ABSTRACT
Carboxydothermus spp. are some of the most studied carbon monoxide–oxidizing anaerobic thermophiles. For further investigation into the carbon monoxide metabolism of Carboxydothermus spp., we report here the draft genome sequences of the hydrogenogenic carboxydotrophs Carboxydothermus pertinax (2.47 Mb; G+C content, 40.7%) and C. islandicus (2.39 Mb; G+C content, 42.0%).
GENOME ANNOUNCEMENT
Carboxydothermus spp. are carbon monoxide (CO)–oxidizing, anaerobic, Gram-positive thermophiles from the family Thermoanaerobacteriales (1, 2). To date, five Carboxydothermus spp. (C. hydrogenoformans, C. ferrireducens, C. siderophilus, C. islandicus, and C. pertinax) have been described. Except for C. ferrireducens, these bacteria produce hydrogen for their growth via CO oxidation (hydrogenogenic carboxydotrophy) (2–6). C. hydrogenoformans has been studied as a model of hydrogenogenic carboxydotrophy and its genome contains five genes of CO dehydrogenase (CODH), a key enzyme of CO metabolism (7, 8). For further investigation into the CO metabolism of Carboxydothermus spp., we report here the draft genome sequences of C. pertinax and C. islandicus (2, 6).
Genomic DNA of C. pertinax and C. islandicus, extracted using previously described NaOH methods (9), were subjected to sequencing with the Illumina MiSeq platform (Illumina Inc., San Diego, CA, USA) using the 2 × 150-bp paired-end approach, generating 3,839,951 and 6,663,869 paired-end reads, respectively. High-quality reads (Phred score above Q20 for 80% of the bases) were assembled into contigs using Velvet version 1.2.07 or version 1.2.10 software (10). The assembled contigs were subjected to the Microbial Genome Annotation Pipeline (MiGAP; http://www.migap.org/index.php/en) (11) to predict open reading frames (ORFs), followed by manual curation. Subsequently, the protein sequences were annotated using BLASTp searches (12, 13) against nonredundant protein sequences in the NCBI database.
The draft genomes of C. pertinax and C. islandicus were assembled into 96 (2.47 Mb) and 142 (2.39 Mb) contigs, respectively. These draft genomes have an average G+C content of 40.7% and 42.0%, respectively. The numbers of predicted ORFs were 2,577 and 2,480, respectively.
We identified four CODH gene clusters (corresponding to CODH-II to CODH-V of C. hydrogenoformans) (8) in C. pertinax and five CODH gene clusters (corresponding to CODH-I to CODH-V of C. hydrogenoformans) (8) in C. islandicus. The functions of the five CODHs in C. hydrogenoformans have been predicted according to empirical evidence and/or the genomic contexts of their genes (cooS) (8, 14, 15): CODH-I for energy conversion conjugated with energy-converting hydrogenase (ECH); CODH-II for NAD (P) H generation; CODH-III for carbon fixation in the Wood–Ljungdahl pathway; CODH-IV for oxidative stress response; and CODH-V for unknown function. To our knowledge, CODH gene clusters for energy conversion are adjacent to or located near the ECH gene cluster on the genomes of hydrogenogenic carboxydotrophs, and complexes of these gene products are considered to be responsible for hydrogenogenic CO metabolism (16, 17). The CODH/ECH gene cluster was conserved in C. islandicus, as in other hydrogenogenic carboxydotrophs, whereas the genome of C. pertinax contained an ECH gene cluster but not the CODH/ECH gene cluster. In addition, cooS, which encodes CODH-I, was not amplified when using a specific PCR primer set (forward primer, 5′GCGGCGCGGGATTCCTTTAG3′; reverse primer, 5′AAGCCCGGCTGCCTTTCCTA3′). These results suggested that for C. pertinax complexes of gene products from the ECH gene cluster and its physically unlinked cooS were responsible for hydrogenogenic CO metabolism.
Accession number(s).
The draft genome sequences of C. pertinax and C. islandicus have been deposited in the DNA Data Bank of Japan under the GenBank accession numbers BDJK01000000 and BDJL01000000, respectively.
ACKNOWLEDGMENTS
We are grateful to Koichiro Nakano and Kazuto Takasaki of FASMAC Co., Ltd. for the preparation of the genome libraries and sequencing of C. pertinax. We declare no conflicts of interest.
This work was funded by Grant-in-Aid for Scientific Research (A) (20248023), (A) (25252038), and (S) (16H06381) from the Ministry of Education, Culture, Sports, Science and Technology (MEXT).
Footnotes
Citation Fukuyama Y, Omae K, Yoneda Y, Yoshida T, Sako Y. 2017. Draft genome sequences of Carboxydothermus pertinax and C. islandicus, hydrogenogenic carboxydotrophic bacteria. Genome Announc 5:e01648-16. https://doi.org/10.1128/genomeA.01648-16.
REFERENCES
- 1.Sokolova T, Lebedinsky A. 2013. CO-Oxidizing anaerobic thermophilic prokaryotes, p 203–231. In Satyanarayana T, Littlechild J, Kawarabayasi Y (ed), Thermophilic microbes in environmental and industrial biotechnology, 2nd ed. Springer, Netherlands, Dordrecht. [Google Scholar]
- 2.Yoneda Y, Yoshida T, Kawaichi S, Daifuku T, Takabe K, Sako Y. 2012. Carboxydothermus pertinax sp. nov., a thermophilic, hydrogenogenic, Fe(III) -reducing, sulfur-reducing carboxydotrophic bacterium from an acidic hot spring. Int J Syst Evol Microbiol 62:1692–1697. doi: 10.1099/ijs.0.031583-0. [DOI] [PubMed] [Google Scholar]
- 3.Svetlichny VA, Sokolova TG, Gerhardt M, Ringpfeil M, Kostrikina NA, Zavarzin GA. 1991. Carboxydothermus hydrogenoformans gen. nov., sp. nov., a CO-utilizing thermophilic anaerobic bacterium from hydrothermal environments of Kunashir Island. Syst Appl Microbiol 14:254–260. doi: 10.1016/S0723-2020(11)80377-2. [DOI] [Google Scholar]
- 4.Slobodkin AI, Sokolova TG, Lysenko AM, Wiegel J. 2006. Reclassification of Thermoterrabacterium ferrireducens as Carboxydothermus ferrireducens comb. nov., and emended description of the genus Carboxydothermus. Int J Syst Evol Microbiol 56:2349–2351. doi: 10.1099/ijs.0.64503-0. [DOI] [PubMed] [Google Scholar]
- 5.Slepova TV, Sokolova TG, Kolganova TV, Tourova TP, Bonch-Osmolovskaya EA. 2009. Carboxydothermus siderophilus sp. nov., a thermophilic, hydrogenogenic, carboxydotrophic, dissimilatory Fe(III)-reducing bacterium from a Kamchatka hot spring. Int J Syst Evol Microbiol 59:213–217. doi: 10.1099/ijs.0.000620-0. [DOI] [PubMed] [Google Scholar]
- 6.Novikov AA, Sokolova TG, Lebedinsky AV, Kolganova TV, Bonch-Osmolovskaya EA. 2011. Carboxydothermus islandicus sp. nov., a thermophilic, hydrogenogenic, carboxydotrophic bacterium isolated from a hot spring. Int J Syst Evol Microbiol 61:2532–2537. doi: 10.1099/ijs.0.030288-0. [DOI] [PubMed] [Google Scholar]
- 7.Ragsdale SW. 2004. Life with carbon monoxide. Crit Rev Biochem Mol Biol 39:165–195. doi: 10.1080/10409230490496577. [DOI] [PubMed] [Google Scholar]
- 8.Wu M, Ren Q, Durkin AS, Daugherty SC, Brinkac LM, Dodson RJ, Madupu R, Sullivan SA, Kolonay JF, Haft DH, Nelson WC, Tallon LJ, Jones KM, Ulrich LE, Gonzalez JM, Zhulin IB, Robb FT, Eisen JA. 2005. Life in hot carbon monoxide: the complete genome sequence of Carboxydothermus hydrogenoformans Z-2901. PLoS Genet 1:e65. doi: 10.1371/journal.pgen.0010065. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Mesbah M, Premachandran U, Whitman WB. 1989. Precise measurement of the G+C content of deoxyribonucleic acid by high-performance liquid chromatography. Int J Syst Bacteriol 39:159–167. doi: 10.1099/00207713-39-2-159. [DOI] [Google Scholar]
- 10.Zerbino DR, Birney E. 2008. Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Genome Res 18:821–829. doi: 10.1101/gr.074492.107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Sugawara H, Ohyama A, Mori H, Kurokawa K. 2009. Microbial genome annotation pipeline (MiGAP) for diverse users, abstr S-001-1-2. Abstr 20th Int Conf Genome Informatics, Kanagawa, Japan. [Google Scholar]
- 12.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. J Mol Biol 215:403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
- 13.Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Svetlitchnyi V, Peschel C, Acker G, Meyer O. 2001. Two membrane-associated NiFeS-carbon monoxide dehydrogenases from the anaerobic carbon-monoxide-utilizing eubacterium Carboxydothermus hydrogenoformans. J Bacteriol 183:5134–5144. doi: 10.1128/JB.183.17.5134-5144.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Inoue T, Takao K, Yoshida T, Wada K, Daifuku T, Yoneda Y, Fukuyama K, Sako Y. 2013. Cysteine 295 indirectly affects Ni coordination of carbon monoxide dehydrogenase-II C-cluster. Biochem Biophys Res Commun 441:13–17. doi: 10.1016/j.bbrc.2013.09.143. [DOI] [PubMed] [Google Scholar]
- 16.Techtmann SM, Lebedinsky AV, Colman AS, Sokolova TG, Woyke T, Goodwin L, Robb FT. 2012. Evidence for horizontal gene transfer of anaerobic carbon monoxide dehydrogenases. Front Microbiol 3:132. doi: 10.3389/fmicb.2012.00132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Fox JD, He Y, Shelver D, Roberts GP, Ludden PW. 1996. Characterization of the region encoding the CO-induced hydrogenase of Rhodospirillum rubrum. J Bacteriol 178:6200–6208. doi: 10.1128/jb.178.21.6200-6208.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
