Skip to main content
British Journal of Pharmacology logoLink to British Journal of Pharmacology
. 2017 Jan 31;174(5):409–423. doi: 10.1111/bph.13701

Canonical hedgehog signalling regulates hepatic stellate cell‐mediated angiogenesis in liver fibrosis

Feng Zhang 1,2,3, Meng Hao 1,2,3, Huanhuan Jin 1,2,3, Zhen Yao 1,2,3, Naqi Lian 1,2,3, Li Wu 1,2,3, Jiangjuan Shao 4, Anping Chen 5, Shizhong Zheng 1,2,3,✉
PMCID: PMC5301045  PMID: 28052321

Abstract

BACKGROUND AND PURPOSE

Hepatic stellate cells (HSCs) are liver‐specific pericytes regulating angiogenesis during liver fibrosis. We aimed to elucidate the mechanisms by which hedgehog signalling regulated HSC angiogenic properties and to validate the therapeutic implications.

EXPERIMENTAL APPROACH

Rats and mice were treated with carbon tetrachloride for in vivo evaluation of hepatic angiogenesis and fibrotic injury. Diversified molecular approaches including real‐time PCR, Western blot, luciferase reporter assay, chromatin immunoprecipitation, electrophoretic mobility shift assay and co‐immunoprecipitation were used to investigate the underlying mechanisms in vitro.

KEY RESULTS

Angiogenesis was concomitant with up‐regulation of Smoothened (SMO) and hypoxia inducible factor‐1α (HIF‐1α) in rat fibrotic liver. The SMO inhibitor cyclopamine and Gli1 inhibitor GANT‐58 reduced expression of VEGF and angiopoietin 1 in HSCs and suppressed HSC tubulogenesis capacity. HIF‐1α inhibitor PX‐478 suppressed HSC angiogenic behaviour, and inhibition of hedgehog decreased HIF‐1α expression. Furthermore, heat shock protein 90 (HSP90) was characterized as a direct target gene of canonical hedgehog signalling in HSCs. HSP90 inhibitor 17‐AAG reduced HSP90 binding to HIF‐1α, down‐regulated HIF‐1α protein abundance and decreased HIF‐1α binding to DNA. 17‐AAG also abolished 1‐stearoyl‐2‐arachidonoyl‐sn‐glycerol (SAG) (a SMO agonist)‐enhanced HSC angiogenic properties. Finally, the natural compound ligustrazine was found to inhibit canonical hedgehog signalling leading to suppressed angiogenic properties of HSCs in vitro and ameliorated liver fibrosis and sinusoidal angiogenesis in mice.

CONCLUSION AND IMPLICATIONS

We have provided evidence that the canonical hedgehog pathway controlled HSC‐mediated liver angiogenesis. Selective inhibition of HSC hedgehog signalling could be a promising therapeutic approach for hepatic fibrosis.


Abbreviations

17‐AAG

17‐N‐allylamino‐17‐demethoxygeldanamycin

ALP

alkaline phosphatase

ALT

alanine aminotransferase

AST

aspartate aminotransferase

ChIP

chromatin immunoprecipitation

CLD

chronic liver disease

Co‐IP

co‐immunoprecipitation

HA

hyaluronic acid

HIF‐1α

hypoxia‐inducible factor‐1α

HSC

hepatic stellate cell

HSP90

heat shock protein 90

LN

laminin

LSEC

liver sinusoidal endothelial cell

PCIII

procollagen type III

RACK1

receptor for activated C‐kinase 1

SAG

1‐stearoyl‐2‐arachidonoyl‐sn‐glycerol

SEM

scanning electronic microscopy

SMO

Smoothened

VEGFR‐2

VEGF receptor 2

vWF

von Willebrand factor

α‐SMA

α‐smooth muscle actin

Tables of Links

TARGETS
G protein‐coupled receptors a
SMO, Smoothened
Catalytic receptors b
VEGFR‐2

These Tables list key protein targets and ligands in this article that are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Southan et al., 2016), and are permanently archived in the Concise Guide to PHARMACOLOGY 2015/16 (a,bAlexander et al., 2015a,b).

Introduction

Angiogenesis is a hypoxia‐stimulated and growth factor‐dependent process in which new vascular structures are formed from existing blood vessels. Pathological angiogenesis and fibrogenesis develop in parallel in chronic liver disease (CLD). During the fibrogenic progression of CLD, loss of liver sinusoidal endothelial cell (LSEC) fenestrae (known as capillarization of hepatic sinusoids) is accompanied by excess deposition of extracellular matrix, which increases resistance to blood flow and reduces oxygen delivery (Thabut and Shah, 2010). These changes induce the hypoxia and transcription of many hypoxia‐sensitive pro‐angiogenic genes, usually regulated by the hypoxia‐inducible factor‐1α (HIF‐1α). Subsequently, hypoxia‐driven neovascularization disrupts hepatic architecture and promotes sinusoidal remodelling, exacerbating liver fibrotic injury (Zhan et al., 2015).

Hepatic stellate cells (HSCs) are known to be the pivotal players in liver fibrosis. These mesenchymal cells are being increasingly recognized as liver‐specific pericytes critically involved in hepatic angiogenesis. HSCs are dispersed along the sinusoids with spatial extensions and thus are sufficient to cover the entire sinusoidal microcirculatory network (Lee et al., 2007a). Due to intimate contact with LSECs, HSCs can stabilize the new vessels during angiogenesis. Furthermore, HSCs behave as hypoxia‐sensitive cells through transcription and secretion of many angiogenic molecules that activate LSECs, promoting a pro‐angiogenic sinusoidal niche (Rosmorduc and Housset, 2010). VEGF‐A and angiopoietin 1 have been defined as two primary stimuli of angiogenesis (Thabut and Shah, 2010). They are also potent pro‐fibrogenic molecules and activate HSCs through interacting with their corresponding receptors on these cells (Hernandez‐Gea and Friedman, 2011). Altogether, HSCs represent a cellular crossroads between pathological angiogenesis and liver fibrogenesis.

The angiogenic behaviours of HSCs may be controlled by intracellular signalling pathways. Hedgehog signalling is a conserved morphogenic cascade that is propagated by a family of ligands, which bind to the membrane receptor Patched. This interaction de‐represses the activity of Patched on the GPCR Smoothened (SMO) and permits the nuclear translocation of the Glis group of transcription factors (namely, Gli1, Gli2 and Gli3), which regulate the expression of hedgehog target genes. This Glis‐dependent pattern is termed canonical hedgehog signalling (Hu et al., 2015). There is growing evidence that hedgehog is a key regulator of adaptive and maladaptive responses to liver injury (Omenetti et al., 2011). The severity of liver fibrosis parallels the level of hedgehog activity in patients with CLDs (Guy et al., 2012). A recent study disclosed that hedgehog signalling regulated hepatic inflammation in mice with non‐alcoholic fatty liver disease (Kwon et al., 2016). Interestingly, hedgehog also regulated the fate of HSCs (Chen et al., 2012) and LSEC capillarization during liver injury (Xie et al., 2013). Here, we have investigated whether the hedgehog pathway could control the angiogenesis mediated by HSCs and have elucidated the underlying mechanisms.

Methods

Animal ethics and procedures

All animal care and experimental procedures complied with the National Institutes of Health (USA) guidelines and were approved by the Institutional and Local Committee on the Care and Use of Animals of Nanjing University of Chinese Medicine. Efforts were made to minimize animal suffering as much as possible during experiments. Animal studies are reported in compliance with the ARRIVE guidelines (Kilkenny et al., 2010; McGrath and Lilley, 2015).

Male Sprague–Dawley rats (200–250 g body weight) and ICR mice (20–25 g body weight) were obtained from Shanghai Slac Laboratory Animal Co., Ltd. (Shanghai, China). Animals were housed in standardized conditions in animal facilities at 20 ± 2°C room temperature, 40 ± 5% relative humidity and a 12 h light/dark cycle with dawn/dusk effect. Water and standard pathogen‐free chow diet were provided ad libitum. For experiments with rats, a mixture of carbon tetrachloride (CCl4) (0.1 mL·100 g−1 body weight) and olive oil [1:1 (v/v)] was used to induce liver fibrosis. Twelve rats were randomly divided into two groups (n = 6). Rats in group 1 were not given CCl4 but injected i.p. with olive oil. Rats in group 2 were injected i.p. with CCl4 every other day for 4 weeks. At the end of experiments, rats were killed after being anaesthetized with pentobarbital (i.p., 50 mg·kg−1) and their livers were removed in a room separated from the other animals.

For experiments with mice, a mixture of CCl4 (0.5 mL·100 g−1 body weight) and olive oil [1:9 (v/v)] was used to induce liver fibrosis. Forty mice were randomly divided into four groups (n = 10). Mice in group 1 were not treated with CCl4 but injected i.p. with olive oil. Mice in group 2 were injected i.p. with CCl4. Mice in group 3 were injected i.p. with CCl4 and given cyclopamine p.o. (30 mg·kg−1). Mice in group 4 were injected i.p. with CCl4 and given ligustrazine p.o. (80 mg·kg−1). Mice in groups 2–4 were treated with CCl4 every other day for 8 weeks. Cyclopamine and ligustrazine were suspended in sterile PBS and given once daily by gavage during the weeks 5–8. The control mice in groups 1 and 2 were similarly handled, including i.p. injection with the same volume of olive oil and oral administration of the same volume of PBS. At the end of experiments, mice were anaesthetized by inhalation of ether, and blood was collected from the retro orbital sinus. Then, mice were killed by decapitation followed by removal of the livers, in a room separated from the other animals.

Serum biochemistry

Blood samples were incubated at room temperature for 1 h to allow clotting, and serum was extracted after centrifugation and aliquoted. Serum levels of alkaline phosphatase (ALP), aspartate aminotransferase (AST), alanine aminotransferase (ALT), hyaluronic acid (HA), laminin (LN) and procollagen type III (PCIII) were measured using ELISA kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the protocols.

Measurement of hydroxyproline

The hydroxyproline levels in liver tissues were measured using a kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer's protocol. Briefly, three small pieces of liver tissues randomly excised from the liver of every mouse were extracted with 6 N hydrochloric acid (25 mg tissue per mL HCl solution) at 100°C for 24 h, and subsequently, the extracts were neutralized with sodium hydroxide. Isopropanol in citrate acetate‐buffered chloramine T was added to aliquots of the extract, followed by the addition of Ehrlich reagent. The chemical reaction occurred in dark for 25 min at 60°C. After centrifugation, absorbance of the supernatant of each sample was read at 558 nm using a 96‐well plate spectrometer. Trans‐ hydroxyproline was used as the standard for quantification.

Liver histopathology

Liver tissues were fixed in 10% neutral buffered formalin and embedded in paraffin. Haematoxylin–eosin staining was used for pathological assessments. Masson staining and Sirius Red staining were used for evaluating collagens. Photographs were blindly taken at random fields under a microscope (ZEISS Axio vert. A1, Germany). Quantification of Sirius Red staining was performed using Image Pro Plus 6.0 and was expressed as percentage of red‐stained area. All these examinations were carried out in a blinded manner. Representative images are shown.

Immunohistochemistry

Liver tissue sections were incubated with primary antibodies against CD31, CD34, vWF and VEGFR‐2 for immunohistochemical evaluation using standard methods. Photographs were blindly taken at random fields under a microscope (ZEISS Axio vert. A1, Germany). Positive staining cells were counted for evaluating the expression of examined molecules. All these examinations were carried out in a blinded manner. Representative images are shown.

Immunofluorescence analyses

Immunofluorescence staining was performed as we previously reported (Zhang et al., 2013). For liver tissues, staining with α‐smooth muscle actin (SMA) was used to identify HSCs. DAPI was used to stain the nucleus of cells in both liver tissues and cultured HSCs. Photographs were blindly taken at random fields under a fluorescence microscope (ZEISS Axio vert. A1, Germany). All these examinations were carried out in a blinded manner. Representative images are shown.

Scanning electronic microscopy (SEM) analyses

Liver tissues were fixed in 2.5% glutaraldehyde at 4°C. The livers were cut into pieces of approximately 5 mm3, which were then fixed in 4% osmium for 1 h. The livers were then processed for sequential alcohol dehydration and infiltrated with t‐butyl alcohol. After freezing, the tissues were vacuum‐dried and then coated with ion sputter for analysis with a field emission scanning electron microscope (ZEISS Ultra Plus, Germany). The morphological changes in LSEC fenestrae were observed at random fields. All these examinations were carried out in a blinded manner. Representative images are shown.

Cell culture

Rat HSC‐T6 cell line were obtained from the Cell Bank of Chinese Academy of Sciences (Shanghai, China). HSCs were cultured in DMEM (Invitrogen, Grand Island, NY, USA) with 10% fetal bovine serum (Wisent Biotechnology Co., Ltd., Nanjing, China), 1% antibiotics and grown in a 5% CO2 humidified atmosphere at 37°C.

Cell viability assay

HSCs were seeded in 96‐well plates and treated with various reagents at indicated concentrations for 24 h. Cell viability was determined using the Cell Counting Kit‐8 (Nanjing Enogene Biotechnology. Co., Ltd., Nanjing, China) according to the manufacturer's protocol. The spectrophotometric absorbance at 450 nm was measured by a SPECTRAmax™ microplate spectrophotometer (Molecular Devices, Sunnyvale, CA, USA). Cell viability was expressed as the percentage of control value.

Real‐time PCR

Total RNA was prepared from liver tissues or treated HSCs using Trizol reagent (Sigma, Saint Louis, MO, USA) and then subjected to reverse transcription to cDNA using the kits provided by TaKaRa Biotechnology Co., Ltd. (Dalian, China) according to the manufacturer's protocol. Real‐time PCR was performed using the SYBR Green Master Mix (Vazyme Biotech Co., Ltd., Nanjing China) as we described previously (Zhang et al., 2014). Fold changes in the mRNA levels of target genes related to the invariant control were calculated as suggested (Schmittgen et al., 2000). The primers of genes (GenScript, Nanjing, China) were listed in Supporting Information Table S1.

Western blot analyses

Whole cell protein extracts were prepared from treated HSCs or liver tissues with RIPA buffer containing protease inhibitor. In certain experiments, nuclear proteins were separated using a Bioepitope Nuclear and Cytoplasmic Extraction Kit (Bioworld Technology, Saint Louis Park, MN, USA) according to the manufacturer's protocol. Protein detection and band visualization were performed as we previously described (Zhang et al., 2014). β‐Actin was used as an invariant control for equal loading of total proteins, and Lamin B1 was the control for nuclear proteins. Representative blots are shown.

Tubulogenesis assay

HSCs were seeded on growth factor‐reduced Matrigel (BD Biosciences, Bedford, MA, USA) after 30 min of preincubation at 37°C in 24‐well plates. HSCs were treated with different reagents at indicated concentrations for 3 h. Tubulogenesis was visualized at random fields under a microscope (ZEISS Axio vert. A1, Germany). Tubulogenesis was assessed by counting the number of closed intercellular compartments (closed rings or pro‐angiogenic structures) as described by Caliceti et al., (2013). Representative images are shown.

Dual‐luciferase reporter assay

HSCs were seeded in 96‐well plates and transfected with pHSP90‐pGL3‐Basic‐Luc provided by Zoonbio Biotechnology Co., Ltd. (Nanjing, China) using X‐tremeGENE 9 DNA Transfection Reagent (Roche, Swiss) in antibiotic free medium for 24 h. Then, cells were grown in refreshed medium and treated with different reagents for 24 h. Transfection efficiency was normalized by co‐transfection of Renilla luciferase reporter plasmid pRL‐TK Vector (Roche, Swiss). Luciferase activities were measured using a dual‐luciferase reporter system (Promega, Madison, WI, USA) and presented in arbitrary units after normalization to renilla luciferase activities.

Chromatin immunoprecipitation (ChIP)‐quantitative PCR

ChIP assays were performed by using a ChIP assay kit (Millipore Corporation, Billerica, MA, USA) according to the manufacturer's instructions. Soluble chromatin was prepared from HSCs treated with vehicle or GANT‐58 at 10 μM for 24 h and then were incubated with ChIP‐grade antibodies against Glli1 (Santa Cruz Biotechnology, CA, USA) or IgG. The immunoprecipitated DNA was amplified by the promoter‐specific primers: forward 5′‐GAAACGTGACTAACCGCACC‐3′, reverse 5′‐GAAGGTTCGGGAGGCTTCT‐3′. DNA enrichment was evaluated by average values of the eluate with immunoprecipitated DNA normalized to average values of input.

EMSA

HSCs were seeded in 6‐well plates and then treated with 17‐N‐allylamino‐17‐demethoxygeldanamycin (17‐AAG) at the indicated concentrations, for 24 h. Then the nuclear extracts were prepared using the NE‐PER Nuclear Extraction Kit (Thermo Scientific, Waltham, MA, USA) according to the protocol. Biotin‐labelled HIF‐1α probe was prepared using the following sequences: forward 5′‐TCTGTACGTGACCACACTCACCTC‐3′; reverse 3′‐AGACATGCACTGGTGTGAGTGGAG‐5′. The extracted nuclear proteins were subjected to PAGE and incubated with biotin‐labelled HIF‐1α probe using the Lightshift Chemiluminescent EMSA Kit (Thermo Scientific, USA), as previously described (Lian et al., 2015).

Co‐immunoprecipitation (Co‐IP) assay

HSCs were seeded in Petri dishes and then treated with 17‐AAG at 5 μM for 24 h. Cells were lysed at 4°C in RIPA buffer containing protease inhibitors. Cell lysates adjusted to 1 mg·mL−1 protein were precleared by IP‐grade antibodies against HIF‐1α (1:1000, Abcam) or HSP90 (1:200, Proteintech Group). After gentle rocking at 4°C overnight, Protein A/G PLUS‐Agarose (Santa Cruz Biotechnology, CA, USA) was added to the lysate/antibody mixture and incubated with gentle agitation at 4°C for 4 h. Then the immunoprecipitates were collected by centrifugation and washed three times with cell lysis buffer, then boiled for 5 min with the same volume of 2× loading buffer (62.5 mM Tris–HCl, pH 6.8, 2% w/v SDS, 10% glycerol, 50 mM DTT and 0.01% w/v bromophenol blue). Proteins were resolved by 10% SDS‐PAGE and subjected to Western blotting. Representative blots are shown.

Data and statistical analyses

The data and statistical analyses in this study complied with the recommendations on experimental design and analyses in pharmacology (Curtis et al., 2015). Data are presented as mean ± SD and analysed using SPSS16.0 software. The significant differences between groups of normally distributed data was determined by Student's t‐test (comparison between two groups) or one‐way ANOVA with post hoc Dunnett's test (comparison between multiple groups) under the condition that F achieved P < 0.05, and there was no significant variance inhomogeneity. For the non‐normally distributed data, Mann–Whitney U‐test (comparison between two groups) or Kruskal–Wallis H test (comparison between multiple groups) was used to determine significant differences. Values of P < 0.05 were considered to be statistically significant.

Materials

The following compounds were used in this study: cyclopamine, GANT‐58 and 1‐stearoyl‐2‐arachidonoyl‐sn‐glycerol (SAG) supplied by Cayman Chemicals (Ann Arbor, MI, USA); PX‐478 and 17‐AAG (tanespimycin) supplied by Selleck Chemicals (Houston, TX, USA); and ligustrazine from Sigma‐Aldrich (St Louis, MO, USA). They were dissolved in DMSO for experiments. Treatment with DMSO alone was used as vehicle control in experiments in vitro throughout the current study. The following primary antibodies were used in this study: VEGF, angiopoietin 1, HIF‐1α, CD31, CD34, vWF and heat shock protein 90 (HSP90; Proteintech Group, Chicago, IL, USA); and α‐smooth muscle actin (α‐SMA), SMO, Gli1, VEGF receptor 2 (VEGFR‐2), Lamin B1 and β‐Actin (Cell Signaling Technology, Danvers, MA, USA).

Results

Hedgehog signalling is activated in HSCs linking to hepatic hypoxia and angiogenesis in rat fibrotic liver

We initially established our model of chemically induced liver fibrosis in rats. Treatment with CCl4 caused marked necrosis and fibrotic septa in rat liver accompanied by excessive collagen production (Figure 1A), suggesting the formation of hepatic fibrosis. The transcripts of CD31, CD34 and von Willebrand factor (vWF), three key endothelial markers indicating angiogenesis, were all significantly elevated in rat fibrotic liver (Figure 1B), which was confirmed by immunohistochemical analyses (Figure 1C). Immunofluorescence staining with α‐SMA, the marker of activated HSCs, showed that VEGF, HIF‐1α and the GPCR SMO were all up‐regulated in HSCs from rat fibrotic liver (Figure 1D). These data, together, showed that hypoxia and angiogenesis occurred in liver fibrosis in vivo, and was accompanied by activation of hedgehog signalling in HSCs.

Figure 1.

Figure 1

Hedgehog signalling is activated in HSCs linking to hepatic hypoxia and angiogenesis in rat fibrotic liver. Rats were injected i.p. with CCl4 for 8 weeks, to induce liver fibrosis. (A) Liver sections were stained with haematoxylin–eosin (H&E), Masson reagents and Sirius Red reagents for histological and collagen examinations (200× magnification) (n = 6). (B) Real‐time PCR analyses of endothelial markers in liver tissues. Data were expressed as fold of control value (n = 6). *P < 0.05, significantly different from control, Mann–Whitney U‐test. (C) Immunohistochemical analyses of angiogenic markers in liver tissues (200× magnification) (n = 6). (D) Immunofluorescence analyses of VEGF, HIF‐1α and SMO in liver tissues (400× magnification) (n = 6). Staining with α‐SMA was used to identify HSCs. DAPI was used to stain the nucleus.

Canonical hedgehog signalling regulates the angiogenic properties of HSCs

We next explored the role of hedgehog signalling in HSC‐mediated hepatic angiogenesis. We used the SMO inhibitor cyclopamine to manipulate the pathway and the Gli1 inhibitor GANT‐58, in parallel, to identify whether the Gli1‐mediated canonical hedgehog signalling was involved. We determined the concentrations of the two compounds, at which they did not significantly affect cell viability, to be used in subsequent molecular experiments (Figure 2A). Pharmacological inhibition of hedgehog signalling by cyclopamine and GANT‐58 inhibited expression of mRNA for VEGF and angiopoietin 1 in HSCs (Figure 2B). Similar results were obtained in terms of the corresponding proteins (Figure 2C). Furthermore, tubulogenesis assays showed that cyclopamine at 10 μM and GANT‐58 at 5 μM significantly inhibited HSC‐mediated tube formation, a capacity inherent in HSCs as pericytes (Figure 2D). Altogether, these data revealed that the angiogenic properties of HSCs were positively regulated by the canonical hedgehog pathway.

Figure 2.

Figure 2

Canonical hedgehog signalling regulates the angiogenic properties of HSCs. HSCs were treated with cyclopamine or GANT‐58 at indicated concentrations for 24 h (A–C) or 3 h (D). (A) Cell viability was determined using Cell Counting Kit‐8. Data were expressed as percentage of control value (n = 6). *P < 0.05, significantly different from control, Kruskal–Wallis H test. (B) Real‐time PCR analyses of angiogenic cytokines. Data were expressed as fold of control value (n = 6). *P < 0.05, significantly different from control, Mann–Whitney U‐test. (C) Western blot analyses of angiogenic cytokines (n = 3). (D) Tubulogenesis assay with quantification of number of closed intercellular compartments (100× magnification) (n = 5). *P < 0.05, significantly different from control, one‐way ANOVA with post hoc Dunnett's test.

Canonical hedgehog signalling transactivates HIF‐1α, which mediates the angiogenic properties of HSCs

We next examined the mechanisms underlying regulation of the angiogenic properties of HSCs by the canonical hedgehog pathway. Given that hypoxia occurs in fibrotic liver and HSCs are highly sensitive to hypoxia (Zhan et al., 2015), we speculated that HIF‐1α could be involved in HSC‐driven liver angiogenesis. We thus used a HIF‐1α inhibitor, PX‐478, to test this possibility. PX‐478 at concentrations lower than 40 μM did not significantly suppress HSC viability (Figure 3A). As expected, PX‐478 decreased the expression of mRNA and protein of VEGF and angiopoietin 1 in HSCs (Figure 3B and C). PX‐478 at 20 μM also significantly inhibited HSC tube formation (Figure 3D). We next investigated whether HIF‐1α could be a linking molecule in hedgehog regulation of HSC angiogenic properties. Cyclopamine and GANT‐58 suppressed the expression of mRNA for HIF‐1α (Figure 3E) and also reduced its protein abundance, as shown by Western blot assays (Figure 3F) and immunofluorescence analyses (Figure 3G). Taken together, these data suggested that HIF‐1α was activated by canonical hedgehog signalling and was critically involved in the angiogenic properties of HSCs.

Figure 3.

Figure 3

The canonical hedgehog pathway transactivates HIF‐1α, which mediates the angiogenic properties of HSCs. HSCs were treated with PX‐478, cyclopamine or GANT‐58 at indicated concentrations for 24 h (A–C, E–G) or 3 h (D). (A) Cell viability was determined using Cell Counting Kit‐8. Data were expressed as percentage of control value (n = 6). *P < 0.05, significantly different from control, Kruskal–Wallis H test. (B, E) Real‐time PCR analyses of angiogenic cytokines (B) and HIF‐1α (E). Data were expressed as fold of control value (n = 6). *P < 0.05, significantly different from control, non‐parametric analyses with Kruskal–Wallis H test. (C, F) Western blot analyses of angiogenic cytokines (C) and HIF‐1α (F) (n = 3). (D) Tubulogenesis assay with quantification of number of closed intercellular compartments (100× magnification) (n = 5). *P < 0.05, significantly different from control, Student's t‐test. (G) Immunofluorescence analyses of HIF‐1α expression (400× magnification) (n = 3). DAPI was used to stain the nucleus.

Transactivation of HSP90 by canonical hedgehog signalling maintains accumulation of HIF‐1α in HSCs

Although HIF‐1α is subject to ubiquitin/acetylation‐mediated proteasomal degradation under normoxia, its stabilization can be regulated in an oxygen‐independent manner by direct interaction with HSP90 (Neckers and Ivy, 2003). We found that cyclopamine and GANT‐58 suppressed the expression of HSP90 at both mRNA and protein levels (Figure 4A and B). The two compounds also decreased the luciferase activity of HSP90 gene promoter (Figure 4C). Subsequent ChIP‐quantitative PCR showed that Gli1 interaction with the HSP90 gene promoter was significantly reduced by GANT‐58 (Figure 4D). These data characterized HSP90 as a target gene of Gli1‐mediated canonical hedgehog signalling in HSCs. We subsequently examined the role of HSP90 in regulation of HIF‐1α and the angiogenic properties of HSCs. The HSP90 inhibitor 17‐AAG was first used over a range of concentrations, to determine its effects on HSC viability (Figure 4E). We found that 17‐AAG did not affect HIF‐1α mRNA expression (Figure 4F) but decreased its protein abundance, as shown by Western blot (Figure 4G) and immunofluorescence analyses (Supporting Information Figure S1). 17‐AAG also reduced the direct interaction between HSP90 and HIF‐1α as shown by Co‐IP experiments (Figure 4H, Supporting Information Figure S2). EMSA additionally revealed that the DNA binding of HIF‐1α was suppressed by17‐AAG (Figure 4I). Furthermore, up‐regulation of VEGF and angiopoietin 1 by the diacylglycerol SAG, a specific agonist of SMO, was blocked by 17‐AAG at both gene and protein levels in HSCs (Figure 4J and K). Incubation with 17‐AAG also abolished the SAG‐enhanced tubulogenesis capacity of HSCs (Figure 4L). These data, together, indicated that hedgehog transactivation of HSP90 was required for HIF‐1α accumulation and the angiogenic properties of HSCs.

Figure 4.

Figure 4

Transactivation of HSP90 by canonical hedgehog signalling maintains accumulation of HIF‐1α in HSCs. HSCs were treated with different reagents at indicated concentrations for 24 h (A–K) or 3 h (L). (A) Real‐time PCR analyses of hsp90. Data were expressed as fold of control value (n = 6). *P < 0.05, significantly different from control, Kruskal–Wallis H test. (B) Western blot analyses of HSP90 (n = 3). (C) Luciferase activities of hsp90 promoter expressed as arbitrary units (n = 6). *P < 0.05, significantly different from control, one‐way ANOVA with post hoc Dunnett's test. (D) ChIP‐quantitative PCR analyses of Gli1 binding to hsp90 promoter in GANT‐58 (10 μM)‐treated HSCs (n = 5). *P < 0.05, significantly different from control, one‐way ANOVA with post hoc Dunnett's test. (E) Cell viability was determined using Cell Counting Kit‐8. Data were expressed as percentage of control value (n = 6). *P < 0.05, significantly different from control, Kruskal–Wallis H test. (F) Real‐time PCR analyses of hif‐1α. Data were expressed as fold of control value (n = 6). Non‐parametric analyses with Kruskal–Wallis H test. (G) Western blot analyses of HIF‐1α (n = 3). (H) Co‐IP analyses of direct interaction between HSP90 and HIF‐1α in 17‐AAG (5 μM)‐treated HSCs using antibodies against HSP90, HIF‐1α or IgG (n = 2). (I) EMSA for examining HIF‐1α binding to DNA sequences (n = 2). (J) Real‐time PCR analyses of angiogenic cytokines. Data were expressed as fold of control value (n = 6). *P < 0.05, significantly different from control, # P < 0.05, significantly different from SAG at 0.6 μM, Kruskal–Wallis H test. (K) Western blot analyses of angiogenic cytokines (n = 3). (L) Tubulogenesis assay with quantification of number of closed intercellular compartments (100× magnification) (n = 5). *P < 0.05, significantly different from control, # P < 0.05, significantly different from SAG at 0.6 μM, one‐way ANOVA with post hoc Dunnett's test.

Pharmacological inhibition of canonical hedgehog signalling attenuates the angiogenic properties of HSCs in vitro

We next investigated whether HSC‐mediated hepatic angiogenesis could be inhibited by pharmacological agents targeting hedgehog signalling. The alkaloid ligustrazine inhibited HSC activation in our earlier work (Zhang et al., 2012). In our present experiments, ligustrazine down‐regulated the protein expression of SMO and decreased the abundance of Gli1 in the nucleus of HSCs (Figure 5A). In addition, ligustrazine reduced the transcripts of bcl‐2 and cyclin d1, two well‐established target genes of hedgehog in mammalian cells (Katoh and Katoh, 2009) (Figure 5B). These data suggested that ligustrazine disrupted the canonical hedgehog signalling in HSCs. In subsequent experiments, ligustrazine decreased the mRNA expression of HSP90 and HIF‐1α in HSCs, effects that were reversed by SAG (Figure 5C). The protein abundance of HSP90 and HIF‐1α was also down‐regulated by ligustrazine, and this effect was also blocked by SAG (Figure 5D). We also assessed the effects of ligustrazine on the angiogenic properties of HSCs. The mRNA and protein expression of VEGF and angiopoietin 1 was decreased by ligustrazine in HSCs and was reversed by SAG (Figure 5E and F). Ligustrazine (20 μM) also markedly decreased the tube formation capacity of HSCs, again reversed by SAG (Figure 5G). Taken together, these data indicated that the angiogenic actions of HSCs could be inhibited by pharmacological blockade of the canonical hedgehog pathway by ligustrazine.

Figure 5.

Figure 5

Pharmacological suppression of canonical hedgehog signalling attenuates the angiogenic properties of HSCs in vitro. HSCs were treated with ligustrazine and/or SAG at indicated concentrations for 24 h (A–F) or 3 h (G). (A) Western blot analyses of SMO and nuclear Gli1 (n = 3). (B) Real‐time PCR analyses of bcl‐2 and cyclin d1. Data were expressed as fold of control value (n = 6). *P < 0.05, significantly different from control, Kruskal–Wallis H test. (C) Real‐time PCR analyses of hsp90 and hif‐1α. Data were expressed as fold of control value (n = 6). *P < 0.05, significantly different from control, # P < 0.05, significantly different from ligustrazine at 30 μM, Kruskal–Wallis H test. (D) Western blot analyses of HSP90 and HIF‐1α (n = 3). (E) Real‐time PCR analyses of angiogenic cytokines. Data were expressed as fold of control value (n = 6). *P < 0.05, significantly different from control, # P < 0.05, significantly different from ligustrazine at 30 μM, Kruskal–Wallis H test. (F) Western blot analyses of angiogenic cytokines (n = 3). (G) Tubulogenesis assay with quantification of number of closed intercellular compartments (100× magnification) (n = 5). *P < 0.05, significantly different from control, # P < 0.05, significantly different from ligustrazine at 30 μM, one‐way ANOVA with post hoc Dunnett's test.

Pharmacological blockade of canonical hedgehog signalling ameliorates liver fibrosis and angiogenesis in mice in vivo

We finally attempted to confirm these actions of ligustrazine in vivo, using mice with CCl4‐induced liver fibrosis. In these mice, Cyclopamine and ligustrazine significantly reduced the serum levels of ALP, AST and ALT (Figure 6A) and improved liver injury (Figure 6B). Exanimations of key fibrogenic indicators showed that the serum levels of HA, LN and PCIII (Figure 6C) and liver hydroxyproline contents (Figure 6D) were all decreased significantly by cyclopamine and ligustrazine in fibrotic mice. Further, the two agents also reduced collagen deposition in mouse fibrotic liver as shown by Masson staining (Figure 6E) and Sirius Red staining (Figure 6F, Supporting Information Figure S3). Moreover, SEM analyses of sinusoidal fenestration showed that loss of LSEC fenestrae was reversed by cyclopamine and ligustrazine (Figure 7A). Cyclopamine and ligustrazine also significantly down‐regulated the expression of CD31, CD34, vWF and VEGFR‐2 at both gene and protein levels in mouse fibrotic liver (Figure 7B and C). Similar results were obtained using immunohistochemical analyses (Figure 7D). Furthermore, the hepatic abundance of SMO, HSP90 and HIF‐1α was all reduced by cyclopamine and ligustrazine (Figure 7E). These alterations were further demonstrated in HSCs in mouse liver by immunofluorescence staining analyses (Figure 7F, Supporting Information Figure S4), which were consistent with the in vitro observations. Collectively, these data provided in vivo evidence that pharmacological blockade of the canonical hedgehog signalling did alleviate fibrotic injury and angiogenesis in our model of liver fibrosis in mice.

Figure 6.

Figure 6

Pharmacological suppression of canonical hedgehog signalling alleviates liver fibrotic injury in mice. Mice were injected i.p. with CCl4 for 8 weeks, to induce liver fibrosis. During the weeks 5–8, mice in treatment groups were treated with cyclopamine (p.o., 30 mg·kg−1) or ligustrazine (80 mg·kg−1). (A) Measurements of serum levels of liver injury markers ALP, AST and ALT (n = 10). *P < 0.05, significantly different from control, # P < 0.05, significantly different from CCl4, one‐way ANOVA with post hoc Dunnett's test. (B) Liver sections were stained with H&E for histological examinations (200× magnification) (n = 10). (C) Measurements of serum levels of fibrotic markers HA, LN and PCIII (n = 10). *P < 0.05, significantly different from control, # P < 0.05, significantly different from CCl4, one‐way ANOVA with post hoc Dunnett's test. (D) Measurements of liver hydroxyproline (Hyp) levels (n = 10). *P < 0.05, significantly different from control, # P < 0.05, significantly different from CCl4, one‐way ANOVA with post hoc Dunnett's test. (E, F) Liver sections were stained with Masson reagents (E) and Sirius Red reagents (F) for collagen examinations (200× magnification) (n = 10).

Figure 7.

Figure 7

Pharmacological suppression of canonical hedgehog signalling attenuates hepatic angiogenesis in mice. Mice were injected i.p. with CCl4 for 8 weeks, to induce liver fibrosis. During the weeks 5–8, mice in treatment groups were given cyclopamine (p.o., 30 mg·kg−1) or ligustrazine (80 mg·kg−1). (A) SEM analyses of sinusoidal fenestration in liver tissues (10 000× magnification) (n = 10). (B) Real‐time PCR analyses of endothelial markers in liver tissues. Data were expressed as fold of control value (n = 10). *P < 0.05, significantly different from control, # P < 0.05, significantly different from CCl4, Kruskal–Wallis H test. (C) Western blot analyses of endothelial markers in liver tissues (n = 3). (D) Immunohistochemical analyses of endothelial markers in liver tissues (200× magnification) (n = 10). (E) Western blot analyses of SMO, HSP90 and HIF‐1α in liver tissues (n = 3). (F) Immunofluorescence analyses of SMO, HSP90 and HIF‐1α in liver tissues (400× magnification) (n = 10). Staining with α‐SMA was used to identify HSCs. DAPI was used to stain the nucleus.

Discussion

Increasing evidence suggests a causative role for angiogenesis and sinusoidal remodelling in liver fibrosis. Inhibition of angiogenesis by the receptor tyrosine kinase inhibitors sunitinib (Tugues et al., 2007) and sorafenib (Hennenberg et al., 2009; Mejias et al., 2009) has shown antifibrotic effects in rodents with experimental liver fibrosis. Activated HSCs play a dominant role in sinusoidal structural changes during fibrosis via crosstalk with LSECs (Lee et al., 2007a). Elucidation of the mechanisms governing the angiogenic functions of HSCs may provide therapeutic approaches to the control of liver fibrogenesis. In the current study, we initially observed high expression of SMO and HIF‐1α in rat fibrotic liver, which was presumably due to the hypoxic micro‐environment. A recent study reported that hypoxia induced up‐regulation of SMO and HIF‐1α independently in pancreatic cancer (Onishi et al., 2011), which was consistent with our present findings in the fibrotic liver. Furthermore, our data identified SMO as an upstream regulator of HIF‐1α in liver hypoxic micro‐environment during fibrogenesis. On the other hand, Onishi's study described a hedgehog ligand‐independent mechanism by which hypoxia activated hedgehog signalling in pancreatic cancer (Onishi et al., 2011). It could not be the same case during liver fibrosis, because injured hepatocytes could secrete various hedgehog ligands activating HSC hedgehog signalling in a paracrine manner (Choi et al., 2011). We therefore postulated that both ligand‐dependent and ligand‐independent mechanisms could be involved in HSC hedgehog activation during liver fibrosis.

In the current study, up‐regulation of SMO in HSCs was concomitant with increased expression of angiogenic molecules in rat fibrotic liver, linking hedgehog to HSC‐driven liver angiogenesis. We determined the expression of angiogenic cytokines and tubulogenesis capacity, two important aspects of HSCs as liver‐specific pericytes. We observed that these angiogenic actions were suppressed by cyclopamine and GANT‐58 in vitro, suggesting that the canonical hedgehog pathway regulated these angiogenic properties of HSCs. Interestingly, a previous study reported that hedgehog activation increased angiopoietin‐1 expression in fibroblasts but did not change the expression of angiopoietin‐1 and VEGF in neural progenitor cells or neurons (Lee et al., 2007b). Thus, it is conceivable that hedgehog regulation of angiogenic cytokines could be cell type‐dependent.

We investigated the mechanisms underlying canonical hedgehog regulation of HSC angiogenic properties and identified a key role for HIF‐1α in this context. An inhibitor of HIF‐1α reduced the synthesis of angiogenic cytokines and suppressed the tubulogenesis capacity of HSCs, which was consistent with the biological nature of HIF‐1α as a pivotal regulator in the angiogenesis network. This finding also suggested the involvement of HIF‐1α in HSC pathophysiology. HIF‐1α is known to stimulate collagen synthesis and chemotaxis in HSCs (Copple et al., 2011) and to induce HSC migration (Novo et al., 2012). Knockdown of HIF‐1α attenuated hypoxia‐induced HSC activation by down‐regulating collagens and inflammatory cytokines (Wang et al., 2013). In the current study, we observed that HIF‐1α transcripts were reduced by cyclopamine and GANT‐58 in HSCs, which would be consistent with a recent report characterizing HIF‐1α as a direct target gene of Gli1 in human HSCs and suggesting an oxygen‐independent mechanism for HIF‐1α regulation (Chen et al., 2012). Interestingly, HIF‐1α in that report was demonstrated to regulate HSC metabolic reprogramming via transactivation of glycolysis genes (Chen et al., 2012). Therefore, HIF‐1α could be a key molecule linking metabolic turnover to the angiogenic actions of HSCs.

Our efforts to elucidate the underlying mechanisms showed that the molecular chaperone HSP90 played an important role in this context. We characterized HSP90 as a target gene of canonical hedgehog signalling, using several molecular approaches. It is known that HSP90 protects client proteins from misfolding and degradation and can increase HIF‐1α stability through binding to the PAS domain (Neckers and Ivy, 2003). Our present data showed that pharmacological inhibition of HSP90 reduced the binding of HSP90 to HIF‐1α in HSCs, accounting for the decreased stability and protein abundance of HIF‐1α. Furthermore, the HSP90 inhibitor, 17‐AAG, did not affect the mRNA of HIF‐1α, presumably because HSP90 did not regulate HIF‐1α at the transcriptional level. This was consistent with the recognition that the protein–protein interaction between HSP90 and HIF‐1α controls HIF‐1α protein abundance (Liu and Semenza, 2007b). Based on these findings, we reasoned that HIF‐1α accumulation in HSCs was dependent at least on two mechanisms: (i) direct induction by the canonical hedgehog pathway at a transcriptional level and (ii) stabilization by HSP90, which was also transactivated by the canonical hedgehog pathway, at a post‐translational level. Interestingly, recent investigations suggested that the multifunctional scaffold protein receptor for activated C‐kinase 1 (RACK1) was an essential component of an oxygen‐independent mechanism for regulating HIF‐1α stability through competition with HSP90 (Liu et al., 2007a; Liu and Semenza, 2007b). The competition between HSP90 and RACK1 for interaction with HIF‐1α may establish a setpoint for HIF‐1α. Hence, additional experiments are necessary to determine whether RACK1 is also involved in canonical hedgehog regulation of HIF‐1α in HSCs.

We further validated the role of HSP90 in the angiogenic actions of HSCs. We observed that the HSP90 inhibitor reduced HIF‐1α binding to DNA sequence in HSCs, indicating a suppression of pro‐angiogenic transactivation of HIF‐1α. Propagation of hedgehog signalling by SAG resulted in increased expression of angiogenic cytokines and strengthened tubulogenesis capacity in HSCs, further supporting the positive regulation of HSC angiogenic behaviours by hedgehog. However, the HSP90 inhibitor blocked these effects, implying that canonical hedgehog stimulation of HSC angiogenic actions was, at least partly, dependent on HSP90. Several earlier studies have reported that the HSP90 inhibitor inhibited proliferation and induced cell cycle arrest in HSCs (Sun et al., 2009), induced HSC apoptosis (Myung et al., 2009) and attenuated thioacetamide‐induced liver fibrosis (Abu‐Elsaad et al., 2016). These data aggregately support HSP90 as a target for restraining the pro‐fibrogenic properties of HSCs.

We finally assessed the therapeutic implications of our mechanistic experiments. Ligustrazine interrupted the canonical hedgehog signalling in HSCs and also reduced the expression of HIF‐1α and HSP90, leading to attenuated angiogenic actions of these cells. Stimulation of hedgehog signalling by SAG in these experiments confirmed the dependence of the effects of ligustrazine on the hedgehog pathway . Experiments using cyclopamine as positive control also showed that ligustrazine improved hepatic injury and reduced fibrosis and decreased angiogenesis, in mice. More importantly, the molecular findings from our culture system were reproduced in mouse fibrotic liver. These results not only provided novel mechanistic insights into ligustrazine as a candidate antifibrotic drug but also indicated a translation of current molecular discoveries into effective action in vivo. However, our current data could not identify the direct target for ligustrazine. It is highly possible that ligustrazine acted on the upstream regulatory machinery of SMO, because the effects of this alkaloid were potently antagonized by SAG. Another issue raised from this study is that it is important to achieve selective inhibition of hedgehog signalling in HSCs for reducing hepatic angiogenesis and fibrosis, especially given recent evidence that steatohepatitis could be induced by inhibition of hepatocyte hedgehog signalling (Matz‐Soja et al., 2016). The biological role of hedgehog signalling could be dependent on cell types and pathological conditions. Encouragingly, a HSC‐targeted drug delivery system has been developed (Li and Wang, 2009), strengthening the therapeutic relevance of our current data.

In summary, we demonstrated that canonical hedgehog signalling regulated HSC‐mediated liver angiogenesis through transactivation of HIF‐1α and HSP 90 (as illustrated in Figure 8). Selective inhibition of hedgehog signalling in HSCs may represent a therapeutic option for hepatic fibrosis.

Figure 8.

Figure 8

Diagram illustrating the mechanisms by which canonical hedgehog signalling regulates HSC‐mediated angiogenesis in liver fibrosis.

Author contributions

F.Z. and S.Z. designed the research. F.Z., M.H., H.J., Z.Y. and N.L. performed the experiments and analysed the data. L.W. and J.S. provided technical assistance. A.C. critically revised the manuscript. F.Z. wrote the manuscript.

Conflict of interest

The authors declare no conflicts of interest.

Declaration of transparency and scientific rigour

This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research recommended by funding agencies, publishers and other organisations engaged with supporting research.

Supporting information

Figure S1 HSCs were treated with vehicle or 17‐AAG at 5 μM for 24 h. Immunofluorescence analyses of HIF‐1α (400× magnification) (n = 3). DAPI was used to stain the nucleus.

Figure S2 HSCs were treated with vehicle or 17‐AAG at 5 μM for 24 h. Western blot analyses of HSP90 and HIF‐1α in the input for co‐immunoprecipitation analyses of direct interaction between HSP90 and HIF‐1α (n = 2).

Figure S3 Mice were intraperitoneally injected with CCl4 to induce liver fibrosis for 8 weeks. During the weeks 5–8, mice in treatment groups were orally administrated cyclopamine at 30 mg·kg‐1 or ligustrazine at 80 mg·kg‐1. Quantification of Sirius Red staining with liver sections for collagen examination (200× magnification) (n = 10). *P < 0.05 versus control, #P < 0.05 versus CCl4, one‐way ANOVA with post hoc

Dunnett's test.

Figure S4 Mice were intraperitoneally injected with CCl4 to induce liver fibrosis for 8 weeks. During the weeks 5–8, mice in treatment groups were orally administrated cyclopamine at 30 mg·kg‐1 or ligustrazine at 80 mg·kg‐1. Immunofluorescence analyses of VEGF in liver tissues (400× magnification) (n = 10). Staining with α‐SMA was used to indicate HSCs. DAPI was used to stain the nucleus.

Table S1 Primer sequences of genes for real‐time PCR in this study.

Acknowledgements

This work was supported by the Natural Science Foundation of Jiangsu Province (BK20140955), the National Natural Science Foundation of China (31401210, 31571455, 31600653, and 81600483), the Natural Science Research General Program of Jiangsu Higher Education Institutions (14KJB310011), the Open Project Program of Jiangsu Key Laboratory for Pharmacology and Safety Evaluation of Chinese Materia Medica (JKLPSE 201502) and the Project of the Priority Academic Program Development of Jiangsu Higher Education Institutions (PADD), and was also sponsored by the Qing Lan Project of Jiangsu Province.

Zhang, F. , Hao, M. , Jin, H. , Yao, Z. , Lian, N. , Wu, L. , Shao, J. , Chen, A. , and Zheng, S. (2017) Canonical hedgehog signalling regulates hepatic stellate cell‐mediated angiogenesis in liver fibrosis. British Journal of Pharmacology, 174: 409–423. doi: 10.1111/bph.13701.

References

  1. Abu‐Elsaad NM, Serrya MS, El‐Karef AM, Ibrahim TM (2016). The heat shock protein 90 inhibitor, 17‐AAG, attenuates thioacetamide induced liver fibrosis in mice. Pharmacol Rep 68: 275–282. [DOI] [PubMed] [Google Scholar]
  2. Alexander SP, Davenport AP, Kelly E, Marrion N, Peters JA, Benson HE et al. (2015a). The Concise Guide to PHARMACOLOGY 2015/16: G protein‐coupled receptors. Br J Pharmacol 172: 5744–5869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Alexander SPH, Fabbro D, Kelly E, Marrion N, Peters JA, Benson HE et al. (2015b). The Concise Guide to PHARMACOLOGY 2015/16: Catalytic receptors. Br J Pharmacol 172: 5979–6023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Caliceti C, Aquila G, Pannella M, Morelli MB, Fortini C, Pinton P et al. (2013). 17beta‐estradiol enhances signalling mediated by VEGF‐A‐delta‐like ligand 4‐notch1 axis in human endothelial cells. PLoS One 8: e71440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen Y, Choi SS, Michelotti GA, Chan IS, Swiderska‐Syn M, Karaca GF et al. (2012). Hedgehog controls hepatic stellate cell fate by regulating metabolism. Gastroenterology 143: e1311–e1311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Choi SS, Omenetti A, Syn WK, Diehl AM (2011). The role of hedgehog signaling in fibrogenic liver repair. Int J Biochem Cell Biol 43: 238–244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Copple BL, Bai S, Burgoon LD, Moon JO (2011). Hypoxia‐inducible factor‐1alpha regulates the expression of genes in hypoxic hepatic stellate cells important for collagen deposition and angiogenesis. Liver Int 31: 230–244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Curtis MJ, Bond RA, Spina D, Ahluwalia A, Alexander SP, Giembycz MA et al. (2015). Experimental design and analysis and their reporting: new guidance for publication in BJP. Br J Pharmacol 172: 3461–3471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Guy CD, Suzuki A, Zdanowicz M, Abdelmalek MF, Burchette J, Unalp A et al. (2012). Hedgehog pathway activation parallels histologic severity of injury and fibrosis in human nonalcoholic fatty liver disease. Hepatology 55: 1711–1721. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Hennenberg M, Trebicka J, Stark C, Kohistani AZ, Heller J, Sauerbruch T (2009). Sorafenib targets dysregulated Rho kinase expression and portal hypertension in rats with secondary biliary cirrhosis. Br J Pharmacol 157: 258–270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hernandez‐Gea V, Friedman SL (2011). Pathogenesis of liver fibrosis. Annu Rev Pathol 6: 425–456. [DOI] [PubMed] [Google Scholar]
  12. Hu L, Lin X, Lu H, Chen B, Bai Y (2015). An overview of hedgehog signaling in fibrosis. Mol Pharmacol 87: 174–182. [DOI] [PubMed] [Google Scholar]
  13. Katoh Y, Katoh M (2009). Hedgehog target genes: mechanisms of carcinogenesis induced by aberrant hedgehog signaling activation. Curr Mol Med 9: 873–886. [DOI] [PubMed] [Google Scholar]
  14. Kilkenny C, Browne W, Cuthill IC, Emerson M, Altman DG (2010). Animal research: Reporting in vivo experiments: the ARRIVE guidelines. Br J Pharmacol 160: 1577–1579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Kwon H, Song K, Han C, Chen W, Wang Y, Dash S et al. (2016). Inhibition of hedgehog signaling ameliorates hepatic inflammation in mice with nonalcoholic fatty liver disease. Hepatology 63: 1155–1169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Lee JS, Semela D, Iredale J, Shah VH (2007a). Sinusoidal remodeling and angiogenesis: a new function for the liver‐specific pericyte? Hepatology 45: 817–825. [DOI] [PubMed] [Google Scholar]
  17. Lee SW, Moskowitz MA, Sims JR (2007b). Sonic hedgehog inversely regulates the expression of angiopoietin‐1 and angiopoietin‐2 in fibroblasts. Int J Mol Med 19: 445–451. [PubMed] [Google Scholar]
  18. Li F, Wang JY (2009). Targeted delivery of drugs for liver fibrosis. Expert Opin Drug Deliv 6: 531–541. [DOI] [PubMed] [Google Scholar]
  19. Lian N, Jiang Y, Zhang F, Jin H, Lu C, Wu X et al. (2015). Curcumin regulates cell fate and metabolism by inhibiting hedgehog signaling in hepatic stellate cells. Lab Invest 95: 790–803. [DOI] [PubMed] [Google Scholar]
  20. Liu YV, Baek JH, Zhang H, Diez R, Cole RN, Semenza GL (2007a). RACK1 competes with HSP90 for binding to HIF‐1alpha and is required for O(2)‐independent and HSP90 inhibitor‐induced degradation of HIF‐1alpha. Mol Cell 25: 207–217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Liu YV, Semenza GL (2007b). RACK1 vs. HSP90: competition for HIF‐1 alpha degradation vs. stabilization. Cell Cycle 6: 656–659. [DOI] [PubMed] [Google Scholar]
  22. Matz‐Soja M, Rennert C, Schonefeld K, Aleithe S, Boettger J, Schmidt‐Heck W et al. (2016). Hedgehog signaling is a potent regulator of liver lipid metabolism and reveals a GLI‐code associated with steatosis. Elife 5: e13308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. McGrath JC, Lilley E (2015). Implementing guidelines on reporting research using animals (ARRIVE etc.): new requirements for publication in BJP. Br J Pharmacol 172: 3189–3193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Mejias M, Garcia‐Pras E, Tiani C, Miquel R, Bosch J, Fernandez M (2009). Beneficial effects of sorafenib on splanchnic, intrahepatic, and portocollateral circulations in portal hypertensive and cirrhotic rats. Hepatology 49: 1245–1256. [DOI] [PubMed] [Google Scholar]
  25. Myung SJ, Yoon JH, Kim BH, Lee JH, Jung EU, Lee HS (2009). Heat shock protein 90 inhibitor induces apoptosis and attenuates activation of hepatic stellate cells. J Pharmacol Exp Ther 330: 276–282. [DOI] [PubMed] [Google Scholar]
  26. Neckers L, Ivy SP (2003). Heat shock protein 90. Curr Opin Oncol 15: 419–424. [DOI] [PubMed] [Google Scholar]
  27. Novo E, Povero D, Busletta C, Paternostro C, di Bonzo LV, Cannito S et al. (2012). The biphasic nature of hypoxia‐induced directional migration of activated human hepatic stellate cells. J Pathol 226: 588–597. [DOI] [PubMed] [Google Scholar]
  28. Omenetti A, Choi S, Michelotti G, Diehl AM (2011). Hedgehog signaling in the liver. J Hepatol 54: 366–373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Onishi H, Kai M, Odate S, Iwasaki H, Morifuji Y, Ogino T   et al. (2011). Hypoxia activates the hedgehog signaling pathway in a ligand‐independent manner by upregulation of SMO transcription in pancreatic cancer. Cancer Sci 102: 1144–1150. [DOI] [PubMed] [Google Scholar]
  30. Rosmorduc O, Housset C (2010). Hypoxia: a link between fibrogenesis, angiogenesis, and carcinogenesis in liver disease. Semin Liver Dis 30: 258–270. [DOI] [PubMed] [Google Scholar]
  31. Schmittgen TD, Zakrajsek BA, Mills AG, Gorn V, Singer MJ, Reed MW (2000). Quantitative reverse transcription‐polymerase chain reaction to study mRNA decay: comparison of endpoint and real‐time methods. Anal Biochem 285: 194–204. [DOI] [PubMed] [Google Scholar]
  32. Southan C, Sharman JL, Benson HE, Faccenda E, Pawson AJ, Alexander SP et al. (2016). The IUPHAR/BPS Guide to PHARMACOLOGY in 2016: towards curated quantitative interactions between 1300 protein targets and 6000 ligands. Nucleic Acids Res 44: D1054–D1068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Sun X, Zhang XD, Cheng G, Hu YH, Wang HY (2009). Inhibition of hepatic stellate cell proliferation by heat shock protein 90 inhibitors in vitro. Mol Cell Biochem 330: 181–185. [DOI] [PubMed] [Google Scholar]
  34. Thabut D, Shah V (2010). Intrahepatic angiogenesis and sinusoidal remodeling in chronic liver disease: new targets for the treatment of portal hypertension? J Hepatol 53: 976–980. [DOI] [PubMed] [Google Scholar]
  35. Tugues S, Fernandez‐Varo G, Munoz‐Luque J, Ros J, Arroyo V, Rodes J et al. (2007). Antiangiogenic treatment with sunitinib ameliorates inflammatory infiltrate, fibrosis, and portal pressure in cirrhotic rats. Hepatology 46: 1919–1926. [DOI] [PubMed] [Google Scholar]
  36. Wang Y, Huang Y, Guan F, Xiao Y, Deng J, Chen H et al. (2013). Hypoxia‐inducible factor‐1alpha and MAPK co‐regulate activation of hepatic stellate cells upon hypoxia stimulation. PLoS One 8: e74051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Xie G, Choi SS, Syn WK, Michelotti GA, Swiderska M, Karaca G et al. (2013). Hedgehog signalling regulates liver sinusoidal endothelial cell capillarisation. Gut 62: 299–309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zhan L, Huang C, Meng XM, Song Y, Wu XQ, Yang Y   et al. (2015). Hypoxia‐inducible factor‐1alpha in hepatic fibrosis: a promising therapeutic target. Biochimie 108: 1–7. [DOI] [PubMed] [Google Scholar]
  39. Zhang F, Kong DS, Zhang ZL, Lei N, Zhu XJ, Zhang XP et al. (2013). Tetramethylpyrazine induces G0/G1 cell cycle arrest and stimulates mitochondrial‐mediated and caspase‐dependent apoptosis through modulating ERK/p53 signaling in hepatic stellate cells in vitro. Apoptosis 18: 135–149. [DOI] [PubMed] [Google Scholar]
  40. Zhang F, Ni C, Kong D, Zhang X, Zhu X, Chen L et al. (2012). Ligustrazine attenuates oxidative stress‐induced activation of hepatic stellate cells by interrupting platelet‐derived growth factor‐beta receptor‐mediated ERK and p38 pathways. Toxicol Appl Pharmacol 265: 51–60. [DOI] [PubMed] [Google Scholar]
  41. Zhang F, Zhang Z, Kong D, Zhang X, Chen L, Zhu X et al. (2014). Tetramethylpyrazine reduces glucose and insulin‐induced activation of hepatic stellate cells by inhibiting insulin receptor‐mediated PI3K/AKT and ERK pathways. Mol Cell Endocrinol 382: 197–204. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1 HSCs were treated with vehicle or 17‐AAG at 5 μM for 24 h. Immunofluorescence analyses of HIF‐1α (400× magnification) (n = 3). DAPI was used to stain the nucleus.

Figure S2 HSCs were treated with vehicle or 17‐AAG at 5 μM for 24 h. Western blot analyses of HSP90 and HIF‐1α in the input for co‐immunoprecipitation analyses of direct interaction between HSP90 and HIF‐1α (n = 2).

Figure S3 Mice were intraperitoneally injected with CCl4 to induce liver fibrosis for 8 weeks. During the weeks 5–8, mice in treatment groups were orally administrated cyclopamine at 30 mg·kg‐1 or ligustrazine at 80 mg·kg‐1. Quantification of Sirius Red staining with liver sections for collagen examination (200× magnification) (n = 10). *P < 0.05 versus control, #P < 0.05 versus CCl4, one‐way ANOVA with post hoc

Dunnett's test.

Figure S4 Mice were intraperitoneally injected with CCl4 to induce liver fibrosis for 8 weeks. During the weeks 5–8, mice in treatment groups were orally administrated cyclopamine at 30 mg·kg‐1 or ligustrazine at 80 mg·kg‐1. Immunofluorescence analyses of VEGF in liver tissues (400× magnification) (n = 10). Staining with α‐SMA was used to indicate HSCs. DAPI was used to stain the nucleus.

Table S1 Primer sequences of genes for real‐time PCR in this study.


Articles from British Journal of Pharmacology are provided here courtesy of The British Pharmacological Society

RESOURCES