIG. 11

Effects of loss of CCR2 on ozone-induced expression of 4-HNE. Lung sections, prepared 24–72 h after exposure of WT and CCR2−/− mice to ozone or to air, were stained with antibody to 4-HNE. Binding was visualized using a peroxidase DAB substrate kit. Representative sections from 3 mice/treatment group are shown. Original magnification, 600×.

FIG. 12.

FIG. 12

Effects of loss of CCR2 on ozone-induced expression of HO-1. Lung sections, prepared 24–72 h after exposure of WT and CCR2−/− mice to ozone or to air, were stained with antibody to HO-1. Binding was visualized using a peroxidase DAB substrate kit. Representative sections from 3 mice/treatment group are shown. Original magnification, 600×.

DISCUSSION

Inflammatory macrophages have been implicated in tissue injury induced by diverse pulmonary toxicants including ozone (Hollingsworth et al., 2007; Laskin et al., 2011). Tissue injury is thought to be mediated by cytotoxic/proinflammatory mediators released from these cells (Italiani and Boraschi, 2014; Liu et al., 2014). The present studies demonstrate that CCR2 is important in trafficking of inflammatory macrophages to the lung after ozone exposure and that subpopulations of these cells promote oxidative stress and tissue injury. This is based on our findings that ozone-induced alveolar epithelial barrier dysfunction and expression of Cypb5, 4-HNE and HO-1 are reduced in mice lacking CCR2, responses associated with decreased numbers of proinflammatory/cytotoxic macrophages in the lung. These data provide new insights into mechanisms regulating macrophage localization in the lung after ozone exposure and their contribution to toxicity.

Treatment of mice with ozone resulted in increased numbers of CCR2+ macrophages in the lung. These findings are in accord with reports that CCL2, a major ligand for CCR2, is upregulated in the lung following ozone exposure (Johnston et al., 2000; Williams et al., 2007). Earlier studies demonstrated increased expression of CCR2 in the lung in experimental models of pulmonary injury induced by diesel exhaust particles and mustard vesicants (Provoost et al., 2012; Venosa et al., 2016), as well as in models of infection (Hohl et al., 2009; Lin et al., 2011; Yang et al., 2010) and fibrosis (Okuma et al., 2004). These data suggest that CCR2+ inflammatory macrophage accumulation in the lung may be a general response to injury and infection. We also found that the percentage of CCR2+ blood monocytes increased 24 h post-ozone exposure, consistent with the notion that these cells originate within the bone marrow (Jung et al., 2015). The fact that no changes were noted in CCR2+ monocytes in the bone marrow may be due to rapid replacement of these cells as they exit the tissue (Wang et al., 2009).

CCR2 has been shown to be required for inflammatory monocyte egress from the bone marrow and accumulation at sites of tissue injury (Serbina and Pamer, 2006; Tsou et al., 2007). We found that loss of CCR2 resulted in a significant reduction in CD11b+ infiltrating macrophages in the lung at all post-ozone exposure time points analyzed, demonstrating that these cells are derived from blood and bone marrow precursors. As previously reported (Sunil et al., 2015), CD11b+ cells responding to ozone were found to be comprised of subpopulations of mature (F4/80 + CD11c+) macrophages exhibiting a proinflammatory (Ly6CHi) or anti-inflammatory (Ly6CLo) phenotype. Following ozone exposure, proinflammatory Ly6CHi macrophages increased in the lung at 24 h, a time consistent with peak accumulation of CCR2+ macrophages in the tissue; this response was blunted in CCR2−/− mice. Proinflammatory Ly6CHi macrophages accumulating in the lung in response to infection have been shown to express CCR2 and to promote pulmonary injury (Chen et al., 2013; Lin et al., 2008). Our findings of a similar correlation between the presence of CCR2+ and Ly6CHi macrophages in the lung and ozone-induced tissue injury provide additional support for the cytotoxic/proinflammatory activity of these cells (Shi and Pamer, 2011).

Loss of CCR2 was also associated with reduced numbers of iNOS+ macrophages in the lung and down regulation of iNOS gene expression, indicating that these cells also traffic to the lung via the CCL2/CCR2 signaling pathway. As expression of iNOS is a characteristic feature of proinflammatory/cytotoxic macrophages (Laskin et al., 2011), we speculate that CCR2-dependent proinflammatory/cytotoxic macrophages that accumulate in the lung in response to ozone are both Ly6CHi and iNOS+. This is supported by previous studies demonstrating proinflammatory Ly6CHi macrophages express iNOS and release cytotoxic oxidants (Dragomir et al., 2012; Shi and Pamer, 2011). In macrophages, iNOS mediates the generation of nitric oxide from l-arginine. Nitric oxide is known to rapidly react with oxygen radicals generating additional highly reactive species, which are thought to be important in the ability of proinflammatory macrophages to promote tissue injury (Laskin et al., 2011). Previous studies have demonstrated that macrophage iNOS is key to ozone toxicity (Fakhrzadeh et al., 2002; Kleeberger et al., 2001). Thus, mice lacking iNOS were unable to generate reactive nitrogen species, a response correlated with reduced ozone toxicity. The present studies suggest that proinflammatory macrophages are primary contributors of iNOS-derived reactive nitrogen species during the pathogenesis of ozone-induced lung injury, and that these cells accumulate in the lung in a CCR2-dependent manner. A similar dependence of iNOS activity on CCR2 has previously been described in a model of non-infectious lung injury, as well as in a model of allergic contact dermatitis (Chong et al., 2014).

Decreases in proinflammatory macrophages in lungs of CCR2−/− mice in response to ozone were associated with a reduction in expression of the proinflammatory genes, IL-1β and TNFα. These findings are in accord with studies demonstrating that proinflammatory macrophages are a major source of these cytokines (Duque and Descoteaux, 2014; Herold et al., 2011). Similar decreases in TNFα and IL-1β have been reported in mice lacking CCR2 in experimental models of skin injury and lung injury (Chong et al., 2014; Tighe et al., 2011b). IL-1 and TNFα have been implicated in lung injury induced by diverse irritants including ozone (Cho et al., 2007; Michaudel et al., 2016). Protection against ozone-induced lung injury and oxidative stress in CCR2−/− mice may be due to decreased release of these proinflammatory mediators. This is supported by previous reports demonstrating that mice lacking TNFR1, the major proinflammatory receptor for TNFα, or NFκB, a transcription factor known to regulate IL-1 and TNFα production, are protected from ozone toxicity (Fakhrzadeh et al., 2004; Fakhrzadeh et al., 2008).

Further analysis of lung macrophage subpopulations revealed significantly greater numbers of mature CD11b + Ly6G−Ly6CLo anti-inflammatory macrophages in air-exposed CCR2−/− mice, when compared with WT mice, along with increased expression of NUR77, a nuclear transcription factor known to regulate macrophage anti-inflammatory/proresolution responses (McMorrow and Murphy, 2011). This may be due to a loss of Ly6CHi proinflammatory macrophages to counterbalance their activity (Laskin et al., 2011; Moore et al., 2013). As observed with Ly6CHi proinflammatory macrophages, in the absence of CCR2, reduced numbers of Ly6CLo anti-inflammatory macrophages were observed in the lung after ozone exposure; NUR77 expression was also down regulated after ozone exposure. These findings suggest that Ly6CLo anti-inflammatory macrophages are the main cell type expressing NUR77 in the lung after ozone, and that they are derived, at least in part, from blood and bone marrow precursors (Ginhoux and Jung, 2014). Alternatively, decreases in numbers of Ly6CLo anti-inflammatory macrophages in CCR2−/− mice treated with ozone may be a consequence of reduced numbers of proinflammatory macrophages available for phenotypic switching (Italiani and Boraschi, 2014; Wang et al., 2014). We also found that ozone-induced accumulation of mannose receptor+ anti-inflammatory macrophages was delayed in CCR2−/− mice relative to WT mice. These results are consistent with the idea that there are multiple subpopulations of anti-inflammatory/wound repair macrophages responding to ozone-induced tissue injury, and that mechanisms regulating their activity are distinct (Boorsma et al., 2013; Sunil et al., 2012; Tighe et al., 2011a). The delayed appearance of mannose receptor+ macrophages in the lung may reflect the time required for the generation of additional chemoattractants for these cells. This is supported by our findings that CX3CL1 and ADAM17, an enzyme important in CX3CL1 release (Garton et al., 2001), are increased in lungs of CCR2−/− mice following ozone exposure. CX3CR1 is a chemokine receptor expressed on anti-inflammatory monocytes/macrophages which is thought to be important in their maturation/development (Shi and Pamer, 2011; Yang et al., 2014). Upregulation of CX3CR1 in lungs of CCR2−/− mice following ozone exposure may represent an attempt to compensate for the loss of anti-inflammatory macrophages responding to ozone in the absence of CCR2. In this regard, Tighe et al. (2011a) identified a population of repair macrophages in the lung after ozone exposure that are dependent on CX3CR1, and that in their absence, oxidative stress is exacerbated. Although Ly6CLo macrophages were reduced in lungs of CCR2−/− after ozone exposure, they still outnumbered Ly6CHi macrophages. This suggests that tissue repair processes in CCR2−/− mice are more prominent, which is in accord with our findings that in the absence of CCR2, ozone toxicity and oxidative stress are reduced. These data provide support for the idea that the outcome of the pathogenic response to ozone depends on a balance between proinflammatory and anti-inflammatory macrophages (Laskin et al., 2011).

Ozone-induced oxidative stress, as measured by expression of 4-HNE, Cypb5, and HO-1, was markedly reduced in lungs of CCR2−/− mice, relative to WT mice, demonstrating a key contribution of CCR2-dependent inflammatory cells to the oxidative burden in the lung. However, whether this a consequence of macrophage generation of reactive oxygen species and lipid peroxidation end products is unknown. Findings in the present studies, and in previous reports (Hamilton et al., 1996; Kirichenko et al., 1996), that lung macrophages express 4-HNE following ozone exposure suggest a direct effect; however this remains to be determined. Previous studies have described a population of CX3CR1-dependent inflammatory macrophages in lungs of mice exposed to ozone that function to limit pathological responses to ozone, presumably because of their ability to scavenge oxidants and/or manage oxidant balance (Tighe et al., 2011a). Our results suggest that Ly6CLo and mannose receptor+ inflammatory macrophages also contribute to these activities in the lung after ozone exposure. It should be noted, however, that other factors may contribute to differences in the response of WT and CCR2−/− mice to ozone including inherent differences in levels of antioxidants, ventilation rates, and/or ozone deposition amounts. Further studies are required to explore these possibilities.

In summary, the present studies demonstrate a key role of CCR2 in regulating the accumulation of proinflammatory macrophages, as well as subpopulations of anti-inflammatory macrophages in the lung in response to ozone. The fact that ozone-induced injury and oxidative stress are reduced in CCR2−/− mice suggests a greater impact on the proinflammatory/cytotoxic macrophage subpopulation. Elucidating specific subpopulations of inflammatory cells responding to ozone and mechanisms regulating their trafficking and activity may lead to the development of more efficacious approaches for mitigating oxidant-induced pulmonary toxicity and disease pathogenesis.

SUPPLEMENTARY DATA

Supplementary data are available at Toxicological Sciences online.

FUNDING

National Institutes of Health (grant numbers ES004738, AR055073, ES007148, and ES005022).

Supplementary Material

Supplementary Data

REFERENCES

  1. Barnes P. J. (2008). Immunology of asthma and chronic obstructive pulmonary disease. Nat. Rev. Immunol. 8, 183–192. [DOI] [PubMed] [Google Scholar]
  2. Belperio J. A., Keane M. P., Burdick M. D., Lynch J. P., 3rd, Xue Y. Y., Berlin A., Ross D. J., Kunkel S. L., Charo I. F., Strieter R. M. (2001). Critical role for the chemokine MCP-1/CCR2 in the pathogenesis of bronchiolitis obliterans syndrome. J. Clin. Invest. 108, 547–556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bhalla D. K. (1999). Ozone-induced lung inflammation and mucosal barrier disruption:toxicology, mechanisms, and implications. J. Toxicol. Environ. Health B Crit. Rev. 2, 31–86. [DOI] [PubMed] [Google Scholar]
  4. Boorsma C. E., Draijer C., Melgert B. N. (2013). Macrophage heterogeneity in respiratory diseases. Mediators Inflamm. 2013, 769214.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen L., Zhang Z., Barletta K. E., Burdick M. D., Mehrad B. (2013). Heterogeneity of lung mononuclear phagocytes during pneumonia: contribution of chemokine receptors. Am. J. Physiol. Lung Cell Mol. Physiol. 305, L702–L711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cho H. Y., Morgan D. L., Bauer A. K., Kleeberger S. R. (2007). Signal transduction pathways of tumor necrosis factor-mediated lung injury induced by ozone in mice. Am. J.Respir. Crit. Care Med. 175, 829–839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chong S. Z., Tan K. W., Wong F. H., Chua Y. L., Tang Y., Ng L. G., Angeli V., Kemeny D. M. (2014). CD8 T cells regulate allergic contact dermatitis by modulating CCR2-dependent TNF/iNOS-expressing Ly6C+ CD11b+ monocytic cells. J. Invest. Dermatol. 134, 666–676. [DOI] [PubMed] [Google Scholar]
  8. Ciencewicki J., Trivedi S., Kleeberger S. R. (2008). Oxidants and the pathogenesis of lung diseases. J. Allergy Clin. Immunol. 122, 456–468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dragomir A. C., Sun R., Choi H., Laskin J. D., Laskin D. L. (2012). Role of galectin-3 in classical and alternative macrophage activation in the liver following acetaminophen intoxication. J. Immunol. 189, 5934–5941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Duque G., Descoteaux A. (2014). Macrophage cytokines: involvement in immunity and infectious diseases. Front. Immunol. 5, 491.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fakhrzadeh L., Laskin J. D., Laskin D. L. (2002). Deficiency in inducible nitric oxide synthase protects mice from ozone-induced lung inflammation and tissue injury. Am. J. Respir. Cell Mol. Biol. 26, 413–419. [DOI] [PubMed] [Google Scholar]
  12. Fakhrzadeh L., Laskin J. D., Laskin D. L. (2004). Ozone-induced production of nitric oxide and TNF-α and tissue injury are dependent on NF-κB p50. Am. J. Physiol. Lung Cell Mol. Physiol. 287, L279–L285. [DOI] [PubMed] [Google Scholar]
  13. Fakhrzadeh L., Laskin J. D., Laskin D. L. (2008). Regulation of caveolin-1 expression, nitric oxide production and tissue injury by tumor necrosis factor-α following ozone inhalation. Toxicol. Appl. Pharmacol. 227, 380–389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Garton K. J., Gough P. J., Blobel C. P., Murphy G., Greaves D. R., Dempsey P. J., Raines E. W. (2001). Tumor necrosis factor-alpha-converting enzyme (ADAM17) mediates the cleavage and shedding of fractalkine (CX3CL1). J. Biol. Chem. 276, 37993–38001. [DOI] [PubMed] [Google Scholar]
  15. Ginhoux F., Jung S. (2014). Monocytes and macrophages: developmental pathways and tissue homeostasis. Nat. Rev. Immunol. 14, 392–404. [DOI] [PubMed] [Google Scholar]
  16. Hamilton R. F., Jr, Hazbun M. E., Jumper C. A., Eschenbacher W. L., Holian A. (1996). 4-Hydroxynonenal mimics ozone-induced modulation of macrophage function ex vivo. Am. J. Respir. Cell Mol. Biol. 15, 275–282. [DOI] [PubMed] [Google Scholar]
  17. Han W., Zaynagetdinov R., Yull F. E., Polosukhin V. V., Gleaves L. A., Tanjore H., Young L. R., Peterson T. E., Manning H. C., Prince L. S., et al. (2015). Molecular imaging of folate receptor β-positive macrophages during acute lung inflammation. Am. J. Respir. Cell Mol. Biol. 53, 50–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Herold S., Mayer K., Lohmeyer J. (2011). Acute lung injury: how macrophages orchestrate resolution of inflammation and tissue repair. Front Immunol. 2, 65.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hohl T. M., Rivera A., Lipuma L., Gallegos A., Shi C., Mack M., Pamer E. G. (2009). Inflammatory monocytes facilitate adaptive CD4 T cell responses during respiratory fungal infection. Cell Host Microbe 6, 470–481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hollingsworth J. W., Kleeberger S. R., Foster W. M. (2007). Ozone and pulmonary innate immunity. Proc. Am. Thorac. Soc. 4, 240–246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Italiani P., Boraschi D. (2014). From monocytes to M1/M2 macrophages: phenotypical vs. functional differentiation. Front. Immunol. 5, 514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Johnston C. J., Reed C. K., Avissar N. E., Gelein R., Finkelstein J. N. (2000). Antioxidant and inflammatory response after acute nitrogen dioxide and ozone exposures in C57BL/6 mice. Inhal. Toxicol. 12, 187–203. [DOI] [PubMed] [Google Scholar]
  23. Jung H., Mithal D. S., Park J. E., Miller R. J. (2015). Localized CCR2 activation in the bone marrow niche mobilizes monocytes by desensitizing CXCR4. PLoS One 10, e0128387.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kirichenko A., Li L., Morandi M. T., Holian A. (1996). 4-hydroxy-2-nonenal-protein adducts and apoptosis in murine lung cells after acute ozone exposure. Toxicol. Appl. Pharmacol. 141, 416–424. [DOI] [PubMed] [Google Scholar]
  25. Kleeberger S. R., Reddy S. P., Zhang L. Y., Cho H. Y., Jedlicka A. E. (2001). Toll-like receptor 4 mediates ozone-induced murine lung hyperpermeability via inducible nitric oxide synthase. Am. J. Physiol. Lung Cell Mol. Physiol. 280, L326–L333. [DOI] [PubMed] [Google Scholar]
  26. Laskin D. L., Sunil V. R., Gardner C. R., Laskin J. D. (2011). Macrophages and tissue injury: agents of defense or destruction?. Annu. Rev. Pharmacol. Toxicol. 51, 267–288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Liang J., Jung Y., Tighe R. M., Xie T., Liu N., Leonard M., Gunn M. D., Jiang D., Noble P. W. (2012). A macrophage subpopulation recruited by CC chemokine ligand-2 clears apoptotic cells in noninfectious lung injury. Am. J. Physiol. Lung Cell Mol. Physiol. 302, L933–L940. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lin K. L., Suzuki Y., Nakano H., Ramsburg E., Gunn M. D. (2008). CCR2+ monocyte-derived dendritic cells and exudate macrophages produce influenza-induced pulmonary immune pathology and mortality. J. Immunol. 180, 2562–2572. [DOI] [PubMed] [Google Scholar]
  29. Lin K. L., Sweeney S., Kang B. D., Ramsburg E., Gunn M. D. (2011). CCR2-antagonist prophylaxis reduces pulmonary immune pathology and markedly improves survival during influenza infection. J. Immunol. 186, 508–515. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Liu Y. C., Zou X. B., Chai Y. F., Yao Y. M. (2014). Macrophage polarization in inflammatory diseases. Int. J. Biol. Sci. 10, 520–529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. McMorrow J. P., Murphy E. P. (2011). Inflammation: a role for NR4A orphan nuclear receptors? Biochem. Soc. Trans. 39, 688–693. [DOI] [PubMed] [Google Scholar]
  32. Melgarejo E., Medina M. A., Sanchez-Jimenez F., Urdiales J. L. (2009). Monocyte chemoattractant protein-1: a key mediator in inflammatory processes. Int. J. Biochem. Cell Biol. 41, 998–1001. [DOI] [PubMed] [Google Scholar]
  33. Menoret A., Kumar S., Vella A. T. (2012). Cytochrome b5 and cytokeratin 17 are biomarkers in bronchoalveolar fluid signifying onset of acute lung injury. PLoS One 7, e40184.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Michaudel C., Couturier-Maillard A., Chenuet P., Maillet I., Mura C., Couillin I., Gombault A., Quesniaux V. F., Huaux F., Ryffel B. (2016). Inflammasome, IL-1 and inflammation in ozone-induced lung injury. Am. J. Clin. Exp. Immunol. 5, 33–40. [PMC free article] [PubMed] [Google Scholar]
  35. Moore B. B., Paine R., 3rd, Christensen P. J., Moore T. A., Sitterding S., Ngan R., Wilke C. A., Kuziel W. A., Toews G. B. (2001). Protection from pulmonary fibrosis in the absence of CCR2 signaling. J. Immunol. 167, 4368–4377. [DOI] [PubMed] [Google Scholar]
  36. Moore K. J., Sheedy F. J., Fisher E. A. (2013). Macrophages in atherosclerosis: a dynamic balance. Nat. Rev. Immunol. 13, 709–721. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Mudway I. S., Kelly F. J. (2000). Ozone and the lung: a sensitive issue. Mol. Aspects Med. 21, 1–48. [DOI] [PubMed] [Google Scholar]
  38. Okuma T., Terasaki Y., Kaikita K., Kobayashi H., Kuziel W. A., Kawasuji M., Takeya M. (2004). C-C chemokine receptor 2 (CCR2) deficiency improves bleomycin-induced pulmonary fibrosis by attenuation of both macrophage infiltration and production of macrophage-derived matrix metalloproteinases. J. Pathol. 204, 594–604. [DOI] [PubMed] [Google Scholar]
  39. Osterholzer J. J., Olszewski M. A., Murdock B. J., Chen G. H., Erb-Downward J. R., Subbotina N., Browning K., Lin Y., Morey R. E., Dayrit J. K., et al. (2013). Implicating exudate macrophages and Ly-6Chigh monocytes in CCR2-dependent lung fibrosis following gene-targeted alveolar injury. J. Immunol. 190, 3447–3457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Provoost S., Maes T., Joos G. F., Tournoy K. G. (2012). Monocyte-derived dendritic cell recruitment and allergic TH2 responses after exposure to diesel particles are CCR2 dependent. J. Allergy Clin. Immunol. 129, 483–491. [DOI] [PubMed] [Google Scholar]
  41. Pryor W. A., Church D. F. (1991). Aldehydes, hydrogen peroxide, and organic radicals as mediators of ozone toxicity. Free Radic. Biol. Med. 11, 41–46. [DOI] [PubMed] [Google Scholar]
  42. Rose C. E., Jr., Sung S. S., Fu S. M. (2003). Significant involvement of CCL2 (MCP-1) in inflammatory disorders of the lung. Microcirculation 10, 273–288. [DOI] [PubMed] [Google Scholar]
  43. Serbina N. V., Pamer E. G. (2006). Monocyte emigration from bone marrow during bacterial infection requires signals mediated by chemokine receptor CCR2. Nat. Immunol. 7, 311–317. [DOI] [PubMed] [Google Scholar]
  44. Shen Y., Wang D., Wang X. (2011). Role of CCR2 and IL-8 in acute lung injury: a new mechanism and therapeutic target. Expert Rev. Respir. Med. 5, 107–114. [DOI] [PubMed] [Google Scholar]
  45. Shi C., Pamer E. G. (2011). Monocyte recruitment during infection and inflammation. Nat. Rev. Immunol. 11, 762–774. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Sunil V. R., Patel-Vayas K., Shen J., Laskin J. D., Laskin D. L. (2012). Classical and alternative macrophage activation in the lung following ozone-induced oxidative stress. Toxicol. Appl. Pharmacol. 263, 195–202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Sunil V. R., Francis M., Vayas K. N., Cervelli J. A., Choi H., Laskin J. D., Laskin D. L. (2015). Regulation of ozone-induced lung inflammation and injury by the β-galactoside-binding lectin galectin-3. Toxicol. Appl. Pharmacol. 284, 236–245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Tighe R. M., Li Z., Potts E. N., Frush S., Liu N., Gunn M. D., Foster W. M., Noble P. W., Hollingsworth J. W. (2011a). Ozone inhalation promotes CX3CR1-dependent maturation of resident lung macrophages that limit oxidative stress and inflammation. J. Immunol. 187, 4800–4808. [DOI] [PMC free article] [PubMed] [Google Scholar] [Research Misconduct Found]
  49. Tighe R. M., Liang J., Liu N., Jung Y., Jiang D., Gunn M. D., Noble P. W. (2011b). Recruited exudative macrophages selectively produce CXCL10 after noninfectious lung injury. Am. J. Respir. Cell Mol. Biol. 45, 781–788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Tsou C. L., Peters W., Si Y., Slaymaker S., Aslanian A. M., Weisberg S. P., Mack M., Charo I. F. (2007). Critical roles for CCR2 and MCP-3 in monocyte mobilization from bone marrow and recruitment to inflammatory sites. J. Clin. Invest. 117, 902–909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Uysal N., Schapira R. M. (2003). Effects of ozone on lung function and lung diseases. Curr. Opin. Pulm. Med. 9, 144–150. [DOI] [PubMed] [Google Scholar]
  52. Venosa A., Malaviya R., Choi H., Gow A. J., Laskin J. D., Laskin D. L. (2016). Characterization of distinct macrophage subpopulations during nitrogen mustard-induced lung injury and fibrosis. Am. J. Respir. Cell Mol. Biol. 54, 436–446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Wang N., Liang H., Zen K. (2014). Molecular mechanisms that influence the macrophage M1-M2 polarization balance. Front Immunol. 5, 614.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Wang Y., Cui L., Gonsiorek W., Min S. H., Anilkumar G., Rosenblum S., Kozlowski J., Lundell D., Fine J. S., Grant E. P. (2009). CCR2 and CXCR4 regulate peripheral blood monocyte pharmacodynamics and link to efficacy in experimental autoimmune encephalomyelitis. J. Inflamm. (Lond.) 6, 32.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Williams A. S., Issa R., Leung S. Y., Nath P., Ferguson G. D., Bennett B. L., Adcock I. M., Chung K. F. (2007). Attenuation of ozone-induced airway inflammation and hyper-responsiveness by c-Jun NH2 terminal kinase inhibitor SP600125. J. Pharmacol. Exp. Ther. 322, 351–359. [DOI] [PubMed] [Google Scholar]
  56. Yadav A., Saini V., Arora S. (2010). MCP-1: chemoattractant with a role beyond immunity: a review. Clin. Chim. Acta 411, 1570–1579. [DOI] [PubMed] [Google Scholar]
  57. Yang D., Tong L., Wang D., Wang Y., Wang X., Bai C. (2010). Roles of CC chemokine receptors (CCRs) on lipopolysaccharide-induced acute lung injury. Respir. Physiol. Neurobiol. 170, 253–259. [DOI] [PubMed] [Google Scholar]
  58. Yang J., Zhang L., Yu C., Yang X. F., Wang H. (2014). Monocyte and macrophage differentiation: circulation inflammatory monocyte as biomarker for inflammatory diseases. Biomark. Res. 2, 1.. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Data
kfw226_Supp.zip (1.3MB, zip)

Articles from Toxicological Sciences are provided here courtesy of Oxford University Press

RESOURCES