Skip to main content
Iranian Journal of Veterinary Research logoLink to Iranian Journal of Veterinary Research
. 2016 Autumn;17(4):273–276.

Isolation of Clostridium difficile and molecular detection of binary and A/B toxins in faeces of dogs

M Ghavidel 1, H Salari Sedigh 2,*, J Razmyar 2
PMCID: PMC5309461  PMID: 28224013

Abstract

The aim of this study was to isolate Clostridium difficile from dogs’ faeces, and to study the frequency of its virulence genes. A total of 151 samples of dogs’ faeces were collected. The isolation of C. difficile was performed by using the bacterial culture methods followed by DNA extraction using boiling method. Multiplex PCR method was performed for identification of tcdA, tcdB, cdtA and cdtB genes and single method was carried out for detection of tcdC. Twelve samples (7.9%) were positive in bacteriological assay and based on molecular assay, 66.7% of the isolates (8 of 12 C. difficile isolated) had shown tcdA+, tcdB+ profile. This is the first investigation on molecular assay of C. difficile in Iran’s dog population.

Key Words: Clostridium difficile, Dog, Molecular detection

Introduction

Clostridium difficile is a Gram-positive spore-forming anaerobic bacillus which has been identified as a main bacterial pathogen in both human and animals’ intestine. It is a common cause of enteritis in a variety of animal species (Doosti and Mokhtari-Farsani, 2014 ▶). In addition, some reports have recently raised the importance of wild animals as a reservoir of C. difficile for humans and domestic animals.

A number of bacterial organisms commonly associated with diarrhea in dogs and cats include Salmonella, Campylobacter, Clostridium perfringens and C. difficile (Marks et al., 2011 ▶).

Two large clostridial toxins A and B (TcdA and TcdB) were among the main virulence factors. TcdA and TcdB are strong cytotoxic enzymes damaging the human colonic mucosa (Deneve et al., 2009 ▶).

TcdA and TcdB in the pathogenicity locus are controlled by two regulators, TcdR and TcdC. TcdR is an alternative sigma factor which positively regulates transcription of tcdA and tcdB while TcdC may function as an anti-sigma factor impeding the activity of TcdR, although some researches have reported that TcdC does not influence toxin production (McKee et al., 2013 ▶).

The C. difficile ADP-ribosyltransferase was a binary toxin consisting of two independently coded protein components: a binding component (CDTb) and an enzymatic component (CDTa) which catalyzes the ADP-ribosylation of monomeric action, inducing alterations in the cytoskeleton (Marks and Kather, 2003 ▶).

In dogs, pathogenicity and the importance of C. difficile is not fully understood as yet. Clinical signs that have been associated with canine C. difficile infection range from asymptomatic carrier to a potentially fatal acute hemorrhagic diarrheal syndrome (Marks et al., 2011 ▶).

A simple and quick method is required in order to distinguish toxigenic and non-toxigenic strains of C. difficile in dogs. The objective of the current study was to investigate the molecular characteristics of various isolates of C. difficile isolated from diarrheic and non-diarrheic dogs, through the use of toxin gene profiling.

Materials and Methods

A total of 151 faecal samples was collected from 151 dogs, 131 of which were apparently healthy and 20 were diarrheic. The samples from diarrheic dogs were obtained directly from the rectum, in a veterinary teaching clinic at the time of consultation and were only collected from dogs in which the main motivation for the consultation was the occurrence of diarrhea. There were 60 male and 91 female dogs, aged from 3 months to 11 years.

Isolation and identification of C. difficile were performed according to standard procedures (Fedorko et al., 1997 ▶; Pituch et al., 2002 ▶). Two or three passages were done to obtain the pure culture. Reference strains of C. difficile were used as positive controls.

A single colony of each strain was suspended in 100 µL distilled water, boiled for 10 min and then centrifuged at 10,000 × g for 10 min. The supernatants were collected carefully and used as template DNA for PCR (Aldous et al., 2005 ▶).

A 5-plex PCR was performed for the detection of tcdA, tcdB, cdtA, cdtB and 16S rDNA based on Persson et al. (2008) ▶. The tcdC analysis was performed based on Antikainen et al. (2009) ▶, primer list was shown in Table 1. PCR products were fractionated by electrophoresis in 1.5% agarose gels. Data analysis was performed by using SPSS software (SPSS 19.0). Correlation between positive bacteria samples and diarrhea, gender and age was assessed by Chi-square. A p-value <0.05 was considered significant.

Table 1.

Multiplex PCR primer and single PCR primer in this study

Analysis Gene target Primer name Sequence (5´-3´) Primer concentration (µM) Amplicon size
(bp)
Reference
5-plex PCR tcdA tcdA-F3345 GCATGATAAGGCAACTTCAGTGGTAa 0.6 629 Persson et al. (2008)
tcdA-R3969 AGTTCCTCCTGCTCCATCAAATG 0.6
tcdB tcdB-F5670 CCAAARTGGAGTGTTACAAACAGGTG 0.4 410 Persson et al. (2008)
tcdB-R6079A GCATTTCTCCATTCTCAGCAAAGTA 0.2
cdtA cdtA-F739A GGGAAGCACTATATTAAAGCAGAAGC 0.05 221 Persson et al. (2008)
cdtA-F739B GGGAAACATTATATTAAAGCAGAAGC 0.05
cdtA-R958 CTGGGTTAGGATTATTTACTGGACCA 0.1
ctdB ctdB-F617 TTGACCCAAAGTTGATGTCTGATTG 0.1 262 Persson et al. (2008)
cdtB-R878 CGGATCTCTTGCTTCAGTCTTTATAG 0.1
16S rDNA PS13 GGAGGCAGCAGTGGGGAATA 0.05 1062 Persson et al. (2008)
PS14 TGACGGGCGGTGTGTACAAG 0.05
tcdC analysis tcdC tcdC-121-F AAGCTATTGAAGCTGAAAATC 0.15 139 (intact) Antikainen et al. (2009)
tcdC-121-R GCTAATTGGTCATAAGTAATACC 0.15

Results

Twelve C. difficile (7.9%) were isolated from dog faeces in Columbia agar. Twelve C. difficile which have been selected for multiplex PCR. The isolation rate was as follows: diarrheic dogs (4/20: 20%) and healthy dogs (8/131: 6.1%). Out of 91 female dogs 10 (11.8%), and of 60 male dogs 2 (3.2%), were positive in culture. Ten isolates belonged to dogs aged below 3 years old (8.3%) and 2 isolates in dogs above 3 years old (6.6%).

All 12 isolates were confirmed to have 1062 bp band (16S rDNA) of C. difficle (7.9%) (Table 2). Clostridium difficile toxins A and B were identified in faeces of 8 (66.7%) samples of 12 isolates and four isolates (33.3%) were non-toxigenic (tcdA-, tcdB-).

Table 2.

Identification of C. difficile isolated form canine faecal samples complemented with other data

Dogs Closteridium difficile
Total
16s RND
tcdA+, tcdB+, tcdC+ (139 bp)
16s RND
tcdA+, tcdB+, tcdC+ (139 bp), ctdAB+
16s RND
tcdA+, tcdB+, tcdC+ (85 bp)
16s RND
tcdA-, tcdB-, tcdC-
Diarrheic 4/4 (100%) - - - 4/4 (100%)
4/20 (20%) - - - 4/20 (20%)
Non-diarrheic 3/8 (37.5%) 1/8 (12.5%) 2/8 (25%) 2/8 (25%) 8/8 (100%)
3/131 (2.2%) 1/131 (0.8%) 2/131 (1.5%) 2/131 (1.5%) 8/131 (6.1%)
Total 7/12 (58.3%) 1/12 (8.3%) 2/12 (16.7%) 2/12 (16.7%) 12/151 (7.9%)
7/151 (4.6%) 1/151 (0.7%) 2/151 (1.3%) 2/151 (1.3%)
Female 6/10 (60%) - 2/10 (20%) 2/10 (20%) 10/10 (100%)
6/91 (6.6%) - 2/91 (2.2%) 2/91 (2.2%) 10/91 (11%)
Male 1/2 (50%) 1/2 (50%) - - 2/2 (100%)
1/60 (1.7%) 1/60 (1.7%) - - 2/60 (3.3%)
Total 7/12 (58.3%) 1/12 (8.3%) 2/12 (16.7%) 2/12 (16.7%) 12/12 (100%)
7/151 (4.6%) 1/151 (0.7%) 2/151 (1.3%) 2/151 (1.3%) 12/151 (7.9%)
Age ≤3 years 7/10 (70%) - 1/10 (10%) 2/10 (20%) 10/10 (100%)
7/121 (5.8%) - 1/121 (0.8%) 2/121 (1.6%) 10/121 (8.2%)
Age >3 years - 1/2 (50%) 1/2 (50%) - 2/2 (100%)
- 1/30 (3.3%) 1/30 (3.3%) - 2/30 (6.7%)
Total 7/12 (58.3%) 1/12 (8.3%) 2/12 (16.7%) 2/12 (16.7%) 12/12 (100%)
7/151 (4.6%) 1/151 (0.7%) 2/151 (1.3%) 2/151 (1.3%) 12/151 (7.9%)

One isolate possessed binary toxin (cdtA, ctdB) in addition to tcdA and tcdB belonging to non-diarrheic dog. TcdC band includes: (139, 121, 100 or 85 bp) 2 isolates with 85 bp band and 2 tcdC gene negative isolates which were also 16s rDNA positive and non-toxigenic. Eight isolates have 139 bp bands, 4 of which were related to diarrheic dogs.

There was not any significant correlation between positive C. difficle and dogs’ diarrhea (P=0.055) nor between positive C. difficle and gender (P=0.085). In this study, dogs were thus divided into three age categories:

Under 1 year, 1-3 years and More than 3 years in which correlations between age and positive C. difficle isolated were not significant (P=0.856).

Discussion

Clostridium difficile has been isolated from almost all mammals (Dabard et al., 1979 ▶; Frazier et al., 1993 ▶; Hasanzade et al., 2013 ▶).

In Iran several studies have been performed for detection of C. difficile (Jalali et al., 2012 ▶; Fooladi et al., 2014 ▶; Rahimi et al., 2014 ▶) but this study is the first investigation on C. difficile isolated from dog population in Iran. Many researches on animals concentrate on the presence of the bacterium in healthy animals. Investigation on the role of household pets as a possible reservoir of C. difficile revealed that both healthy and diseased dogs and cats can shed spores of C. difficile (Riley et al., 1991 ▶).

Colonization of humans by C. difficile can produce enteric symptoms termed CDI, ranging from asympto-matic intestinal colonization to diarrhea. The most common transmission routes of C. difficile include: direct transmission from human to human, direct contact with the animals and environment, aerosol transmission and consuming contaminated food and water (Ghose, 2013 ▶).

There have been several studies worldwide aimed at isolating and molecular typing C. difficile in dogs (Marks et al., 2002 ▶; Kevin et al., 2007 ▶; Clooten et al., 2008 ▶; Koene et al., 2011 ▶; Ossiprandi et al., 2012 ▶; Silva et al., 2013 ▶).

In this study, 12 isolates of C. difficile were isolated from 151 dogs (7.9%) in which the number of dogs being C. difficile positive was lower than other recent reports (O’Neill et al., 1993 ▶; Marks et al., 2002 ▶; Kevin et al., 2007 ▶), however two other studies have reported a lower rate of C. difficile in comparison with the current study (Weese et al., 2001 ▶; Wetterwik et al., 2013 ▶) 2%, 5.7% positive samples, respectively.

In this study, 8 of the 12 isolates (66.6%) were toxigenic (tcdA+, tcdB+). Our research was similar to that of Ossiprandi et al. (2012 ▶). The last research signifies that 60% of the isolates were toxigenic (tcdA+, tcdB+). Clooten et al. (2008) ▶ found that 69% of the isolates were toxigenic (tcdA+, tcdB+).

In the current study, one isolate possessed binary toxin gene which was A+ B + and was derived from non-diarrheic dog. Silva et al. (2013) ▶ found one strain with this characteristic.

In this study, we observed the fact that 4 isolates showed tcdA+, tcdB+ and tcdC+ patterns, while the subjects have shown clinical signs of diarrhea which might be due to the variability of tcdC alleles among toxigenic isolates. There have been reports indicating C. difficile isolates being characterized by a non-specific in-frame 18 bp deletion and a specific point deletion at position 117, which results in a frame-shift mutation introducing a stop codon at position 196. This phenomenon leads to a truncated, inactive TcdC protein, the severe truncation of this protein, therefore, seems responsible for the increased toxin production in these pathogenic C. difficile isolates which would usually negatively regulate toxin production (Deneve et al., 2009 ▶).

Acknowledgements

The research leading to these results was funded by a grant (No. 16142) from the Research Council of the Ferdowsi University of Mashhad. We would like to thank Mr. A. Kargar for his assistance in the laboratory work, Prof. A. Barin and Dr. T. Pirzadeh for providing reference strains.

Conflict of interest

The authors declare no potential conflicts of interest.

References

  1. Aldous WK, Pounder JI, Cloud JL, Woods GL. Comparison of six methods of extracting Mycobacterium tuberculosis DNA from processed sputum for testing by quantitative real-time PCR. J. Clin. Microbiol. 2005;43:2471–2473. doi: 10.1128/JCM.43.5.2471-2473.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Antikainen J, Pasanen T, Mero S, Tarkka E, Kirveskari J, Kotila S, Mentula S, Könönen E, Virolainen‐ Julkunen AR, Vaara M. Detection of virulence genes of Clostridium difficile by multiplex PCR. APMIS. 2009;117:607–613. doi: 10.1111/j.1600-0463.2009.02509.x. [DOI] [PubMed] [Google Scholar]
  3. Clooten J, Kruth S, Arroyo L, Weese JS. Prevalence and risk factors for Clostridium difficile colonization in dogs and cats hospitalized in an intensive care unit. Vet. Microbiol. 2008;129:209–214. doi: 10.1016/j.vetmic.2007.11.013. [DOI] [PubMed] [Google Scholar]
  4. Dabard J, Dubos F, Martinet L, Ducluzeau R. Experimental reproduction of neonatal diarrhea in young gnotobiotic hares simultaneously associated with Clostridium difficile and other Clostridium strains. Infect. Immun. 1979;24:7–11. doi: 10.1128/iai.24.1.7-11.1979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Deneve, C , Janoir, C , Poilane, I , Fantinato, C , Collignon, A New trends in Clostridium difficile virulence and pathogenesis. Int. J. Antimicrob. Agents. 2009;33:S24–S28. doi: 10.1016/S0924-8579(09)70012-3. [DOI] [PubMed] [Google Scholar]
  6. Doosti A, Mokhtari-Farsani A. Study of the frequency of Clostridium difficiletcdA, tcdB, cdtA and cdtB genes in feces of calves in south west of Iran. Ann. Clin. Microbiol. Antimicrob. 2014;13:1–6. doi: 10.1186/1476-0711-13-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Fedorko DP, Williams EC. Use of cycloserine-cefoxitinfructose agar and L-proline-aminopeptidase (PRO Discs) in the rapid identification of Clostridium difficile. J. Clinic. Microbiol. 1997;35:1258–1259. doi: 10.1128/jcm.35.5.1258-1259.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Fooladi AAI, Rahmati S, Abadi JFM, Halabian R, Sedighian H, Soltanpour MJ, Rahimi M. Isolation of Clostridium difficile and detection of A and B toxins encoding genes. Int. J. Entric. Pathog. 2014;2:e15238. [Google Scholar]
  9. Frazier KS, Herron AJ, Hines ME, Gaskin JM, Altman NH. Diagnosis of enteritis and entero-toxemia due to Clostridium difficile in captive ostriches (Struthio camelus) J. Vet. Diagn. Invest. 1993;5:623–625. doi: 10.1177/104063879300500422. [DOI] [PubMed] [Google Scholar]
  10. Ghose C. Clostridium difficile infection in the twenty-first century. Emerg. Microbes. Infect. 2013;2:1–8. doi: 10.1038/emi.2013.62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hasanzade A, Rahimi E. Isolation of Clostridium difficile from turkey and ostrich meat sold in meat stores of Isfahan city. I.J.A.B.B.R. 2013;1:963–967. [Google Scholar]
  12. Jalali, M , Khorvash, F , Warriner, K , Weese, JS Clostridium difficile infection in an Iranian hospital. BMC. Res. Notes. 2012;5:159. doi: 10.1186/1756-0500-5-159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Kevin K, Brazier JS, Post KW, Weese S, Songer JG. Prevalence of PCR ribotypes among Clostridium difficile isolates from pigs, calves, and other species. J. Clin. Microbiol. 2007;45:1963–1964. doi: 10.1128/JCM.00224-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Koene MGJ, Mevius D, Wagenaar JA, Harmanus C, Hensgens MPM, Meetsma AM, Putirulan FF, Bergen MAP, Kuijper EJ. Clostridium difficile in Dutch animals: their presence, characteristics and similarities with human isolates. Clin. Microbiol. Infect. 2011;18:778–784. doi: 10.1111/j.1469-0691.2011.03651.x. [DOI] [PubMed] [Google Scholar]
  15. Marks SL, Kather EJ. Antimicrobial sus-ceptibilities of canine Clostridium difficile and Clostridium perfringens isolates to commonly utilized antimicrobial drugs. Vet. Microbiol. 2003;94:39–45. doi: 10.1016/s0378-1135(03)00061-0. [DOI] [PubMed] [Google Scholar]
  16. Marks S, Kather EJ, Kass PH, Melli AC. Genotypic and phenotypic characterization of Clostridium perfringens and Clostridium difficile in diarrheic and healthy dogs. J. Vet. Intern. Med. 2002;16:533–540. doi: 10.1892/0891-6640(2002)016<0533:gapcop>2.3.co;2. [DOI] [PubMed] [Google Scholar]
  17. Marks S, Rankin S, Byrne B, Weese J. Enteropathogenic bacteria in dogs and cats: diagnosis, epidemiology, treatment, and control. J. Vet. Intern. Med. 2011;25:1195–1208. doi: 10.1111/j.1939-1676.2011.00821.x. [DOI] [PubMed] [Google Scholar]
  18. McKee R, Mangalea M, Purcell E, Borchardt E, Tamayo R. The second messenger cyclic Di-GMP regulates Clostridium difficile toxin production by controlling expression of sigD. J. Bacteriol. 2013;195:5174–5185. doi: 10.1128/JB.00501-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. O’Neill G, Adams JE, Bowman RA, Riley TV. A molecular characterization of Clostridium difficile isolates from humans, animals and their environments. Epidemiol. Infect. 1993;111:257–264. doi: 10.1017/s095026880005696x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Ossiprandi MC, Buttrini M, Bottarelli E, Zerbini L. A preliminary molecular typing by PCR assays of Clostridium perfringens and Clostridium difficile isolates from dogs. AiM. 2012;2:87–92. [Google Scholar]
  21. Persson S, Torpdahl M, Olsen KEP. New multiplex PCR method for the detection of Clostridium difficile toxin A (tcdA) and toxin B (tcdB) and the binary toxin (cdtA⁄cdtB) genes applied to a Danish strain collection. Clin. Microbiol. Infect. 2008;14:1057–1064. doi: 10.1111/j.1469-0691.2008.02092.x. [DOI] [PubMed] [Google Scholar]
  22. Pituch H, Obuch‐Woszczatyñski P, Van Den Braak N, Van Belkum A, Kujawa M, Luczak M, Meisel‐ Mikolajczyk F. Variable flagella expression among clonal toxin A–/B+ Clostridium difficile strains with highly homogeneous flagellin genes. Clin. Microbiol. Infect. 2002;8:187–188. doi: 10.1046/j.1469-0691.2002.00394.x. [DOI] [PubMed] [Google Scholar]
  23. Rahimi, E , Jalali, M , Weese, JS Prevalence of Clostridium difficile in raw beef, cow, sheep, goat, camel and buffalo meat in Iran. BMC. Public Health. 2014;14:119. doi: 10.1186/1471-2458-14-119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Riley T, Adams J, O’Neill G, Bowman R. Gastrointestinal carriage of Clostridium difficile in cats and dogs attending veterinary clinics. Epidemiol. Infect. 1991;107:659–665. doi: 10.1017/s0950268800049359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Silva ROS, Santos RLR, Pires PS, Pereira LC, Duarte MC, de Assis RA, Lobato FC. Detection of toxins A/B and isolation of Clostridium difficile and Clostridium perfringens from dogs in Minas Gerais, Brazil. Braz. J. Microbiol. 2013;44:133–137. doi: 10.1590/S1517-83822013005000008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Weese JS, Staempfli HR, Prescott JF, Kruth SA, Greenwood SJ, Weese HE. The roles of Clostridium difficile and enterotoxigenic Clostridium perfringens in diarrhea in dogs. J. Vet. Intern. Med. 2001;15:374–378. [PubMed] [Google Scholar]
  27. Wetterwik K, Trowald-Wigh G, Fernström L, Krovacek K. Clostridium difficile in faeces from healthy dogs and dogs with diarrhea. Acta Vet. Scand. 2013;55:23. doi: 10.1186/1751-0147-55-23. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Iranian Journal of Veterinary Research are provided here courtesy of Shiraz University

RESOURCES