Abstract
Premise of the study:
Microsatellite primers were developed in Pinus kesiya var. langbianensis (Pinaceae), a species native to southwestern China, to investigate its genetic diversity and population structure in order to provide information for the conservation and management of this species.
Methods and Results:
Using next-generation sequencing, a total of 2349 putative simple sequence repeat primer pairs were designed. Eighteen polymorphic markers in 60 individuals belonging to four populations of P. kesiya var. langbianensis were identified and characterized with two to 11 alleles per locus. The observed and expected heterozygosity ranged from 0.000 to 0.800 and 0.000 to 0.840, respectively. Each of these loci cross-amplified in the closely related species P. massoniana, P. densata, P. tabuliformis, and P. yunnanensis, with one to seven alleles per locus.
Conclusions:
The new markers are promising tools to study the population genetics of P. kesiya var. langbianensis and related species.
Keywords: microsatellite, next-generation sequencing, Pinaceae, Pinus kesiya var. langbianensis, population genetics
Pinus kesiya Royle ex Gordon var. langbianensis (A. Chev.) Gaussen (Pinaceae) is an important forest tree species in Yunnan Province, China. It has been recorded at altitudes from 600–1800 m in the southern, semihumid climate zone of Yunnan (Editorial Committee of Flora of China, 1978; Wu, 1986) and accounts for 11% of the forest area and 1.0 × 108 m3 of the forest volume (Jiang et al., 2007). The wood is extensively used in building, furniture, and the fiber industry. Pinus kesiya var. langbianensis is also highly valued for its high resin content, with an annual output of 179,100,000 kg (Editorial Committee of Flora of China, 1978; Wu, 1986; Dong et al., 2009). Output of gum turpentine from P. kesiya var. langbianensis accounted for more than 90% of the total output in Yunnan (Yin et al., 2005). However, germplasm resources of P. kesiya var. langbianensis have decreased in recent years as a result of overexploitation (Zhao et al., 2016).
Information on genetic diversity and spatial structure in P. kesiya var. langbianensis is important for its future conservation and can be used to help guide local forest management (Sanchez et al., 2014). No specific conservation strategy is available for this species, in part due to the limited understanding of genetic diversity and structure of the natural populations. As a primary forest tree species in southern Yunnan Province, resource conservation of P. kesiya var. langbianensis will benefit the entire ecological system in the region (Li et al., 2015). Therefore, in this study we developed novel microsatellite markers for P. kesiya var. langbianensis by applying next-generation sequencing to investigate the genetic diversity and population structure of this species at the molecular level.
METHODS AND RESULTS
Needle samples of 60 individuals from four P. kesiya var. langbianensis populations located in Yunnan Province, China, and 59 individuals from four related species (P. massoniana D. Don, P. densata Mast, P. tabuliformis Carrière, P. yunnanensis Franch.) were collected (Appendix 1). All needle samples were dried and preserved in silica gel. Total genomic DNA was isolated from dried needle samples using the cetyltrimethylammonium bromide (CTAB) method (Doyle and Doyle, 1990). Paired-end libraries were constructed on four individuals sampled from Puer City Institute of Forestry Sciences and sequenced by a customer sequencing service (Beijing Honor Tech Co. Ltd., Beijing, China) using the Illumina HiSeq 2500 Sequencing System (Illumina, San Diego, California, USA). Clean reads were assembled using Trinity version 2.2.0 (https://github.com/trinityrnaseq/trinityrnaseq/wiki; Grabherr et al., 2011; Haas et al., 2013). Data quality control was carried out with the software FastQC (Andrews, 2010). The Q30 percentage exceeded 90% and the GC contents were 45.60–46.56%, which suggests that the sequencing was highly reliable. Data filtering was carried out according to the following criteria: (1) removed reads with adapters; (2) removed reads with unknown bases >10%; and (3) removed low-quality reads (defined as reads having >50% bases with quality value ≤5). A total of 104,392 unigenes were obtained with an N50 length of 1349 bp. The data have been deposited in the Short Read Archive (SRA) database of the National Center for Biotechnology Information (NCBI; accession no. SRP093696). Genomic microsatellite loci for P. kesiya var. langbianensis were detected using the software MicroSAtellite Identification Tool (MISA; Thiel et al., 2003). Two thousand three hundred forty-nine simple sequence repeat (SSR) loci were designed with Primer Premier 5.0 (PREMIER Biosoft International, Palo Alto, California, USA). Among them, 192 SSR loci with dinucleotide or trinucleotide SSR motifs were randomly chosen to screen using four individuals from four populations. One hundred fifty-nine out of 192 SSR loci were amplified successfully, and 79 out of 159 SSR loci were polymorphic. Eighteen polymorphic SSR loci (Table 1) were then randomly selected for characterization using 60 individuals from four populations (Appendix 1). The SSR amplifications were multiplexed in a 10-μL reaction containing 30 ng of genomic DNA, 0.15 μM of each primer, 5 μL Mix (0.05 units/μL Taq DNA Polymerase, 0.4 mM dNTPs, 4.0 mM MgCl2; Beijing Ruibio Biotech Co. Ltd., Beijing, China), and 1× PCR Buffer. The amplification protocol was: 95°C for 5 min; followed by 30 cycles at 95°C for 30 s, the annealing temperature for each primer (Table 1) for 30 s, and 72°C for 30 s; and a final extension step at 72°C for 7 min.
Table 1.
Characteristics of 18 polymorphic microsatellite loci in Pinus kesiya var. langbianensis.
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | Ta (°C) | GenBank accession no. |
| Pkvl001 | F: TTTGCAGTCTGTTGCCTTTG | (GCC)6 | 149–179 | 60.0 | KX519328 |
| R: GTGGAGGAAGATGGAAACGA | |||||
| Pkvl002 | F: GCACGTTGGATTTCAGGTTT | (GCA)5 | 134–146 | 60.0 | KX519329 |
| R: GCAACTCCAGCAACTCCTTC | |||||
| Pkvl003 | F: CAGGCTGTAACGCTCAATCA | (CAG)5 | 151–163 | 60.0 | KX519330 |
| R: TTGAAGGATCCCAACTTCCTT | |||||
| Pkvl004 | F: CCCTGAGTTTGACCGACAGT | (AAT)5 | 265–280 | 60.1 | KX519331 |
| R: GGGCATTTTAATGCTGCTGT | |||||
| Pkvl005 | F: GGGATTGGACTGGATGAGAA | (AGA)5 | 241–256 | 59.9 | KX519332 |
| R: TTTTGTAAACTGCAGCCGTG | |||||
| Pkvl006 | F: GCAGTGGCTGACATTTGAGA | (CTG)6 | 147–174 | 59.9 | KX519333 |
| R: GCTTCACGCCGTTCTTTATC | |||||
| Pkvl007 | F: GTAGGCACTCCGTGAAGCTC | (CAG)5 | 240–255 | 60.0 | KX519334 |
| R: ATCGGGACCTGTTGTTTCAG | |||||
| Pkvl008 | F: TGGGAAGTTTGTCCATGTCA | (TCT)5 | 258–273 | 60.0 | KX519335 |
| R: GCATTGTTGGCGTTGTATTG | |||||
| Pkvl009 | F: GTGGTCTGAAAATACCGCGT | (TCT)5 | 174–180 | 60.0 | KX519336 |
| R: GCAGCAGTAGCCATCATCAA | |||||
| Pkvl010 | F: CGAGACGAAGCAATTCCAA | (AT)6 | 244–262 | 59.9 | KX519337 |
| R: CGAAGATCAAGAAAGGCAGG | |||||
| Pkvl011 | F: AGCTCGGGATCAGGAGTATG | (TA)6 | 169–183 | 59.6 | KX519338 |
| R: TTTGGTGAAGTTTTGATTGCC | |||||
| Pkvl012 | F: GTTCTGTGAGCTTGGGGAAG | (AT)6 | 144–166 | 60.0 | KX519339 |
| R: TAAGACCGATTTGGCTACGG | |||||
| Pkvl013 | F: GATTGGCAGAGGCTACAAGC | (TA)11 | 114–150 | 59.9 | KX519340 |
| R: ATGCTTCCGCTGTTCAACTT | |||||
| Pkvl014 | F: TGCCACATTTGGGTAAGAAA | (AT)9 | 224–252 | 59.5 | KX519341 |
| R: TCGGAATGATGGATAGGAGC | |||||
| Pkvl015 | F: CCTTTTATGGGGGCGATAAT | (AT)9 | 208–224 | 59.9 | KX519342 |
| R: TTGACTTGAACACAAAGCCG | |||||
| Pkvl016 | F: ATCCTTACGCCTGCAGAGAA | (AT)7 | 152–158 | 60.2 | KX519343 |
| R: CATCGATTGCGCTACATCAG | |||||
| Pkvl017 | F: GATGCATTTGGATCAGCAAA | (TA)9 | 226–242 | 59.9 | KX519344 |
| R: ACCAATCGCTTGCATCTTTC | |||||
| Pkvl018 | F: CTGGTGCATAGACCCGAGAT | (TA)9 | 235–257 | 60.0 | KX519345 |
| R: TTTTCTGCTTCAAGTGGCCT |
Note: Ta = annealing temperature.
Amplification products were resolved using capillary electrophoresis on an ABI 3730xl DNA Analyzer (Applied Biosystems, Waltham, Massachusetts, USA). The electropherograms were analyzed using GeneMarker version 2.2.0 with GeneScan 500 LIZ as a size standard (Applied Biosystems). CONVERT version 1.3.1 (Glaubitz, 2004) was used to convert input files for analysis in subsequent software. The genetic diversity parameters of polymorphic loci, including the number of alleles, observed heterozygosity, and expected heterozygosity were calculated by GenAlEx 6.4 (Peakall and Smouse, 2006), and Hardy–Weinberg equilibrium (HWE) for each locus and the presence of linkage disequilibria for all pairwise loci in each population were tested with POPGENE 1.32 (Yeh et al., 1997). Among the 60 genotyped individuals, the number of alleles per locus varied from one to 11 (Table 2). The observed heterozygosity and expected heterozygosity ranged from 0.000 to 0.800 and from 0.000 to 0.840, respectively. There were no significant departures from HWE over all loci for any populations, but some populations deviated from HWE at up to 15 loci (P < 0.05) (Table 2). A significant linkage disequilibrium (P < 0.01) was detected in three pairwise SSR loci in two (Populations 1 and 2) out of four populations (Population 1: Pkvl007 and Pkvl010, Pkvl008 and Pkvl010; Population 2: Pkvl006 and Pkvl014). Furthermore, 16 out of 18 SSR loci were successfully amplified in 59 individuals of four related species (14–15 individuals for each species; Appendix 1). Most of these loci were polymorphic (Table 3).
Table 2.
Genetic properties of 18 polymorphic microsatellite markers in four Pinus kesiya var. langbianensis populations.a
| Locus | Population 1 (N = 15) | Population 2 (N = 15) | Population 3 (N = 15) | Population 4 (N = 15) | ||||||||||||
| A | Ho | He | HWEb | A | Ho | He | HWEb | A | Ho | He | HWEb | A | Ho | He | HWEb | |
| Pkvl001 | 3 | 0.267 | 0.371 | ns | 6 | 0.400 | 0.564 | ** | 3 | 0.133 | 0.338 | *** | 4 | 0.133 | 0.187 | *** |
| Pkvl002 | 5 | 0.333 | 0.658 | ns | 2 | 0.000 | 0.391 | *** | 4 | 0.200 | 0.296 | * | 3 | 0.267 | 0.338 | ** |
| Pkvl003 | 3 | 0.267 | 0.287 | ns | 4 | 0.267 | 0.293 | ns | 2 | 0.067 | 0.358 | ** | 3 | 0.067 | 0.127 | *** |
| Pkvl004 | 4 | 0.000 | 0.516 | *** | 5 | 0.067 | 0.482 | *** | 4 | 0.133 | 0.293 | * | 3 | 0.067 | 0.184 | ** |
| Pkvl005 | 5 | 0.200 | 0.396 | * | 4 | 0.071 | 0.365 | *** | 2 | 0.067 | 0.064 | ns | 2 | 0.067 | 0.064 | ns |
| Pkvl006 | 7 | 0.400 | 0.491 | ns | 5 | 0.267 | 0.349 | *** | 3 | 0.067 | 0.127 | *** | 3 | 0.067 | 0.127 | *** |
| Pkvl007 | 3 | 0.133 | 0.240 | ** | 3 | 0.133 | 0.291 | * | 1 | 0.000 | 0.000 | — | 2 | 0.067 | 0.064 | ns |
| Pkvl008 | 4 | 0.200 | 0.393 | *** | 4 | 0.133 | 0.242 | * | 3 | 0.133 | 0.127 | ns | 2 | 0.067 | 0.064 | ns |
| Pkvl009 | 2 | 0.733 | 0.464 | * | 3 | 0.400 | 0.418 | ** | 2 | 0.667 | 0.444 | ns | 2 | 0.800 | 0.498 | * |
| Pkvl010 | 5 | 0.154 | 0.393 | ** | 5 | 0.333 | 0.549 | *** | 3 | 0.200 | 0.331 | ns | 1 | 0.000 | 0.000 | — |
| Pkvl011 | 4 | 0.533 | 0.613 | *** | 3 | 0.667 | 0.531 | ns | 5 | 0.667 | 0.638 | *** | 4 | 0.667 | 0.544 | ** |
| Pkvl012 | 3 | 0.133 | 0.438 | * | 4 | 0.333 | 0.607 | *** | 5 | 0.467 | 0.609 | ** | 3 | 0.133 | 0.240 | ** |
| Pkvl013 | 6 | 0.133 | 0.551 | *** | 11 | 0.333 | 0.840 | *** | 4 | 0.000 | 0.459 | *** | 6 | 0.143 | 0.561 | *** |
| Pkvl014 | 9 | 0.077 | 0.837 | *** | 5 | 0.231 | 0.615 | * | 6 | 0.400 | 0.487 | ns | 9 | 0.333 | 0.616 | ** |
| Pkvl015 | 1 | 0.000 | 0.000 | — | 3 | 0.267 | 0.240 | ns | 1 | 0.000 | 0.000 | — | 1 | 0.000 | 0.000 | — |
| Pkvl016 | 3 | 0.000 | 0.418 | *** | 3 | 0.133 | 0.338 | *** | 3 | 0.133 | 0.291 | * | 3 | 0.200 | 0.184 | ns |
| Pkvl017 | 4 | 0.214 | 0.625 | *** | 4 | 0.357 | 0.574 | ** | 6 | 0.200 | 0.744 | *** | 5 | 0.333 | 0.629 | ** |
| Pkvl018 | 5 | 0.600 | 0.671 | * | 7 | 0.533 | 0.820 | *** | 4 | 0.467 | 0.656 | *** | 6 | 0.800 | 0.631 | *** |
Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; HWE = Hardy–Weinberg equilibrium; N = number of individuals sampled.
See Appendix 1 for locality and voucher information.
Deviation from Hardy–Weinberg equilibrium using χ2 tests: ns = not significant, *P < 0.05, **P < 0.01, ***P < 0.001, — = monomorphic.
Table 3.
Cross-amplification results showing the number of alleles detected in 18 loci from Pinus kesiya var. langbianensis in four related species.a
| Locus | Pinus massoniana | Pinus densata | Pinus tabuliformis | Pinus yunnanensis |
| Pkvl001 | 2 | 2 | 2 | 2 |
| Pkvl002 | 4 | 4 | 2 | 4 |
| Pkvl003 | 1 | 2 | 2 | 1 |
| Pkvl004 | 4 | 2 | 2 | 3 |
| Pkvl005 | 3 | 2 | 1 | 2 |
| Pkvl006 | 1 | 1 | 1 | 4 |
| Pkvl007 | 3 | 1 | 1 | 1 |
| Pkvl008 | 1 | 1 | 2 | 3 |
| Pkvl009 | 3 | 2 | 2 | 2 |
| Pkvl010 | 3 | 5 | 2 | 5 |
| Pkvl011 | 3 | 4 | 3 | 2 |
| Pkvl012 | 5 | 3 | 3 | 3 |
| Pkvl013 | — | — | — | — |
| Pkvl014 | — | — | — | — |
| Pkvl015 | 5 | 7 | 5 | 4 |
| Pkvl016 | 6 | 2 | 1 | 3 |
| Pkvl017 | 2 | 5 | 6 | 2 |
| Pkvl018 | 2 | 5 | 3 | 3 |
See Appendix 1 for locality and voucher information.
CONCLUSIONS
The set of 18 novel SSR markers reported in this study will be helpful for population genetic analysis in P. kesiya var. langbianensis, which will offer valuable information for the formulation of the rational utilization and conservation strategies of this species in the future. Furthermore, the successful cross-species amplification of these SSR markers in Pinus (Pinaceae) suggests their potential to be used in studies of genetic variation for related pine species.
Appendix 1.
Voucher information for Pinus kesiya var. langbianensis and its four related species used in this study.a
| Species | Collection locality | Geographic coordinates | N |
| Pinus kesiya Royle ex Gordon var. langbianensis (A. Chev.) Gaussen | Ninger, Yunnan, China (Population 1) | 22°57′N, 101°03′E | 15 |
| Pinus kesiya var. langbianensis | Zhenyuan, Yunnan, China (Population 2) | 23°51′N, 100°53′E | 15 |
| Pinus kesiya var. langbianensis | Jiangcheng, Yunnan, China (Population 3) | 22°35′N, 101°51′E | 15 |
| Pinus kesiya var. langbianensis | Lanchang, Yunnan, China (Population 4) | 22°33′N, 99°50′E | 15 |
| Pinus massoniana D. Don | Yuping, Guizhou, China | 27°30′N, 109°11′E | 14 |
| Pinus densata Mast | Xianggelila, Yunnan, China | 28°29′N, 99°37′E | 15 |
| Pinus tabuliformis Carrière | Lushi, Henan, China | 33°44′N, 110°49′E | 15 |
| Pinus yunnanensis Franch. | Yilang, Yunnan, China | 24°35′N, 103°08′E | 15 |
Note: N = number of individuals sampled.
Silica gel–dried needle samples of all vouchers were deposited in the Key Laboratory for Forest Genetic and Tree Improvement and Propagation in Universities of Yunnan Province, Southwest Forestry University, Kunming, Yunnan, China.
LITERATURE CITED
- Andrews S. 2010. FastQC: A quality control tool for high throughput sequence data. Website http://www.bioinformatics.babraham.ac.uk/projects/fastqc [accessed 13 January 2017].
- Dong J. X., Guo H. J., Li P., Zhao Y. F., Yun X. H. 2009. Oleoresin resources and development capacity in Yunnan. Journal of Northwest Forestry University 24: 157–160. [Google Scholar]
- Doyle J. J., Doyle J. L. 1990. Isolation of plant DNA from fresh tissue. Focus (San Francisco, Calif.) 12: 13–15. [Google Scholar]
- Editorial Committee of Flora of China. 1978. Flora Reipublicae Popularis Sinicae, Vol. 7, 259–260. Science Press, Beijing, China. [Google Scholar]
- Glaubitz J. C. 2004. CONVERT: A user-friendly program to reformat diploid data for commonly used population genetic software packages. Molecular Ecology Notes 4: 309–310. [Google Scholar]
- Grabherr M. G., Haas B. J., Yassour M., Levin J. Z., Thompson D. A., Amit I., Adiconis X., et al. 2011. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nature Biotechnology 29: 644–652. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Haas B. J., Papanicolaou A., Yassour M., Grabherr M., Blood P. D., Bowden J., Couger M. B., et al. 2013. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nature Protocols 8: 1494–1512. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jiang Y. B., Wu T., Chen S. Y., Yuan R. L. 2007. Optimization of RAPD reaction conditions for Pinus kesiya var. langbianensis. Journal of Northeast Forestry University 35: 16–19. [Google Scholar]
- Li S. F., Su J. R., Liu W. D., Lang X. D., Huang X. B., Jia C. X. Z., Tong Q., Tang H. Y. 2015. Changes in soil organic carbon and nitrogen stocks in Pinus kesiya var. langbiannesis plantation. Forest Research 28: 810–817. [Google Scholar]
- Peakall R., Smouse P. E. 2006. GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: 288–295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sanchez M., Ingrouille M. J., Cowan R. S., Hamilton M. A., Fay M. F. 2014. Spatial structure and genetic diversity of natural populations of the Caribbean pine, Pinus caribaea var. bahamensis (Pinaceae), in the Bahaman archipelago. Botanical Journal of the Linnean Society 174: 359–383. [Google Scholar]
- Thiel T., Michalek W., Varshney R. K., Graner A. 2003. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theoretical and Applied Genetics 106: 411–422. [DOI] [PubMed] [Google Scholar]
- Wu Z. Y. 1986. Flora Yunnanica, Vol. 4 (Spermatophyta), 57–58. Science Press, Beijing, China. [Google Scholar]
- Yeh F. C., Yang R. C., Boyle T. 1997. POPGENE version 1. 31: Microsoft Windows–based freeware for population genetics analysis: Quick user guide. Center for International Forestry Research, University of Alberta, Edmonton, Alberta, Canada. [Google Scholar]
- Yin X. B., Geng S. X., Ma H. F., Zheng W. 2005. Differences of physical and chemical characteristics of gum turpentine from Simao Pine. Journal of Nanjing Forestry University 29: 80–84 (Natural Sciences Edition). [Google Scholar]
- Zhao N., Shi R., Li B., Xiong Z., Wang J. 2016. Correlation between indexes of resin tapping and chemical components of Pinus kesiya var. langbianensis. Journal of West China Forestry Science 45: 63–68. [Google Scholar]