Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2018 Feb 7.
Published in final edited form as: Cell Metab. 2017 Jan 12;25(2):472–480. doi: 10.1016/j.cmet.2016.12.004

FGF21 is an Exocrine Pancreas Secretagogue

Katie C Coate 1,4,*, Genaro Hernandez 1,*, Curtis A Thorne 1, Shengyi Sun 1, Thao D V Le 1, Kevin Vale 1, Steven A Kliewer 1,2,†, David J Mangelsdorf 1,3,†
PMCID: PMC5299054  NIHMSID: NIHMS837612  PMID: 28089565

Summary

The metabolic stress hormone FGF21 is highly expressed in exocrine pancreas, where its levels are increased by refeeding and chemically-induced pancreatitis. However, its function in the exocrine pancreas remains unknown. Here, we show that FGF21 stimulates digestive enzyme secretion from pancreatic acinar cells through an autocrine/paracrine mechanism that requires signaling through a tyrosine kinase receptor complex composed of an FGF receptor and β-Klotho. Mice lacking FGF21 accumulate zymogen granules and are susceptible to pancreatic ER stress, an effect that is reversed by administration of recombinant FGF21. Mice carrying an acinar cell-specific deletion of β-Klotho also accumulate zymogen granules, but are refractory to FGF21-stimulated secretion. Like the classical post-prandial secretagogue, cholecystokinin (CCK), FGF21 triggers intracellular calcium release via PLC-IP3R signaling. However, unlike CCK, FGF21 does not induce protein synthesis, thereby preventing protein accumulation. Thus, pancreatic FGF21 is a digestive enzyme secretagogue whose physiologic function is to maintain acinar cell proteostasis.

Graphical Abstract

graphic file with name nihms837612u1.jpg

Introduction

The exocrine pancreas, which comprises >95% of the organ, consists of clusters of ductal structures as well as acinar cells that synthesize and secrete digestive enzymes in response to feeding (Logsdon and Ji, 2013). Secretion from the exocrine pancreas is regulated humorally by the prandial gut hormones, cholecystokinin (CCK) and secretin, and neurally by vagal stimulation. Since pancreatic acinar cells synthesize and secrete more protein than any other adult cell type (Case, 1978), they must have mechanisms to minimize protein misfolding and associated endoplasmic reticulum (ER) stress (Kubisch and Logsdon, 2008).

Fibroblast growth factor 21 (FGF21) is a hormone whose synthesis and secretion are triggered by diverse metabolic and cellular stresses, ranging from starvation to mitochondrial and ER stress (Owen et al., 2015). FGF21 acts through a cell surface receptor composed of a conventional FGF receptor (FGFR) with tyrosine kinase activity in complex with β-Klotho, a single-pass transmembrane protein. FGF21, β-Klotho and FGFRs are co-expressed in the murine pancreas, indicating that it is an FGF21 target tissue (Fon Tacer et al., 2010; Johnson et al., 2009). FGF21 is expressed at low levels in pancreatic islets, and FGF21 administration preserves β-cell function and mass in diabetic mice (Singhal et al., 2016; Wente et al., 2006). In vitro, FGF21 increases insulin secretion from diabetic rodent islets but has little or no effect on either insulin or glucagon secretion from healthy islets (Singhal et al., 2016; Xu et al., 2009).

Fgf21 mRNA is expressed at much higher levels in pancreatic acinar cells, where it is induced by feeding and suppressed by fasting (Adams et al., 2013; Johnson et al., 2009; Singhal et al., 2016). Fgf21 is also induced in isolated acinar cells after thapsigargin treatment, which induces ER stress (Johnson et al., 2009). Fgf21-knockout (KO) mice have a heightened susceptibility to pancreatic inflammation and injury caused by the potent cholecystokinin (CCK) analog cerulein (Johnson et al., 2009). Likewise, mice lacking the pancreatic transcription factor MIST1 are susceptible to pancreatitis due to silencing of the Fgf21 gene (Johnson et al., 2014). Conversely, FGF21 overexpression protects the pancreas against inflammation and injury in both cerulein-treated and MIST1-knockout mice (Johnson et al., 2014; Johnson et al., 2009).

While the protective effects of FGF21 in mouse models of pancreatitis are well established, its physiologic function in the exocrine pancreas has remained unclear. Here we show that FGF21 functions as an acinar cell secretagogue that alleviates ER stress.

Results and Discussion

FGF21 regulates pancreatic digestive enzyme levels in an autocrine/paracrine manner

We first examined the pancreatic phenotype of Fgf21-knockout (KO) mice. Histological analysis of H&E-stained pancreatic sections revealed significantly greater eosinophilic staining in Fgf21-KO pancreas from both fasted and fed mice, indicative of increased zymogen granule density (Figure S1A). In support of this observation, amylase and lipase levels were greater in Fgf21-KO pancreas during fasting and refeeding (Figures 1A and 1B, Figure S1B). Administration of exogenous FGF21 (1 mg/kg, b.i.d., subcutaneous injection, resulting in plasma levels of approximately 1400 ng/ml 1 hour after injection; Figure S1C) decreased the pancreatic eosinophilic staining in Fgf21-KO mice to wild type (WT) levels (Figure S1D). Immunofluorescence and immunoblot analysis confirmed a corresponding reduction in pancreatic digestive enzyme levels in Fgf21-KO mice following FGF21 treatment (Figures 1C and D, Figure S1E). In agreement with previous findings (Adams et al., 2013), FGF21 mRNA and protein levels were induced in the pancreas during refeeding (Figures 1E and 1F, Figure S1F). Notably, however, refeeding decreased FGF21 concentrations in plasma (Figure 1G). These data demonstrate that FGF21 is not secreted from the exocrine pancreas into the blood and are consistent with a previous study showing that the principal source of blood-borne FGF21 is the liver (Markan et al., 2014), where FGF21 is induced by fasting and repressed by feeding (Badman et al., 2007; Inagaki et al., 2007). The concentration of FGF21 in the pancreatic juice was approximately 250 ng/ml (Figure 1H), which is sufficient for FGF21 to activate its receptor complex (Kurosu et al., 2007; Ogawa et al., 2007). Treatment with CCK, which is known to markedly increase pancreatic enzyme synthesis (Williams and Blevins, 1993), further increased the concentration of FGF21 in the pancreatic juice without any change in the blood (Figure 1H). These results suggest FGF21 acts in an autocrine or paracrine manner to reduce pancreatic digestive enzyme levels.

Figure 1. Pancreatic FGF21 regulates digestive enzyme levels.

Figure 1

(A, B) Immunofluorescence for amylase (green) and nuclei (blue) (A) and western blot quantification of amylase and lipase levels (B) in wild type (WT) and Fgf21-knockout (KO) mice after an overnight fast and 2 hour refeeding period. Calibration bar indicates 20 μm.

(C, D) Immunofluorescence for amylase (green) and nuclei (blue) (C) and western blot quantification of amylase and lipase levels (D) in WT and Fgf21-KO mice treated with vehicle or 1 mg/kg recombinant FGF21 twice per day for two consecutive days. Calibration bar indicates 20 μm.

(E–G) Pancreatic FGF21 mRNA (E), pancreatic FGF21 protein (F) and plasma FGF21 (G) levels in WT mice after an overnight fast and 2 hour refeeding period.

(H) FGF21 protein levels in pancreatic juice and plasma before (Basal) or after 15 min CCK treatment of ad-lib fed WT mice.

Results are expressed as means ±S.E.M. n=3–6 mice/group for all experiments. *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001.

See also Figure S1.

FGF21 protects against cerulein-induced pancreatitis (CIP) (Johnson et al., 2009). However, the mechanism underlying this protective effect of FGF21 is not known. Based on our data and the previous finding that FGF21 expression is induced by ER stress (Jiang et al., 2014; Kim et al., 2015; Schaap et al., 2013), we hypothesized that the secretagogue activity of FGF21 protects against CIP by reducing protein load and concomitant ER stress. To investigate this possibility, we induced CIP in WT and Fgf21-KO mice and measured markers of ER stress, including phosphorylation of the α subunit of eukaryotic translation initiation factor 2 (eIF2α) and transcriptional regulation of activating transcription factor 4 (Atf4), CCAAT-enhancer-binding protein homologous protein (Chop), immunoglobulin-heavy-chain-binding protein (Bip) and spliced X-box binding protein 1 (XBP1s). Each of these ER stress markers was induced by CIP in pancreas of both WT and Fgf21-KO mice (Figure 2A). Importantly, these markers, with the exception of XBP1s, were further increased in the Fgf21-KO mice (Figure 2A). In complementary gain-of-function studies done using a liver-specific transgene that elevates circulating FGF21 to approximately 500 ng/ml, FGF21 overexpression suppressed each of these ER stress markers in response to CIP (Figure 2B). These data suggest that FGF21 mitigates pharmacologic-induced pancreatic ER stress, thereby restoring pancreatic proteostasis.

Figure 2. FGF21 attenuates ER stress during cerulein-induced pancreatitis.

Figure 2

(A, B) Quantification of phospho (p)-eIF2α protein (western blot image is shown below) and Atf4, Chop, Bip and XBP1s mRNA analyzed by qPCR in wild-type (WT) and Fgf21-knockout (KO) mice (A) or WT and Fgf21-transgenic (Tg) mice (B) treated with cerulein to induce pancreatitis (CIP). n=3–4 mice/group. Results are expressed as means ±S.E.M. n=3–6 mice/group for all experiments. *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001.

FGF21 triggers digestive enzyme secretion without affecting protein synthesis

FGF21 could reduce digestive enzyme concentrations in pancreatic acinar cells by either reducing protein synthesis or stimulating protein secretion. We first examined whether FGF21 affects pancreatic protein synthesis compared to CCK. As expected, CCK administration significantly increased 3H-phenylalanine incorporation into pancreatic protein (Figure 3A). In contrast, FGF21 administration had no effect on pancreatic protein synthesis (Figure 3A). Consistent with this protein synthesis profile, CCK increased phosphorylation of eukaryotic translation initiation factor 4E binding protein 1 (eIF4E-BP1), whereas FGF21 had no effect (Figure 3B and Figure S2A). Both FGF21 and CCK induced ERK1/2 phosphorylation in pancreas (Figure 3B and Figure S2A), demonstrating that they signal in the pancreas. We conclude that FGF21 does not reduce digestive enzyme levels in the pancreas by suppressing protein synthesis. Moreover, unlike CCK, FGF21 does not stimulate pancreatic protein synthesis.

Figure 3. FGF21 acts on acinar cells to induce pancreatic digestive enzyme secretion without affecting protein synthesis.

Figure 3

(A, B) 3H-Phenylalanine incorporation into pancreatic protein (A) and western blot quantification of pancreatic phospho (p)-eIF4E-BP1 and p-ERK1/2 (B) in mice treated with vehicle, 1 mg/kg FGF21 or 5 μg/kg CCK for 2 hours (A) or 15 minutes (B).

(C–F) Pancreatic juice flow rates and amylase levels in the pancreatic juice of wild type mice (C and D) or heterozygous (Het) control or β-Klotho-knockout (KO) mice (E and F) treated with vehicle or 1 mg/kg FGF21 for 2 consecutive days.

(G, H) Amylase secretion from mouse primary acinar cells (G) and AR42J cells (H) treated with vehicle, 1 μg/ml FGF21, 10 pM (primary acinar cells), 100 pM (AR42J cells) CCK or both 1 μg/ml FGF21 and 10 pM CCK (primary acinar cells) for 30 minutes.

(I, J) Amylase levels and pancreatic juice flow rates in the pancreatic juice of Klbfl/fl and KlbCela1−/− mice treated with vehicle or 1 mg/kg FGF21 for 2 consecutive days.

Results are expressed as means ±S.E.M. n=4–6 mice/group for all experiments. Primary acinar cell experiments were performed in triplicate, and similar results were obtained in 3 independent experiments.*, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001.

See also Figures S2 and S3.

To determine whether FGF21 stimulates pancreatic secretion in vivo, we treated WT mice with either vehicle or FGF21 and collected pancreatic juice for 15 minutes. Remarkably, FGF21 treatment approximately doubled both the pancreatic juice flow rate and the secretion of amylase when compared to vehicle treatment (Figures 3C and 3D). Notably, the effect of FGF21 administration on pancreatic flow rate and amylase secretion was lost in whole-body mouse knockouts of the FGF21 co-receptor, β-Klotho (Figures 3E and 3F). Together, these data show that FGF21 stimulates digestive enzyme secretion without concomitant protein synthesis.

To investigate whether FGF21 acts directly on pancreatic acinar cells to induce protein secretion, we treated either primary acinar cells derived from mouse pancreas or the AR42J rat pancreatic acinar cell line with FGF21 and measured amylase secretion into the media. Cells were treated in parallel with CCK as a positive control. FGF21 significantly increased amylase secretion from both the primary acinar cells and AR42J cells, albeit less efficaciously than CCK (Figures 3G and 3H). Concomitant administration of FGF21 and CCK did not elicit a response greater than CCK alone (Figure 3G).

To explore whether FGF21 also acts directly on pancreatic acinar cells in vivo, we generated an inducible acinar cell-specific β-Klotho (Klb) knockdown mouse model in which Cre recombinase expression was under the control of a modified estrogen receptor and the elastase promoter. Efficient knockdown of Klb expression following tamoxifen administration was confirmed in floxed Klb mice carrying the Cre allele (KlbCela1−/−)(Figure S2B). There was no change in plasma FGF21 concentrations in KlbCela1−/−mice under fasted conditions (Figure S2C). Similar to the Fgf21-KO mice, the KlbCela1−/−mice had increased zymogen granule density and pancreatic digestive enzyme concentrations (Figure S2C). To test whether FGF21 acts directly on pancreatic acinar cells to stimulate secretion, Klbfl/fl and KlbCela1−/−mice were treated with either vehicle or FGF21 and pancreatic juice collected for 15 minutes. The effect of FGF21 on digestive enzyme secretion was absent in KlbCela1−/−mice (Figure 3I), and the effect on pancreatic juice flow rate was significantly reduced but not eliminated (Figure 3J). Regarding this latter result, we did not detect β-Klotho expression in pancreatic ductal epithelial cells using knock-in mice expressing a fusion of β-Klotho and TdTomato (Figure S3), indicating that FGF21 does not act directly on ductal cells. Moreover, FGF21 did not increase blood concentrations of secretin (Figure S2B), an intestinal hormone that acts on pancreatic duct cells to induce pancreatic juice flow. Thus, the basis for the remaining effect of FGF21 on pancreatic juice flow rate requires further investigation. Nevertheless, the data demonstrate that FGF21 acts directly on pancreatic acinar cells to stimulate both juice flow and digestive enzyme secretion.

FGF21 triggers intracellular calcium release via an FGFR-PLCγ-IP3R pathway

CCK stimulates secretion from the exocrine pancreas by activating a phospholipase C (PLC)-inositol triphosphate receptor (IP3R) signaling cascade that induces intracellular calcium release from the ER (Williams, 2008). The FGF21 co-receptor, FGFR1, which is expressed in the exocrine pancreas (Fon Tacer et al., 2010) also activates PLC (Eswarakumar et al., 2005), suggesting that FGF21 might act through a similar mechanism. In support of this hypothesis, treatment of AR42J cells with either FGF21 or CCK triggered intracellular calcium release (Figure 4A). Interestingly, the calcium release profile was dynamically and temporally distinct upon treatment with FGF21 compared to CCK: whereas calcium levels peaked within 30 seconds after CCK treatment, the effect of FGF21 was more sustained, with calcium levels peaking 1–2 minutes after treatment (Figure 4A). Notably, the effect of FGF21 on calcium release was dose-dependent (Figure S4A). Calcium release elicited by FGF21 was blocked by the FGF receptor antagonist PD173074 but not the CCK-A receptor antagonist L-364,718; conversely, CCK-mediated calcium release was blocked by L-364,718 but not PD173074 (Figures 4B and 4C). Treatment of AR42J cells with either the PLC inhibitor U73122 or the IP3R inhibitor 2-APB blocked calcium release elicited by both FGF21 and CCK (Figures 4D and 4E). None of the inhibitors affected calcium release on their own (Figure S4B).

Figure 4. FGF21 triggers intracellular calcium release via an FGFR-PLC-IP3R pathway.

Figure 4

(A–E) Calcium release in AR42J cells was measured by the calcium indicator Fluo4-AM signal minus background fluorescence normalized to baseline fluorescence (ΔF/F0) for 2 minutes at 10X magnification. Cells were imaged for 10 seconds and then treated with either 1 μg/ml FGF21 (left panels) or 100 pM CCK (right panels). Black arrows indicate the start of treatment. In (B–E), cells were treated 30 minutes prior and during imaging with 1 μM PD173074 (B), 10 μM L-364,718 (C), 10 μM U73122 (D) or 100 μM 2-APB (E). Calcium transients are expressed as the mean calcium release of 50–200 cell clusters/group with each cluster containing 5–20 cells. Similar results were obtained in two independent experiments.

(F) Western blot images and quantification of pancreatic total (T) and phospho (p) PLCγ1, and PLCβ3 and p-ERK1/2 from WT mice treated with 1 mg/kg FGF21 or 5 μg/kg CCK (i.p.) for 15 minutes. Hsp90 is the loading control. Results are expressed as means ±S.E.M. n=4 mice/group. *, p<0.05; **, p<0.01; ***, p<0.001.

(G) Model for the action of FGF21 on the acinar cell to stimulate digestive enzyme secretion.

See also Figure S4.

Activation of the CCK-A receptor leads to the phosphorylation of the β isoform of PLC, calcium release and subsequent secretion (Berna et al., 2007). In contrast, FGF receptors are known to activate the γ isoform (Mohammadi et al., 1991). To explore whether FGF21 and CCK have different activation profiles for the PLC isoforms, we treated WT mice with vehicle, FGF21 or CCK for 15 minutes. As expected, CCK induced the phosphorylation of PLCβ (Figure 4F). In contrast, FGF21 induced the phosphorylation of PLCγ (Figure 4F). Both FGF21 and CCK induced ERK1/2 phosphorylation demonstrating that signaling was active in the pancreas at 15 minutes following administration of either CCK or FGF21 (Figure 4F). Collectively, these data show that FGF21 and CCK act through different cell surface receptors and PLC isoforms to engage downstream IP3R-mediated calcium release in pancreatic acinar cells.

In summary, we show that FGF21 acts via an autocrine or paracrine signaling mechanism on pancreatic acinar cells to stimulate zymogen secretion and pancreatic juice flow. Like the prototypical pancreatic secretagogue, CCK, FGF21 induces secretion by activating PLC/IP3R signaling and calcium release. Importantly, however, FGF21 functions through a receptor complex distinct from that of CCK and does not concomitantly induce protein synthesis (Figure 4G). As a consequence, unlike CCK, FGF21 alleviates ER stress that can occur in pancreas under either physiological conditions such as fasting/refeeding or pathological conditions such as pancreatitis (Sah et al., 2014).

The discovery of FGF21 as an autocrine/paracrine digestive enzyme secretagogue reveals an unexpected role for FGF21 that is separate from its other well-documented physiologic effects as a nutritional stress hormone and its pharmacologic effects as a diabetes and obesity drug. As a secretagogue in the exocrine pancreas where digestive enzyme synthesis rates are high, FGF21 prevents protein overload in acinar cells by stimulating secretion without affecting protein synthesis, thereby mitigating ER-stress. Interestingly, FGF21 is not released into the serum from the exocrine pancreas, yet its concentration there is more than 10-fold higher than blood. A potential explanation for this disparity is that the high level of FGF21 in the exocrine pancreas, even under basal conditions, serves to protect the exocrine pancreas from the fluctuating concentrations that occur in circulation and that govern FGF21’s distinct endocrine actions on metabolism. The ability of FGF21 to attenuate ER stress due to pathologic conditions that cause pancreatitis also suggests a unique pharmacologic use for FGF21 in the treatment of pancreatic diseases.

Experimental Procedures

Mouse Studies

Fgf21-KO (Fgf21tm1.2Djm) (Potthoff et al., 2009), Fgf21-Tg (Tg(Apoe-Fgf21)1Sakl) (Inagaki et al., 2007), β-Klotho-Tdtomato reporter mice (KLB-T) and WT littermates were maintained on a C57Bl/6J background. β-Klotho-KO (Klbtm1.2Sakl) and heterozygous littermates were kept on a mixed C57BL/6J;129/Sv background (Ding et al., 2012). Inducible acinar cell-specific β-Klotho knockdown mice (KlbCela1−/−) were maintained on a C57Bl/6J background. We generated these mice by crossing β-Klotho floxed mice (Klbfl/fl) (Klbtm1.1Sakl) (Ding et al., 2012) with mice expressing Cre recombinase under the control of a modified estrogen receptor and the elastase promoter (Tg(Cela1-cre/ERT)1Lgdn) (Ji et al., 2008). Cre expression was induced via intraperitoneal (i.p.) injection of 50 μg/g tamoxifen (Sigma) for two consecutive 2 days. All mice were housed in a pathogen-free facility and fed a standard chow diet (Harlan Teklad 2916). For fasting refeeding experiments, mice were fasted overnight and then refed for 2 hours with standard chow diet. Acute pancreatitis was induced by administration of seven hourly intraperitoneal injections of 50 μg/kg cerulein (Sigma), whereas mice in the control group were injected with saline. FGF21 in plasma of Fgf21-Tg mice (489 ± 57 ng/ml; n = 4 ± SEM) and after injection of recombinant FGF21 (Figure S1C) was measured using a mouse FGF21 ELISA kit (Biovendor).

KLB-T reporter mice were generated using the CRISPR/Cas9 knock-in method as described (Yang et al., 2013). The coding region of the Tdtomato gene was fused in-frame to the 3′ end of the last coding exon (exon 5) of the Klb gene. A single guide RNA with sequence AGTTTCAAGATTCACTCCGG targeting the 3′ UTR of Klb exon 5 was microinjected in C57Bl/6J zygotes in conjunction with Cas9 mRNA (Trilink Bio) and a circular homology-directed repair (HDR) template containing Klb exon 5 fused to Tdtomato bounded by left (2 kb) and right (3 kb) arms of homologous sequence (Figure S3A). The injected zygotes were implanted into pseudopregnant female C57Bl/6J mice. Mice born from these microinjections were screened by PCR from tail DNA to verify HDR template insertion and germline transmission was confirmed in the second generation of breeding with WT C57Bl/6J mice to eliminate any potential mosaicism. For this study, male homozygous KLB-T and their WT littermates were used.

Male mice were used for all experiments. The Institutional Animal Care and Research Advisory Committee of the University of Texas Southwestern Medical Center approved all experiments.

Pancreatic Juice Collection

Mice were injected with vehicle (10 mM Na2HPO4, 2% [w/v] glycerol, pH 7.6) or 1 mg/kg human recombinant FGF21 (Novo Nordisk) subcutaneously twice per day for two consecutive days. Mice were fasted for 6 hours, and pancreatic juice was collected for 15 minutes as described (Holmstrom et al., 2011). The final injection of vehicle or FGF21 was given 1 hour prior to pancreatic juice collection.

Measurement of Pancreatic Protein Synthesis

Pancreatic protein synthesis was measured by the flooding dose method using 3H-phenylalanine (Sans et al., 2004).

Real-time Quantitative PCR

RNA from pancreas was extracted using RNA-Stat 60 (IsoTex Diagnostics). cDNA was generated from RNA (2 μg) using the High-Capacity cDNA Reverse Transcription Kit (Life Technologies). qPCR was performed by the SYBR green method as described (Bookout et al., 2006). U36b4 was used as the reference mRNA.

Histology

Mouse pancreas was fixed in 10% neutral buffered formalin overnight and then paraffin embedded, sectioned and hematoxylin and eosin stained. For fresh frozen histology, the pancreas was quickly dissected, snap frozen in cooled isopentane and sectioned at 14–16 μm. The sections were then fixed in 10% neutral buffered formalin for 15 min at 4°C, washed 3 times in 1X PBS and mounted with Vectashield mounting medium with DAPI (Vector Laboratories). Images were acquired with a Zeiss Axioscan Z1 slide scanner.

Immunofluorescence

Paraffin embedded pancreas sections were deparaffinized in xylene and rehydrated through an ethanol gradient (100%, 95%, 70% and 50%). Antigen retrieval was performed for 30 minutes in citric acid based antigen unmasking solution (Vector Laboratories). Sections were incubated for 1 hour in blocking buffer (1% BSA and 5% normal donkey serum). Where indicated, sections were incubated overnight at 4°C with primary antibodies to amylase (Santa Cruz), TdTomato (Rockland) or cytokeratin 19 (DSHB Cat# TROMA-III, RRID: AB 2133570). Sections were washed in PBS 3 times for 5 minutes followed by incubation for 1 hour at RT with Alexa-fluor conjugated secondary antibodies against the primary antibody’s host species. Sections were washed in PBS 3 times for 5 minutes and coverslipped using Vectashield with DAPI (Vector Laboratories). Images were acquired with a Zeiss Axioscan Z1 slide scanner.

Immunoblotting

Pancreas was homogenized using Fastprep-24 lysing matrix bead tubes (MP Biomedicals) in 1X RIPA buffer (Cell Signaling Technology) supplemented with a cocktail of protease and phosphatase inhibitors (Roche). Protein lysate concentrations were measured using the DC Protein Assay (Biorad). Equal protein amounts were loaded and electrophoresed in a 4–20% SDS-polyacrylamide gel (Biorad) and transferred to nitrocellulose membranes (Biorad). Membranes were blocked with 5% BSA in TBST for 1 hour. Probing of membranes with antibodies against FGF21, amylase and lipase (Santa Cruz); β-actin (Abcam); p-EIF2α, p-ERK1/2, p-eIF4E-BP1, p-PLCγ1 and p-PLCβ3 (Cell Signaling Technology) was performed overnight at 4°C. Membranes were then incubated with HRP-conjugated secondary antibodies (Cell Signaling Technology) against the primary antibody’s host species for 1 hour. Membranes were developed using the Super Signal West Chemiluminescence Kit (Thermo) and signal was detected with an ImageQuant LAS4000 luminescent imager (General Electric). Quantification was done using Image J.

Preparation of Murine Primary Acinar Cells

Primary acinar cells were prepared by modification of a published protocol (Williams et al., 1978). Briefly, mice were sacrificed by decapitation followed by dissection and washing of the pancreas in 1X PBS. Pancreas digestion medium (0.75 mg/ml collagenase type XI-S [Sigma], 0.1 mg/ml soybean trypsin inhibitor [Sigma], 1% BSA in DMEM) was injected into the pancreatic parenchyma with a 30g syringe. Pancreas was then incubated in digestion medium for 20–40 minutes with constant mixing using serological pipets of decreasing diameters. Cells were filtered through a 100 μm strainer and washed 3 times with incubation medium (0.1 mg/ml soybean trypsin inhibitor, 1% BSA in DMEM) via centrifugation at 50 x g for 3 minutes per wash. Cells were plated and allowed to recover for 2 hours in incubation medium at 37°C.

Cell Secretion Assays

Primary acinar and AR42J cells were treated with vehicle, FGF21 (1 μg/ml for both primary acinar cells and AR42J) or CCK (10pM for primary acinar cells and 100 pM for AR42J cells [Phoenix Pharmaceuticals]) for 30 minutes at 37°C. Amylase levels in both the cell medium and cells were analyzed using an Amylase Assay Kit (Abcam).

Calcium Imaging

AR42J cells were pre-loaded with 1 μM of the calcium indicator fluo4-AM (Life Technologies) for 30 minutes at 37°C. Where indicated, 1 μM PD173074 (Sigma), 10 μM L-364,718 (Tocris Bioscience), 10 μM U73122 (Tocris Bioscience) or 100 μM 2-APB (Tocris Bioscience) were added during fluo4-AM preloading and to the imaging medium (DMEM without phenol red). Cells were imaged on a BD Pathway 855 bioimager with a 10X objective. Vehicle, FGF21 (1μg/ml) and CCK (100pM) were delivered 10 seconds after baseline fluorescence acquisition by an automated fluid delivery mechanism and imaged for a total time of 2 minutes. Calcium release was calculated using Image J as ΔF/F0, where ΔF is the raw fluorescent signal (F) from cells minus their background fluorescence (calculated from a region where no cells and fluorescent signal was expected), and F0 was the average of the first 6 frames before the compound was added. Sample size (n) corresponds to the number of cell clusters measured with each cell cluster containing 5–20 cells.

Statistical Analyses

Student’s T-Test was used for two-group analyses. One-way and two-way ANOVA with Newman-Keuls post-hoc correction (Graphpad Prism) were used for multiple group analyses. Data are presented as the mean ± SEM; p < 0.05 was considered significant.

Supplementary Material

supplement

Acknowledgments

We thank Birgitte Andersen (Novo Nordisk) for providing recombinant FGF21 and Yuan Zhang for FGF21 plasma measurements. This work was supported by the National Institutes of Health (grant R01DK067158 to S.A.K. and D.J.M.; grant F32DK098908 to K.C.C.); the Robert A. Welch Foundation (grants I-1558 to S.A.K. and I-1275 to D.J.M.); a National Science Foundation Graduate Research Fellowship (G.H.); and the Howard Hughes Medical Institute (D.J.M.).

Footnotes

Author Contributions

K.C.C. and G.H. designed, performed, and analyzed experiments, and wrote the paper; C.T. performed and analyzed calcium release experiments; S.S. performed and analyzed experiments; T.D.V.L. and K.V. performed experiments; S.A.K. and D.J.M. supervised the project, designed and analyzed experiments, and wrote the paper. K.C. and G.H. contributed equally. All authors commented and approved the paper. Data for this paper are also included in the supplemental materials.

Conflicts of Interest

D.J.M. is a founder of Metacrine and a member of its scientific advisory board; the other authors have no conflicts of interest to declare.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Adams AC, Coskun T, Cheng CC, LSOF, Dubois SL, Kharitonenkov A. Fibroblast growth factor 21 is not required for the antidiabetic actions of the thiazoladinediones. Mol Metab. 2013;2:205–214. doi: 10.1016/j.molmet.2013.05.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Badman MK, Pissios P, Kennedy AR, Koukos G, Flier JS, Maratos-Flier E. Hepatic fibroblast growth factor 21 is regulated by PPARalpha and is a key mediator of hepatic lipid metabolism in ketotic states. Cell Metab. 2007;5:426–437. doi: 10.1016/j.cmet.2007.05.002. [DOI] [PubMed] [Google Scholar]
  3. Berna MJ, Hoffmann KM, Tapia JA, Thill M, Pace A, Mantey SA, Jensen RT. CCK causes PKD1 activation in pancreatic acini by signaling through PKC-delta and PKC-independent pathways. Biochimica et biophysica acta. 2007;1773:483–501. doi: 10.1016/j.bbamcr.2006.12.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bookout AL, Cummins CL, Mangelsdorf DJ, Pesola JM, Kramer MF. High-throughput real-time quantitative reverse transcription PCR. Current protocols in molecular biology / edited by Frederick M Ausubel [et al] 2006;Chapter 15(Unit 15):18. doi: 10.1002/0471142727.mb1508s73. [DOI] [PubMed] [Google Scholar]
  5. Case RM. Synthesis, intracellular transport and discharge of exportable proteins in the pancreatic acinar cell and other cells. Biological reviews of the Cambridge Philosophical Society. 1978;53:211–354. doi: 10.1111/j.1469-185x.1978.tb01437.x. [DOI] [PubMed] [Google Scholar]
  6. Ding X, Boney-Montoya J, Owen BM, Bookout AL, Coate KC, Mangelsdorf DJ, Kliewer SA. betaKlotho is required for fibroblast growth factor 21 effects on growth and metabolism. Cell metabolism. 2012;16:387–393. doi: 10.1016/j.cmet.2012.08.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Eswarakumar VP, Lax I, Schlessinger J. Cellular signaling by fibroblast growth factor receptors. Cytokine Growth Factor Rev. 2005;16:139–149. doi: 10.1016/j.cytogfr.2005.01.001. [DOI] [PubMed] [Google Scholar]
  8. Fon Tacer K, Bookout AL, Ding X, Kurosu H, John GB, Wang L, Goetz R, Mohammadi M, Kuro-o M, Mangelsdorf DJ, Kliewer SA. Research resource: Comprehensive expression atlas of the fibroblast growth factor system in adult mouse. Mol Endocrinol. 2010;24:2050–2064. doi: 10.1210/me.2010-0142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Holmstrom SR, Deering T, Swift GH, Poelwijk FJ, Mangelsdorf DJ, Kliewer SA, MacDonald RJ. LRH-1 and PTF1-L coregulate an exocrine pancreas-specific transcriptional network for digestive function. Genes & development. 2011;25:1674–1679. doi: 10.1101/gad.16860911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Inagaki T, Dutchak P, Zhao G, Ding X, Gautron L, Parameswara V, Li Y, Goetz R, Mohammadi M, Esser V, Elmquist JK, Gerard RD, Burgess SC, Hammer RE, Mangelsdorf DJ, Kliewer SA. Endocrine regulation of the fasting response by PPARalpha-mediated induction of fibroblast growth factor 21. Cell Metab. 2007;5:415–425. doi: 10.1016/j.cmet.2007.05.003. [DOI] [PubMed] [Google Scholar]
  11. Ji B, Song J, Tsou L, Bi Y, Gaiser S, Mortensen R, Logsdon C. Robust acinar cell transgene expression of CreErT via BAC recombineering. Genesis. 2008;46:390–395. doi: 10.1002/dvg.20411. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Jiang S, Yan C, Fang QC, Shao ML, Zhang YL, Liu Y, Deng YP, Shan B, Liu JQ, Li HT, Yang L, Zhou J, Dai Z, Liu Y, Jia WP. Fibroblast growth factor 21 is regulated by the IRE1alpha-XBP1 branch of the unfolded protein response and counteracts endoplasmic reticulum stress-induced hepatic steatosis. The Journal of biological chemistry. 2014;289:29751–29765. doi: 10.1074/jbc.M114.565960. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Johnson CL, Mehmood R, Laing SW, Stepniak CV, Kharitonenkov A, Pin CL. Silencing of the Fibroblast growth factor 21 gene is an underlying cause of acinar cell injury in mice lacking MIST1. Am J Physiol Endocrinol Metab. 2014;306:E916–928. doi: 10.1152/ajpendo.00559.2013. [DOI] [PubMed] [Google Scholar]
  14. Johnson CL, Weston JY, Chadi SA, Fazio EN, Huff MW, Kharitonenkov A, Koester A, Pin CL. Fibroblast growth factor 21 reduces the severity of cerulein-induced pancreatitis in mice. Gastroenterology. 2009;137:1795–1804. doi: 10.1053/j.gastro.2009.07.064. [DOI] [PubMed] [Google Scholar]
  15. Kim SH, Kim KH, Kim HK, Kim MJ, Back SH, Konishi M, Itoh N, Lee MS. Fibroblast growth factor 21 participates in adaptation to endoplasmic reticulum stress and attenuates obesity-induced hepatic metabolic stress. Diabetologia. 2015;58:809–818. doi: 10.1007/s00125-014-3475-6. [DOI] [PubMed] [Google Scholar]
  16. Kubisch CH, Logsdon CD. Endoplasmic reticulum stress and the pancreatic acinar cell. Expert review of gastroenterology & hepatology. 2008;2:249–260. doi: 10.1586/17474124.2.2.249. [DOI] [PubMed] [Google Scholar]
  17. Kurosu H, Choi M, Ogawa Y, Dickson AS, Goetz R, Eliseenkova AV, Mohammadi M, Rosenblatt KP, Kliewer SA, Kuro-o M. Tissue-specific expression of betaKlotho and fibroblast growth factor (FGF) receptor isoforms determines metabolic activity of FGF19 and FGF21. J Biol Chem. 2007;282:26687–26695. doi: 10.1074/jbc.M704165200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Logsdon CD, Ji B. The role of protein synthesis and digestive enzymes in acinar cell injury. Nature reviews Gastroenterology & hepatology. 2013;10:362–370. doi: 10.1038/nrgastro.2013.36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Markan KR, Naber MC, Ameka MK, Anderegg MD, Mangelsdorf DJ, Kliewer SA, Mohammadi M, Potthoff MJ. Circulating FGF21 is Liver Derived and Enhances Glucose Uptake During Refeeding and Overfeeding. Diabetes. 2014 doi: 10.2337/db14-0595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Mohammadi M, Honegger AM, Rotin D, Fischer R, Bellot F, Li W, Dionne CA, Jaye M, Rubinstein M, Schlessinger J. A tyrosine-phosphorylated carboxy-terminal peptide of the fibroblast growth factor receptor (Flg) is a binding site for the SH2 domain of phospholipase C-gamma 1. Molecular and cellular biology. 1991;11:5068–5078. doi: 10.1128/mcb.11.10.5068-5078.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Ogawa Y, Kurosu H, Yamamoto M, Nandi A, Rosenblatt KP, Goetz R, Eliseenkova AV, Mohammadi M, Kuro-o M. BetaKlotho is required for metabolic activity of fibroblast growth factor 21. Proc Natl Acad Sci U S A. 2007;104:7432–7437. doi: 10.1073/pnas.0701600104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Owen BM, Mangelsdorf DJ, Kliewer SA. Tissue-specific actions of the metabolic hormones FGF15/19 and FGF21. Trends in endocrinology and metabolism: TEM. 2015;26:22–29. doi: 10.1016/j.tem.2014.10.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Potthoff MJ, Inagaki T, Satapati S, Ding X, He T, Goetz R, Mohammadi M, Finck BN, Mangelsdorf DJ, Kliewer SA, Burgess SC. FGF21 induces PGC-1alpha and regulates carbohydrate and fatty acid metabolism during the adaptive starvation response. Proc Natl Acad Sci U S A. 2009;106:10853–10858. doi: 10.1073/pnas.0904187106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Sah RP, Garg SK, Dixit AK, Dudeja V, Dawra RK, Saluja AK. Endoplasmic reticulum stress is chronically activated in chronic pancreatitis. J Biol Chem. 2014;289:27551–27561. doi: 10.1074/jbc.M113.528174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Sans MD, Lee SH, D’Alecy LG, Williams JA. Feeding activates protein synthesis in mouse pancreas at the translational level without increase in mRNA. American journal of physiology Gastrointestinal and liver physiology. 2004;287:G667–675. doi: 10.1152/ajpgi.00505.2003. [DOI] [PubMed] [Google Scholar]
  26. Schaap FG, Kremer AE, Lamers WH, Jansen PL, Gaemers IC. Fibroblast growth factor 21 is induced by endoplasmic reticulum stress. Biochimie. 2013;95:692–699. doi: 10.1016/j.biochi.2012.10.019. [DOI] [PubMed] [Google Scholar]
  27. Singhal G, Fisher FM, Chee MJ, Tan TG, El Ouaamari A, Adams AC, Najarian R, Kulkarni RN, Benoist C, Flier JS, Maratos-Flier E. Fibroblast Growth Factor 21 (FGF21) Protects against High Fat Diet Induced Inflammation and Islet Hyperplasia in Pancreas. PLoS One. 2016;11:e0148252. doi: 10.1371/journal.pone.0148252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Wente W, Efanov AM, Brenner M, Kharitonenkov A, Koster A, Sandusky GE, Sewing S, Treinies I, Zitzer H, Gromada J. Fibroblast growth factor-21 improves pancreatic beta-cell function and survival by activation of extracellular signal-regulated kinase 1/2 and Akt signaling pathways. Diabetes. 2006;55:2470–2478. doi: 10.2337/db05-1435. [DOI] [PubMed] [Google Scholar]
  29. Williams JA. Receptor-mediated signal transduction pathways and the regulation of pancreatic acinar cell function. Curr Opin Gastroenterol. 2008;24:573–579. doi: 10.1097/MOG.0b013e32830b110c. [DOI] [PubMed] [Google Scholar]
  30. Williams JA, Blevins GT., Jr Cholecystokinin and regulation of pancreatic acinar cell function. Physiol Rev. 1993;73:701–723. doi: 10.1152/physrev.1993.73.4.701. [DOI] [PubMed] [Google Scholar]
  31. Williams JA, Korc M, Dormer RL. Action of secretagogues on a new preparation of functionally intact, isolated pancreatic acini. The American journal of physiology. 1978;235:517–524. doi: 10.1152/ajpendo.1978.235.5.E517. [DOI] [PubMed] [Google Scholar]
  32. Xu J, Stanislaus S, Chinookoswong N, Lau YY, Hager T, Patel J, Ge H, Weiszmann J, Lu SC, Graham M, Busby J, Hecht R, Li YS, Li Y, Lindberg RA, Veniant MM. Acute glucose-lowering and insulin-sensitizing action of FGF21 in insulin resistant mouse models----Association with liver and adipose tissue effects. Am J Physiol Endocrinol Metab. 2009;297:E1105–E1114. doi: 10.1152/ajpendo.00348.2009. [DOI] [PubMed] [Google Scholar]
  33. Yang H, Wang H, Shivalila CS, Cheng AW, Shi L, Jaenisch R. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell. 2013;154:1370–1379. doi: 10.1016/j.cell.2013.08.022. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supplement

RESOURCES