Role of Litopenaeus vannamei Yin Yang 1 in the Regulation of the White Spot Syndrome Virus Immediate Early Gene ie1

ABSTRACT

Yin Yang 1 (YY1) is a multifunctional zinc finger transcription factor that regulates many key cellular processes. In this study, we report the cloning of YY1 from Litopenaeus vannamei shrimp (LvYY1). This study shows that LvYY1 is ubiquitously expressed in shrimp tissues, and knockdown of LvYY1 expression by double-stranded RNA (dsRNA) injection in white spot syndrome virus (WSSV)-infected shrimp reduced both mRNA levels of the WSSV immediate early gene ie1 as well as overall copy numbers of the WSSV genome. The cumulative mortality rate of infected shrimp also declined with LvYY1 dsRNA injection. Using an insect cell model, we observed that LvYY1 activates ie1 expression, and a mutation introduced into the ie1 promoter subsequently repressed this capability. Moreover, reporter assay results suggested that LvYY1 is involved in basal transcriptional regulation via an interaction with L. vannamei TATA-binding protein (LvTBP). Electrophoretic mobility shift assay (EMSA) results further indicated that LvYY1 binds to a YY1-binding site in the region between positions −119 and −126 in the ie1 promoter. Chromatin immunoprecipitation analysis also confirmed that LvYY1 binds to the ie1 promoter in WSSV-infected shrimp. Taken together, these results indicate that WSSV uses host LvYY1 to enhance ie1 expression via a YY1-binding site and the TATA box in the ie1 promoter, thereby facilitating lytic activation and viral replication.

IMPORTANCE WSSV has long been a scourge of the shrimp industry and remains a serious global threat. Thus, there is a pressing need to understand how the interactions between WSSV and its host drive infection, lytic development, pathogenesis, and mortality. Our successful cloning of L. vannamei YY1 (LvYY1) led to the elucidation of a critical virus-host interaction between LvYY1 and the WSSV immediate early gene ie1. We observed that LvYY1 regulates ie1 expression via a consensus YY1-binding site and TATA box. LvYY1 was also found to interact with L. vannamei TATA-binding protein (LvTBP), which may have an effect on basal transcription. Knockdown of LvYY1 expression inhibited ie1 transcription and subsequently reduced viral DNA replication and decreased cumulative mortality rates of WSSV-infected shrimp. These findings are expected to contribute to future studies involving WSSV-host interactions.

INTRODUCTION

White spot syndrome virus (WSSV), a member of the Whispovirus genus of the Nimaviridae family, has a circular double-stranded DNA genome of about 300 kb, which contains about 181 open reading frames (ORFs) (1, 2). This virus is a crustacean pathogen causing up to 90 to 100% cumulative mortality in cultured shrimp (3–6). Following lytic WSSV infection, the virus expresses immediate early (IE), early, and late genes to produce infectious virions (1, 7). Most of the viral IE genes encode transcription factors to regulate viral gene expression and proliferation (8–11). So far, 21 WSSV IE genes have been identified (12–14); among these, WSSV108, WSSV126 (also known as ie1), WSSV136, and WSSV156 have been confirmed to activate transcription (14). The ie1 gene encodes a 224-amino-acid protein, which contains a transactivation domain and a zinc finger DNA-binding domain (15). Liu et al. (16) reported previously that the TATA box-binding protein from Penaeus monodon (Asian tiger shrimp) (PmTBP) interacts with IE1 to enhance basal transcription. Additionally, IE1 interacts with a retinoblastoma (Rb)-like protein in Litopenaeus vannamei (Pacific white shrimp) to regulate cell cycle progression through the Rb-E2F pathway (17). Silencing of ie1 expression by RNA interference (RNAi) also inhibits WSSV replication in infected shrimp (16), indicating that ie1 is critical for viral lytic progression. Previous studies also demonstrated that WSSV uses host transcriptional factors such as STAT, NF-κB, and Kruppel-like factors (KLF) to enhance the transcription of ie1 (7, 18, 19). Another previous study showed that Penaeus monodon is latently infected with WSSV (20), indicating that the virus has a latent stage. Four genes, wsv151, wsv366, wsv403, and wsv427, are known to be critical for virus latency (20, 21). Among these genes are wsv151, which encodes a repressor that suppresses the transcription of its own gene, as well as the thymidine-thymidylate kinase genes of WSSV (22). The E3 ligase WSV403 shows autoubiquitination activity in the presence of shrimp E2-conjugating enzymes and can also regulate WSSV latency (21). The functions of the other two genes are still unclear.

Yin Yang 1 (YY1) is a ubiquitous and multifunctional GLI-Kruppel family zinc finger protein that regulates transcription via interactions with associated cofactors including cyclic AMP (cAMP) response element-binding protein (CREB) (23), CBP/p300 (24), histone deacetylases (HDACs) (25), or TBP (26, 27). YY1 binds to a consensus binding sequence, 5′-CCATNTT (28, 29), via four highly conserved Cys2-His2 zinc finger DNA-binding domains in the C-terminal region to influence cell growth, differentiation, apoptosis, transformation, genomic imprinting, and X-chromosome inactivation (26, 30–35). Furthermore, the transcription of many viral genes is regulated by YY1. For example, YY1 represses the adeno-associated virus (AAV) P5 promoter (36) but activates the promoter when the adenovirus E1A protein is present (36). YY1 also represses the transcription of two Epstein-Barr virus (EBV) immediate early genes, BRLF1 and BZLF1, to prevent lytic activation (37). In Kaposi's sarcoma-associated herpesvirus (KSHV), YY1 inhibits the transcription of ORF50, an immediate early gene, to block the latent-lytic switch (38).

In this study, we cloned a YY1 homolog from L. vannamei (LvYY1) and demonstrated that LvYY1 binds to the promoter of the ie1 gene of WSSV. This interaction enhances ie1 transcription in WSSV-infected shrimp, and the knockdown of LvYY1 expression consequently reduces WSSV replication and decreases cumulative mortality of infected shrimp. This indicates that LvYY1 is an important host factor for lytic WSSV infection.

RESULTS

Cloning of the LvYY1 gene.

By using the sequence of L. vannamei EST (GenBank accession no. FE125424), we cloned a gene encoding a YY1 homolog (LvYY1) using 5′ and 3′ rapid amplification of cDNA ends (RACE). The amplified DNA fragment was 1,401 bp long and contained a 1,065-bp gene (Fig. 1A), which encodes a protein with a calculated molecular mass of 38.9 kDa (GenBank accession no. KT820172). The 5′-RACE experiment also revealed the transcription start site, which is located 60 nucleotides upstream of the translational initiation codon (Fig. 1A). Reverse transcription-PCR (RT-PCR) showed that LvYY1 mRNA was present in heart, nerve, muscle, midgut, hepatopancreas, pleopod, stomach, and gill (Fig. 1C) and showed a higher expression level in the heart and midgut. Alignment of the protein sequences showed that highly conserved zinc finger and recruit polycomb (REPO) domains in the proteins of the YY1 family were present in LvYY1 (Fig. 1B). We also used a bacterially expressed His-tagged peptide, which contains the N-terminal 180-amino-acid region but not the four zinc finger domains (Fig. 1B), to generate a polyclonal antibody in a rabbit. An immunoblot study revealed that this antibody detected a protein in the lysate from L. vannamei shrimp that migrated to the 60-kDa position (Fig. 2A, lane 2). Immunoblotting also revealed that both anti-His and anti-YY1 antibodies detected a protein that migrated to the 65-kDa position in an SDS gel in the lysate from Escherichia coli BL21(DE3)(pET-LvYY1) cells (Fig. 2B, lanes 2 and 4) but not in the lysate from E. coli BL21(DE3)(pET-28a) cells (Fig. 2B, lanes 1 and 3), suggesting that the band is LvYY1. LvYY1 expressed from pET-LvYY1 contains a 5-kDa peptide fused to the amino terminus of LvYY1, explaining why the protein detected in the E. coli lysate is larger than the protein detected in shrimp tissues (Fig. 2A, lane 2). We also found that both anti-LvYY1 and anti-V5 antibodies detected a protein that migrated to the 65-kDa position in the lysate from Sf9(pDHSP-LvYY1/V5-His) cells (Fig. 2C, lanes 2 and 4) but not in that from Sf9(pDHSP/V5-His) cells (Fig. 2C, lanes 1 and 3), further verifying that the detected protein is LvYY1. A previous study also showed that human YY1 has a calculated molecular mass of 45 kDa but migrates to the position of 68 kDa in an SDS gel (36).

FIG 1.

LvYY1 nucleotide and deduced amino acid sequences and presence of LvYY1 mRNA in shrimp tissues. (A) The nucleotide sequence is numbered from the +1 site of the mRNA, which was determined by 5′ RACE performed in this study. An asterisk indicates the stop codon. (B) Alignment of human YY1 (GenBank accession no. NP_003394.1), Drosophila pleiohomeotic (PHO) (accession no. NP_524630.1), and L. vannamei YY1. Four highly homologous zinc finger domains are highlighted in black. The acidic amino acid residues (aspartate and glutamate) are underlined. Asterisks indicate identical amino acids; colons indicate similar amino acids. (C) LvYY1 mRNAs in heart, nerve, muscle, midgut, hepatopancreas, pleopod, stomach, and gill were detected by RT-PCR. β-Actin mRNA was amplified as an internal control. M, 100-bp DNA marker. cDNA reverse transcribed from Sf9 cell total RNA was amplified as a negative control. −, PCR without a DNA template.

FIG 2.

Expression of LvYY1 in L. vannamei, E. coli, and Sf9 cells. (A) YY1 in L. vannamei muscle tissues was detected by immunoblotting with anti-YY1 antibody (lane 2) or preimmune serum (lane 1). (B) Proteins expressed in E. coli BL21(DE3)(pET-28a) (lanes 1 and 3) and E. coli BL21(DE3)(pET-LvYY1) (lanes 2 and 4) after IPTG induction were detected by immunoblotting using anti-His (lanes 1 and 2) and anti-YY1 (lanes 3 and 4) antibodies. (C) Proteins in the lysates from Sf9(pDHSP-LvYY1/V5-His) (lanes 2 and 4) and Sf9(pDHSP/V5-His) (lanes 1 and 3) cells were detected by immunoblotting using anti-V5 (lanes 1 and 2) and anti-YY1 (lanes 3 and 4) antibodies.

LvYY1 activates transcription of the ie1 gene.

We conducted a transient-transfection assay in S2 cells to determine how the ie1 promoter is regulated by LvYY1. We found that when the cells were cotransfected with an empty reporter plasmid, pGL3-Basic, and either pDHSP-/V5-His or pDHSP-LvYY1/V5-His, cells yielded similar background levels of luciferase activity (Fig. 3B). When cells were cotransfected with pIE1(−268/+52) and pDHSP/V5-His, the cells also exhibited background levels of luciferase activity (Fig. 3B); however, when pDHSP-LvYY1/V5-His was cotransfected with pIE1(−268/+52) to examine the effects of exogenous LvYY1 expression, promoter activity increased to levels that were 27-fold higher than those exhibited by cells transfected with pIE1(−268/+52) and pDHSP/V5-His (Fig. 3B), indicating that the introduction of LvYY1 promotes the activation of the ie1 promoter. When the region between positions −268 and −95 was deleted [pIE1(−94/+52)], thereby removing the YY1-binding site, LvYY1 activated the reporter plasmid at levels just 15-fold higher than those of background controls (Fig. 3B). We further extended the deletion to position −45 [pIE1(−44/+52)], which removes all the known cis elements that regulate the ie1 promoter, except for the TATA sequence (Fig. 3B). With the expression of LvYY1, luciferase activity was just 9.9-fold higher than that of background controls (Fig. 3B). Since human YY1 is known to interact with basal transcription factors binding to the TATA sequence (27, 39–41), the results suggest that LvYY1 activation may be conducted through a similar mechanism. After the TATA sequence was also deleted [pIE1(+5/+52)], only background levels of luciferase activity were observed in the presence of LvYY1 (Fig. 3B). To further verify the importance of the YY1 site and the TATA sequence, we generated mutations in pIE1(−268/+52) to create pIE1(−268/+52)-mYY1 and pIE1(−268/+52)-mTATA, respectively (Fig. 3B). We observed a 5.8-fold increase in activation over that of controls for pIE1(−268/+52)-mYY1 when LvYY1 was present as well as a 5.2-fold increase over that of controls for pIE1(−268/+52)-mTATA (Fig. 3B), suggesting an important role for the TATA box in mediating LvYY1 activation of the ie1 promoter. However, it should be noted that these levels were considerably lower than the increase in transactivation activity observed for LvYY1 with the full-length promoter.

FIG 3.

Transcriptional activation of the ie1 promoter by LvYY1. (A) Sequence of the ie1 promoter. The NF-κB, STAT, and KLF sites in the promoter are indicated. A putative YY1 site is located between positions −119 and −126; TATA is located between positions −26 and −30. (B) S2 cells were cotransfected with a reporter plasmid containing a luciferase gene transcribed from a segment of the ie1 promoter and either pDHSP-LvYY1/V5-His or an empty vector, pDHSP/V5-His. Luciferase activities exhibited by the cells were monitored 36 h after transfection. The activity exhibited by cells that were cotransfected with a reporter plasmid and pDHSP-LvYY1/V5-His was divided by the activity exhibited by cells that were cotransfected with the same reporter plasmid and pDHSP/V5-His in order to calculate fold activation. The experiments were repeated three times, and samples in each experiment were prepared in duplicate. The error bars represent standard deviations. * indicates a significant difference observed between pIE1(−268/+52) and all other reporter constructs.

Binding of LvYY1 to the ie1 promoter.

A biotin-labeled double-stranded YY1 probe containing the region in the ie1 promoter from positions −113 to −133 was generated to verify the binding of LvYY1 to the putative YY1-binding site in this fragment, 5′-AAAATGGC (Fig. 3A), located between positions −119 and −126. We found that although the proteins in the nuclear extract from Sf9 cells did not shift the probe (Fig. 4A, lane 2), the nuclear extract from Sf9(pDHSP-LvYY1/V5-His) cells, which contains LvYY1 fused to a V5-His tag, shifted the YY1 probe (Fig. 4A, lane 3). After the addition of a cold YY1 probe or a probe from the AAV P5 promoter (36), which contains the consensus YY1-binding sequence (Fig. 4C), binding was competed, and no shifted band was observed (Fig. 4A, lanes 4 and 5). As expected, neither a cold probe with a STAT sequence (Fig. 4C) nor a YY1 probe with a mutated YY1 sequence (Fig. 4C) competed with the binding interaction (Fig. 4A, lanes 6 and 7), thus confirming the binding of the target proteins to the YY1 site in the ie1 promoter. Furthermore, a supershift was observed after anti-V5 antibody was added to the binding mixture (Fig. 4A, lane 8). We also found that the addition of a polyclonal anti-YY1 antibody caused the disappearance of the shifted band and a decrease of free probes (Fig. 4A, lane 9), likely due to multiple epitopes on LvYY1 being recognized by the antibody, thus preventing the large antigen-antibody complex from entering the gel. The disappearance of the DNA-protein complex is frequently observed in electrophoretic mobility shift assays (EMSAs) involving a supershift by antibodies (42–44). Incidentally, the binding reaction mixture with added preimmune serum did not cause a supershift (Fig. 4A, lane 10). We also used the lysate from L. vannamei shrimp to demonstrate the binding of LvYY1 to the YY1 probe. The results showed that proteins in the lysate shifted the YY1 probe (Fig. 4B, lane 2); both the cold YY1 probe and the consensus YY1-binding sequence competed with the binding interaction (Fig. 4B, lanes 3 and 4). However, a probe containing a STAT or a mutated YY1 sequence did not compete with binding (Fig. 4B, lanes 5 and 6), revealing the binding of LvYY1 to the YY1 site in the ie1 promoter. In a supershift experiment, we found that preimmune serum did not supershift binding (Fig. 4B, lane 7), but the addition of an anti-YY1 antibody caused the disappearance of the shifted band (Fig. 4B, lane 8), showing that the antibody supershifts the complex. Notably, another protein-DNA complex was observed, which migrated to a position higher than that of the YY1-DNA complex (Fig. 4B, lane 2). We found that the cold YY1 probe competed with the binding interaction (Fig. 4B, lane 3), but the YY1 site-containing probe from the AAV P5 promoter could not compete with binding (Fig. 4B, lane 4), suggesting that this complex is formed by the binding of a protein other than YY1.

FIG 4.

Binding of LvYY1 to a putative YY1-binding site in the ie1 promoter. (A) A biotin-labeled double-stranded DNA probe (1 ng) containing the region from positions −113 to −133 (YY1 probe) was incubated with 2 μg of nuclear extracts from Sf9(pDHSP/V5-His) or Sf9(pDHSP-LvYY1/V5-His) cells. Probes unlabeled with biotin (100 ng), including the YY1 probe, a probe containing a consensus YY1 sequence, a probe containing the STAT sequence, and a YY1 probe with a mutated YY1 site, were added to compete with binding. Anti-V5 and anti-YY1 antibodies were used to shift the protein-DNA complex, and preimmune serum was used as a control. (B) A similar experiment using the same probe was performed with 10 μg of nuclear extracts from muscle tissues of L. vannamei shrimp. Anti-YY1 antibody was used to supershift the YY1-DNA complex; preimmune serum was used as a control. (C) Sequences of competitors used in EMSAs.

In an immunoprecipitation (IP) study, we incubated shrimp muscle extracts with anti-YY1 antibody and showed that the antibody immunoprecipitated LvYY1 (Fig. 5A, lane 3). However, LvYY1 was not immunoprecipitated by anti-glutathione S-transferase (GST) antibody (Fig. 5A, lane 2). Therefore, a chromatin immunoprecipitation (ChIP) assay was performed by using the antibody and the lysates from WSSV-infected and mock-infected shrimp to ascertain the binding of LvYY1 to the ie1 promoter in vivo. After cross-linking of protein-DNA complexes and immunoprecipitation, real-time PCR analysis using primers amplifying the ie1 promoter was conducted. The signal detected from the anti-GST antibody group was used as a background. The results showed that the mock-infected group did not exhibit any signals pertaining to the ie1 promoter (Fig. 5B). However, positive signals that were 7-fold higher than background signals were detected in the shrimp lysate (Fig. 5B). These results confirm that in WSSV-infected L. vannamei shrimp, LvYY1 binds to the ie1 promoter.

FIG 5.

Binding of LvYY1 to the ie1 promoter in WSSV-infected shrimp. (A) Proteins extracted from shrimp muscle tissues were immunoprecipitated (IP) using anti-YY1 antibody (lane 3) and anti-GST antibody (lane 2), followed by immunoblotting (IB) to demonstrate the ability of the antibody to immunoprecipitate LvYY1. IgG_H, heavy chain of immunoglobulin. (B) A ChIP assay was performed by using muscle tissues from either three shrimp (L. vannamei) infected with WSSV for 48 h or mock-infected shrimps. Anti-YY1 and rabbit polyclonal anti-GST antibodies were used to immunoprecipitate DNA-protein complexes after cross-linking and sonication. The precipitated DNA was then amplified by real-time PCR using primers specific for the ie1 promoter. The experiment was repeated three times, and samples were prepared in duplicate. The error bars represent standard deviations. N.D, not determined.

LvYY1 interacts with TBP.

In this study, we showed that LvYY1 may activate the transcription of ie1 through its TATA sequence (Fig. 3B). Therefore, we investigated whether LvYY1 interacts with a key TATA-binding protein from L. vannamei. A GST pulldown assay showed that GST-LvYY1-glutathione-Sepharose beads pulled down bacterially expressed His-LvTBP (Fig. 6A, lane 7). However, in a parallel experiment, GST-glutathione-Sepharose beads did not pull down His-LvTBP (Fig. 6A, lane 6), revealing that LvYY1 interacts with LvTBP in vitro. A coimmunoprecipitation assay was also performed by using the lysate from Sf9 cells that had been transfected with plasmids expressing V5-His-LvTBP and Flag-LvYY1. Lysates were then prepared 48 h after transfection. We found that Flag-enhanced green fluorescent protein (EGFP) was detected by anti-Flag antibody in the lysate from cells that were cotransfected with pDHSP-LvTBP/V5-His and pDHSP-EGFP/Flag (Fig. 6B, lane 1). Flag-YY1 was also detected in the lysate from cells that were cotransfected with pDHSP-LvTBP/V5-His and pDHSP-LvYY1/V5-His (Fig. 6B, lane 2). Additionally, this study showed the binding of Flag-EGFP and Flag-LvYY1 to M2 Flag-agarose beads (Sigma) (Fig. 6B, lanes 3 and 4). Immunoblotting also revealed that V5-His-LvTBP was present in the lysate (Fig. 6B, lane 6) and was coimmunoprecipitated with Flag-LvYY1 by anti-Flag antibody (Fig. 6B, lane 8). However, V5-His-LvTBP was not coimmunoprecipitated with Flag-EGFP (Fig. 6B, lane 7) from the lysate of Sf9 cells cotransfected with plasmids expressing V5-His-LvTBP (Fig. 6B, lane 5) and Flag-EGFP (Fig. 6B, lane 1). These results show that V5-His-LvTBP and Flag-LvYY1 interact in vivo.

FIG 6.

Interaction between LvYY1 and LvTBP. (A) GST pulldown assay. GST or GST-LvYY1 (20 μg) was mixed with 30 μl glutathione-Sepharose beads, and 1% of the GST and GST-LvYY1 samples was analyzed by immunoblotting (IB) with anti-GST antibody (lanes 1 and 2). His-LvTBP (50 μg) was then added to the reaction mixture, and 1% of the added His-LvTBP sample was analyzed by immunoblotting (lane 5). Proteins pulled down by the beads were analyzed by immunoblotting with anti-GST (lanes 3 and 4) and anti-His (lanes 6 and 7) antibodies. (B) Coimmunoprecipitation assay. Sf9 cells were cotransfected with pDHSP-LvTBP/V5-His and pDHSP-LvYY1/Flag or pDHSP-EGFP/Flag. Forty-eight hours after transfection, proteins in the cell lysate were immunoprecipitated (IP) with anti-Flag antibody. Proteins coimmunoprecipitated by the antibody were analyzed by immunoblotting using anti-Flag (lanes 3 and 4) and anti-V5 (lanes 7 and 8) antibodies. Lanes 1, 2, 5, and 6 were loaded with 5% of the cell lysate. Sf9 cells cotransfected with pDHSP-EGFP/Flag and pDHSP-LvTBP/V5-His served as experimental controls (lanes 1 and 5).

Knockdown of LvYY1 expression and WSSV replication.

We injected three groups of 15 shrimp each with LvYY1 double-stranded RNA (dsRNA) (dsYY1), green fluorescent protein (GFP) dsRNA (dsGFP), or phosphate-buffered saline (PBS) 48 h prior to WSSV challenge. We found that at 0 h post-WSSV infection (hpi), although levels of LvYY1 and elongation factor 1α (EF-1α) mRNAs were unchanged in three animals in each of the groups injected with PBS and dsGFP RNA, the levels of LvYY1 mRNA decreased in the group that was injected with dsYY1 RNA (Fig. 7A). Furthermore, immunoblotting revealed a reduction of LvYY1 expression in shrimp injected with dsYY1 RNA (Fig. 7A). Similar results were also observed for shrimp at 48 hpi (Fig. 7B). We further investigated the amounts of ie1 mRNA in shrimp after injection. The results showed that the amounts of ie1 mRNA increased over a 48-h period (Fig. 7E). Injection of shrimp with dsGFP RNA resulted in an initial decrease in the amount of ie1 mRNA at 24 hpi, but levels returned to a state that was comparable to that of shrimp injected with PBS at 48 hpi (Fig. 7E), showing nonspecific inhibition of ie1 expression by dsGFP RNA (45). This study also found that injection of dsYY1 RNA substantially reduced the amounts of ie1 mRNA in shrimp during the period within 48 h postinfection (Fig. 7E). These results showed that LvYY1 is critical for ie1 expression in shrimp. We also studied how the injection of dsYY1 RNA affects viral replication. We found that 24 h after infection with WSSV, the 5 shrimp injected with PBS had an average of 4 × 10⁵ copies of the WSSV genome per shrimp (Fig. 7C). We further observed that dsGFP RNA reduced the copy numbers of the WSSV genome per shrimp by 10-fold to 4 × 10⁴ copies (Fig. 7C); the injection of dsYY1 RNA reduced the copy number to 3,850 copies per shrimp (Fig. 7C). At 48 h postinfection, the viral genome copy numbers in the group injected with PBS were 2.9 × 10⁷ copies per shrimp, while the group injected with dsGFP RNA had 3 × 10⁶ copies per shrimp, and those injected with dsYY1 RNA had 4.5 × 10⁴ copies (Fig. 7D). These results show that LvYY1 is critical for WSSV proliferation. A mortality assay also revealed that WSSV-infected shrimp treated with PBS and dsGFP reached 100% and 93% cumulative mortality rates at 132 hpi and 156 hpi (Fig. 7F), respectively, but the dsYY1 RNA group exhibited only 57% cumulative mortality at 240 hpi (Fig. 7F). Taken together, these findings point to a crucial role for LvYY1 in mediating WSSV infection and virulence.

FIG 7.

Reduction of WSSV copy numbers and cumulative mortality in WSSV-infected shrimp after LvYY1 dsRNA injection. (A and B, left) Shrimp were injected with PBS, PBS containing GFP dsRNA (2 μg/g shrimp weight), or PBS containing LvYY1 dsRNA (2 μg/g shrimp weight) 48 h prior to being challenged with WSSV. At 0 h (A) and 48 h (B) post-WSSV infection, total RNA was extracted and reverse transcribed to cDNA. RT-PCR was conducted to analyze the expression of LvYY1. EF-1α was used as an internal control for RT-PCR. − represents PCR without a template. (Right) The levels of the LvYY1 protein were also examined by immunoblotting (IB) using anti-YY1 and anti-α-tubulin antibodies. (C and D) Copy numbers of WSSV in infected shrimp were determined at 24 hpi (C) and 48 hpi (D) by qPCR. Data from five shrimp at the indicated time points for each group were averaged, and all the samples were prepared in duplicate. Statistical analysis was performed by using one-way ANOVA. (E) ie1 expression levels were assessed at different time points after WSSV infection by qPCR. EF-1α was used as an internal control. Results from five shrimp at the indicated time points for each group were averaged, and all the samples were prepared in duplicate. Statistical analysis was performed by using one-way ANOVA. (F) Cumulative mortality of WSSV-infected shrimp was recorded every 12 h until 240 hpi. Kaplan-Meier analysis was used to chart cumulative mortality.

DISCUSSION

YY1 is known to regulate the transcription of viral genes to affect their infection, proliferation, and pathogenesis (36–38, 46). In this study, we identify a YY1 homolog from L. vannamei, LvYY1. Like the proteins in the YY1 family, LvYY1 contains four conserved zinc finger domains, which have high sequence similarity to YY1 from fruit flies and humans (Fig. 1B). LvYY1 also contains a commonly conserved REPO domain (Fig. 1B), which is responsible for the recruitment of proteins of the polycomb group (PcG) as well as transcriptional repression (47–49). This study found that LvYY1 binds to a YY1 site in the ie1 promoter of WSSV to activate viral transcription and ultimately influence the physiology of the virus.

In an immunoblot study, we found that the LvYY1 antibody detected a protein of 60 kDa in the shrimp lysate (Fig. 2A). The size estimated from the gel is inconsistent with that calculated from the amino acid sequence of LvYY1, which is 38.9 kDa. In fact, human YY1, a 45-kDa protein, similarly migrates to the 68-kDa position in an SDS gel (36). To verify that LvYY1 migrates in a manner that is inconsistent with its molecular weight, we expressed His-LvYY1 in E. coli BL21(DE3) cells. In this case, the estimated molecular mass for this recombinant protein is 44 kDa, but immunoblotting revealed that both anti-His and anti-YY1 antibodies detected a protein of 65 kDa (Fig. 2B). Simultaneous detection by anti-His and anti-YY1 antibodies suggests that the protein band is LvYY1. A similar result was also observed for the lysate from Sf9 cells that express LvYY1 with a V5-His tag (Fig. 2C). The migration to a higher position in the gel is probably not attributable to phosphorylation, as treatment of LvYY1 with phosphatase does not change the migration pattern (data not shown). Glycosylation has also been shown to have no effect on the migration of human YY1 (50). Previous studies suggested that the presence of a high percentage of acidic amino acids may affect the migration of a protein in an SDS gel (51–54). Our sequence analysis revealed that 20.6% of the amino acid residues in the N-terminal region (amino acids [aa] 1 to 180) of LvYY1 are acidic, either glutamate or aspartate (Fig. 1B), which may explain why LvYY1 appears at the 60-kDa position in these gels.

In a mutational analysis, we found that a deletion of the region between positions −268 and −95 in the WSSV ie1 promoter reduces the ability of LvYY1 to transactivate the promoter, and transcription levels were observed to decline from 27-fold over those of controls to just 15-fold over those of controls (Fig. 3B). LvYY1 activation may be initiated by its binding at a putative YY1 site in the region between positions −119 and −126 (Fig. 3), and we show in an EMSA that LvYY1 expressed from Sf9(pDHSP-LvYY1/V5-His) cells, as well as LvYY1 endogenously present in shrimp tissues, can bind to this region (Fig. 4). Mutation of this site in the full-length promoter [pIE1(−268/+52)-mYY1] affects transactivation by LvYY1 (Fig. 3B). To further identify the shrimp LvYY1-DNA complex in the EMSA reaction (Fig. 4B), we conducted an immunoblot experiment to demonstrate the presence of LvYY1 in the complex. However, it was difficult to detect the LvYY1-DNA complex, as only 10 ng of the DNA probe could be applied in each 20-μl EMSA reaction mixture, and the amounts of LvYY1 binding to the probe are very small. Therefore, we performed another DNA affinity precipitation assay (DAPA) to ascertain the binding between LvYY1 and the DNA target using 2 μg of the biotin-labeled YY1 probe and 150 μg of shrimp muscle tissue lysate. DAPA results support the binding of LvYY1 to the probe (data not shown). In addition, ChIP assay results (Fig. 5B) further verify the binding of LvYY1 to this region (Fig. 5B) and also provide support for the activation of ie1 transcription by LvYY1. In this study, we found that a deletion of the region between positions −268 and −95 increases luciferase activity (Fig. 3B). An increase in promoter activity following the deletion of this region was also observed in another study (7), suggesting that a negative element is present here. Furthermore, after mutation of the YY1 sequence in the full-length promoter, despite the absence of LvYY1 in cells, the promoter plasmid exhibited transactivation activity that was higher than that of the wild-type construct. It is known that the YY1 homolog in Drosophila melanogaster, pleiohomeotic (PHO), represses transcription (48, 49), and it is possible that the PHO homolog in S2 cells may bind to this YY1 site to repress ie1 transcription in the absence of LvYY1. It is possible that other as-yet-unidentified repressors or activators that could play a role in this interaction may be present.

In human cells, YY1 is known to activate transcription via its interaction with TBP and basal transcription factors, including TFIIB and TAF_II55 (39–41). LvYY1 likely uses a similar mechanism to activate the transcription of ie1, as our transient-transfection results show that LvYY1 may activate ie1 transcription via a TATA box in the promoter (Fig. 3B) and also interacts with LvTBP in vitro and in vivo (Fig. 6). These results suggest that LvYY1 can activate shrimp promoters that contain a TATA box.

Our study shows that the introduction of dsYY1 RNA reduces the transcription of ie1 in shrimp 24 to 48 h after infection (Fig. 7E) and also reduces WSSV genome copy numbers (Fig. 7C and D). More importantly, injection of dsYY1 RNA decreases shrimp mortality after WSSV infection (Fig. 7F). It was reported previously that dsRNA treatment causes nonspecific virus inhibition (45), and this may decrease cumulative mortality rates. However, our data did not show any significant differences between the PBS and dsGFP RNA groups (Fig. 7F). The dosage of dsRNA and the physiological difference in the test animals involved may play a role in this. Our study demonstrates that LvYY1 is involved in ie1 transcription and required for the proliferation of WSSV. Although the application of dsYY1 RNA to reduce rates of infection may not be practical, this study nevertheless shows that LvYY1 is a useful target for such a purpose. It is commonly known that ie1 mRNA can be detected by RT-PCR as soon as 1 to 2 h after infection (13, 14). Since WSSV infection is extremely lethal to shrimp, infection with large amounts of the virus would have made our study difficult due to rapid shrimp death. A previous study examining the Warburg effect in shrimp used low levels of virus to investigate the host metabolic shift after virus infection (55), and in this study, we used similar conditions to investigate the effect of dsYY1 RNA on the expression of ie1 at 24 to 48 h postinfection (Fig. 7E).

In summary, we cloned the gene encoding LvYY1 and found that LvYY1 activates WSSV ie1 expression via binding to a YY1 response element in the ie1 promoter and interactions with basal transcription factors. Reduced LvYY1 expression levels critically affect the ability of WSSV to proliferate. Taken together, these findings demonstrate the importance of the LvYY1-IE1 host-virus interaction for WSSV replication and virulence.

MATERIALS AND METHODS

Bacterial strains, cell lines, and experimental animals.

Two strains of Escherichia coli, EPI-300 and BL21(DE3), which were used for plasmid DNA maintenance/extraction and recombinant protein expression, respectively, were cultured on Luria-Bertani (LB) plates. Spodoptera frugiperda Sf9 cells and Drosophila melanogaster S2 cells were cultured at 27°C in Sf-900 II SFM (Invitrogen) or Schneider's drosophila medium (Invitrogen). L. vannamei experimental shrimp, each weighing 3 g on average, were purchased from the Aquatic Animal Center at National Taiwan Ocean University. Shrimp were cultured in water tanks containing seawater (30 ppt at 27°C) and acclimated for ∼3 to 4 days before experiments. The virus used in this study was the WSSV T-1 isolate (GenBank accession no. AF440570) (56), which was prepared from a batch of WSSV-infected specific-pathogen-free (SPF) L. vannamei shrimp (57). The virus stock was further diluted with PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, 2 mM KH₂PO₄) to the experimental titer that caused ∼100% cumulative mortality of shrimp 5 days after virus challenge.

RNA extraction and RT-PCR.

WSSV-infected or mock-infected shrimp tissues were homogenized in liquid nitrogen by using mortars and pestles precooled with liquid nitrogen. Mortars were filled with liquid nitrogen prior to homogenization in order to ensure the complete powdering of shrimp tissues. The homogenized tissue powder was then immediately treated with TRIzol reagent (Invitrogen) for RNA extraction according to the manufacturer's instructions. RNA samples were then treated with RNase-free DNase I (Qiagen, Valencia, CA) to remove genomic DNA contaminants. DNA-free RNA samples were then reverse transcribed by using oligo(dT) as a primer and the ImProm-II reverse transcription system (Promega) for first-strand cDNA synthesis. Genes of interest were detected by PCR using the primers listed in Table 1, while β-actin served as an internal control. Pfu DNA polymerase (Promega) was used for PCR amplification; cycles for LvYY1 amplification were 95°C for 2 min, followed by 28 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 70 s, with one cycle at 72°C for 5 min and then a cooldown to 4°C.

TABLE 1.

Primers used in this study

Primer	Primer sequence (5′–3′)	Usage
RACE-F	CATCCTCACCCATGCCAAAGC	3′ RACE
RACE-R	GTCAACGCCAGGTATACCCG	5′ RACE
YY1-F	CGTAAACATCTACATACACATGGTC	RT-PCR
YY1-R	TGAAGAATGAGTTGTCTCCA	RT-PCR
β-actin-F	GAYGATATGGAGAAGATCTGG	RT-PCR
β-actin-R	CCRGGGTACATGGTGGTRCC	RT-PCR
EF-1α-F	GGAGATGCACCACGAAGCTC	RT-PCR
EF-1α-R	TTGGGTCCGGCTTCCAGTTC	RT-PCR
IE1-F	TGGCACAACAACAGACCCTA	qPCR
IE1-R	CTTTCCTTGCCGTACGAGAC	qPCR
EF-1α-F	TGCTCTGGACAACATCGAGC	qPCR
EF-1α-R	CGGGCACTGTTCCAATACCT	qPCR
WSSV285-F	AGGCAGTCAGGAAGAGTGATCTAGA	qPCR
WSSV285-R	AATTCTTCGATGCCTCCATTGA	qPCR
pIE1-F	TGAATCATGTTAAGGAATTTCCTTGTTACT	ChIP assay
pIE1-R	GAGCTAACACGGGCTCTTATATACACAAAT	ChIP assay
dsYY1-1-F	GGATCTAATACGACTCACTATAGGCCAGAGATACAGGAGGTTGA	dsRNA production
dsYY1-1-R	TTTCTTTGGCTTTATCTTCG	dsRNA production
dsYY1-2-F	CCAGAG ATACAGGAGGTTGA	dsRNA production
dsYY1-2-R	GGATCCTAATACGACTCACTATAGGTTTCTTTGGCTTTATCTTCG	dsRNA production
dsGFP-1-F	GGATCCTAATACGACTCACTATAGGATGGTGAGCAAGGGCGAGG	dsRNA production
dsGFP-1-R	TTGATGCCGTTCTTCTGCT	dsRNA production
dsGFP-2-F	ATGGTGAGCAAGGGCGAGG	dsRNA production
dsGFP-2-R	GGATCCTAATACGACTCACTATAGGTTGATGCCGTTCTTCTGCT	dsRNA production

Rapid amplification of cDNA ends.

5′ RACE and 3′ RACE were performed by using the FirstChoice RLM-RACE kit (Ambion, Austin, TX) according to the manufacturer's instructions. Total RNA was extracted from the cephalothoraxes (including the heart, gut, gills, and parts of muscle tissue) of L. vannamei shrimp and then reverse transcribed by using oligo(dT) as a primer. The resulting cDNA was subjected to nested PCR using the anchor and gene-specific primers RACE-F and RACE-R (Table 1), which were designed according to the sequence of L. vannamei EST (GenBank accession no. FE125424). GoTaq Flexi DNA polymerase (Promega) was used for PCR, and the cycles were as follows: 95°C for 2 min, followed by 35 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 3 min, with one cycle at 72°C for 5 min and then a cooldown to 4°C. The PCR product was then introduced into a T&A cloning vector (RBC Bioscience, Taiwan), and at least 5 constructs were sequenced.

Plasmid construction.

Plasmid pET-LvYY1 was constructed by inserting a full-length LvYY1 DNA fragment, which was amplified by using primers LvYY1-F and LvYY1-R (Table 2) with L. vannamei cDNA as a template, into pET-28a (Novagen, Madison, WI). Full-length LvYY1 was also cloned into pDHSP/V5-His (7) to generate pDHSP-LvYY1/V5-His for insect cell transfection. Luciferase reporter plasmids, including pIE1(−268/+52), pIE1(−94/+52), and pIE1(+5/+52), were described previously (7). Plasmid pIE1(−44/+52) was constructed by inserting a PCR-amplified DNA fragment that contains the sequence from positions −44 to +52 in the ie1 promoter at the HindIII and XhoI sites in pGL3-Basic (Promega). Plasmid pIE1(−268/+52)-mYY1 contained the same sequence as that of pIE1(−268/+52) except that the YY1-binding site in the ie1 promoter was modified from 5′-ATGG to 5′-CGAT by using the overlap extension method (58). Plasmid pIE1(−268/+52)-mTATA contained the same sequence as that of pIE1(−268/+52) except that the TATA box was mutated from 5′-TATATAA to 5′-TAGCCAA. An empty vector, pDHSP/Flag, was constructed by replacing the V5 tag in pDHSP/V5-His with a Flag tag sequence (5′-GATTACAAGGATGACGACGATAAG). A full-length LvYY1 DNA fragment was also inserted into pGEX-4T1 and pDHSP/Flag at the BamHI and EcoRI sites, respectively, to construct pGEX-LvYY1 and pDHSP-LvYY1/Flag. The gene encoding TATA-binding protein from L. vannamei (LvTBP) (GenBank accession no. FJ870977) was amplified by using primers LvTBP-F and LvTBP-R (Table 2), with L. vannamei cDNA as a template, and inserted into the BamHI-XhoI sites in pET-28a and pDHSP/V5-His to generate pET-LvTBP and pDHSP-LvTBP/V5-His, respectively. Plasmid pDHSP-EGFP/Flag was constructed by introducing the EGFP gene into the HindIII and BamHI sites in pDHSP/Flag. For the preparation of anti-LvYY1 polyclonal antibody, 180 amino acid residues from the N terminus of LvYY1 were amplified by using primers LvYY1-F and LvYY1-N-R (Table 2), with pET-LvYY1 as a template, and inserted into pET-28a to generate pET-LvYY1-dZ.

TABLE 2.

Primers used for construction

Plasmid	Forward primer (5′–3′)	Reverse primer (5′–3′)
pET-LvYY1	CGGGATCCATGGCTTCCTCCGACTTTGTG	CCGGAATTCCGGCTTGAATAGATAACAAACTGTTG
pET-LvTBP	CGCGGATCCATGGATCACATGCTGCCT	CCGCTCGAGTCATTGTTTTTTGAAGCTTTT
pIE1(−268/+52)	CCGCTCGAGGGTGTTAAAGAAGCAGTTGTG	CCCAAGCTTCTTGAGTGGAGAGAGAGAGC
pIE1(−268/+52)-mYY1	TTGCAGATGAAACGATCTGTTTGAATCA	TGATTCAAACAGATCGTTTCATCTGCAA
pIE1(−268/+52)-mTATA	GTGTAGCCAAGAGCCCGTGTTAGCTC	CTCTTAGCTACACAAATATGCTCCGCCC
pIE1(−44/+52)	CGGGTACCAGCATATTTGTGTATATA	CCCAAGCTTCTTGAGTGGAGAGAGAGAGC
pDHSP-EGFP/Flag	CCCAAGCTTATGGTGAGCAAGGGCGAG	CGCGGATCCCTTGTACAGCTCGTC
pET-LvYY1-dZ	CGGGATCCATGGCTTCCTCCGACTTTGTG	CCGAAGCTTTTATTCGGCAAGTTGTTTGGGG

Immunoblot analysis.

Protein samples from E. coli cells, insect cells, and shrimp were resolved by SDS-polyacrylamide gel electrophoresis, followed by electrotransfer to a Hybond C membrane (GE Healthcare). Proteins were probed by using anti-His antibody (catalog no. H1029; Sigma), anti-V5 antibody (catalog no. V8137; Sigma), anti-GST antibody (catalog no. sc-459; Santa Cruz), or anti-YY1 antibody generated by the TechComm Center of the College of Life Science, National Taiwan University, Taiwan. The Immobilon Western chemiluminescent horseradish peroxidase (HRP) substrate (Millipore) was used to visualize proteins on the membrane.

GST pulldown assay.

GST and GST-LvYY1 fusion proteins were expressed in isopropyl-β-d-thiogalactopyranoside (IPTG)-induced E. coli BL21(DE3)(pGEX-4T1) or E. coli BL21(DE3)(pGEX-LvYY1) cells, which were lysed with NETN buffer (20 mM Tris-HCl [pH 8.0], 100 mM NaCl, 1 mM EDTA, 0.5% IGEPAL) containing 10 μg/ml each of leupeptin, aprotinin, and 4-(2-aminoethyl)-benzenesulfonyl fluoride. Lysates were then cleared by centrifugation and purified with glutathione-Sepharose 4B (GE Healthcare) according to the manufacturer's instructions. Purified GST or GST-LvYY1 at a concentration of 40 ng/μl in 500 μl NETN buffer was added to 30 μl glutathione-Sepharose 4B and incubated for 1 h at 4°C. Glutathione-Sepharose beads were then washed three times with NETN buffer and incubated for 1 h with 50 μg of the purified His-tagged LvTBP recombinant protein that was purified from E. coli BL21(DE3)(pET-LvTBP) by using Ni-Sepharose (GE Healthcare) according to the manufacturer's instructions. Finally, the beads were washed three times with NETN buffer, followed by elution with 20 μl 2× electrophoresis sample buffer (100 mM Tris-HCl [pH 6.8], 20% glycerol, 4 mM EDTA, 2% SDS, 0.01% bromophenol blue, 20% β-mercaptoethanol). Eluted proteins were separated by SDS-PAGE and analyzed by Western blotting.

Immunoprecipitation assay.

Sf9 cells were cotransfected with pDHSP-LvTBP/V5-His and pDHSP-LvYY1/Flag or pDHSP-EGFP/Flag. Cell lysates were prepared by using PBS buffer (PBS and 0.1% IGEPAL [Sigma]), centrifuged at 13,800 × g for 10 min, and then mixed with anti-Flag antibody-conjugated M2-agarose beads (Sigma) at 4°C for 1 h. Beads were centrifuged and washed three times with PBS buffer. Proteins binding to the beads were eluted by using 2× electrophoresis sample buffer and analyzed by Western blotting. For immunoprecipitation of proteins in shrimp lysates, 0.5 g sliced shrimp muscle tissues was homogenized by using a 10-ml Dounce homogenizer for 5 strokes in 5 ml PBS buffer. The homogenized tissues were transferred to a 1.5-ml microcentrifuge tube and centrifuged at 200 × g for 10 min at 4°C. PBS was discarded, and cells were suspended in IP buffer (12 mM HEPES [pH 7.9], 0.1% Triton X-100) containing 10 μg/ml each of leupeptin, aprotinin, and 4-(2-aminoethyl)-benzenesulfonyl fluoride, followed by sonication for 1 min with intervals of a 10-s sonication and a 10-s pause, at 25% amplitude on ice (catalog no. VCX750; Vibra-cell). The lysates were cleared by centrifugation, and anti-GST or anti-YY1 antibody was added, followed by 4 h of incubation at 4°C. Protein A-Sepharose beads (Millipore) were added and washed with IP buffer three times. The precipitated protein was eluted by using 2× electrophoresis sample buffer and analyzed by immunoblotting.

Transient-transfection and luciferase assays.

Sf9 cells (4 × 10⁵ cells/well) were seeded onto 6-well plates and then transfected with 3 μg of the indicated plasmids by using 6 μl of Cellfectin II reagent (Invitrogen, San Diego, CA). After transfection for 16 to 18 h, the cells were heat shocked in a 42°C incubator for 30 min and then returned to 27°C for 24 h. Cells were then collected for further analysis. For reporter assays, S2 cells seeded onto 24-well plates (8 × 10⁵ cells/well) were cotransfected with 100 ng of a reporter plasmid and 400 ng of an effector plasmid. After 36 h of transfection, cells were harvested and lysed by using 200 μl Luc lysis buffer (25 mM Tris-phosphate [pH 7.8], 2 mM EDTA, 2 mM dl-dithiothreitol [DTT], 10% glycerol, 1% Triton X-100) containing 10 μg/ml each of leupeptin, aprotinin, and 4-(2-aminoethyl)-benzenesulfonyl fluoride, followed by centrifugation at 13,800 × g for 10 min at 4°C. The supernatant (80 μl) was used for luciferase activity analysis. Luciferase activity was measured by using an Orion II microplate luminometer (Berthold, Germany) with 60 μl Luc substrate [20 mM Tricine, 470 mM luciferin, 1.07 mM (MgCO₃)₄Mg(OH)₂·5H₂O, 2.67 mM MgSO₄, 0.1 mM DTT, 270 mM coenzyme A, 530 mM ATP]. The reagents described above were prepared according to methods described previously (59). The data obtained from the reporter assay were subjected to one-way analysis of variance (ANOVA) using SPSS software 12.0. P values of <0.05 were considered statistically significant.

Electrophoretic mobility shift assay.

An EMSA was performed by using a LightShift chemiluminescent EMSA kit (Thermo Scientific, Rockford, IL), according to the manufacturer's instructions. Nuclear proteins from pDHSP-LvYY1/V5-His-transfected Sf9 cells or shrimp muscle tissues were extracted by using NE-PER nuclear and cytoplasmic extraction reagents (Thermo) according to the protocol provided by the manufacturer, and proteins were quantified by using the Bradford method (60). Double-stranded DNAs containing the YY1-binding sequence from the WSSV ie1 promoter were labeled with 5′-biotin and used as probes. For competition experiments, nuclear extracts were preincubated for 10 min with a 100-fold molar excess of unlabeled double-stranded competitor oligonucleotides. Labeled probes were then added to the mixture, and the mixture was incubated for 20 min at room temperature. For supershift assays, nuclear extracts were incubated with labeled probes for 20 min at room temperature, followed by incubation with antibodies for 20 min on ice. The reaction mixtures were separated by 6% polyacrylamide gel electrophoresis. Proteins in the gel were electrotransferred to a Hybond-N⁺ membrane (Amersham), followed by enhanced chemiluminescence (ECL) visualization.

Double-stranded RNA preparation and RNA interference.

dsRNAs were generated by using the RiboMAX T7 large-scale RNA production system (Promega, Madison, WI). DNA templates for YY1 dsRNA preparation were generated by PCR using dsYY1-1-F/R and dsYY1-2-F/R (Table 1) as primers and pET-LvYY1 as a template. DNA templates for GFP dsRNA were also amplified by PCR using dsGFP-1-F/R and dsGFP-2-F/R (Table 1) as primers and pDHSP-EGFP/Flag as a template. After the in vitro transcription reaction, single-strand RNA was annealed to the double-strand form, and the remaining DNA templates were removed by using RNase-free DNase I, followed by acid phenol-chloroform extraction. The concentrations of the dsRNA product were then quantified by using a UV spectrophotometer and verified by agarose gel electrophoresis. Forty-five shrimp were randomly divided into three groups and then injected with either 2 μg dsRNA per g shrimp weight or PBS buffer. At 48 h post-dsRNA injection, shrimp were challenged with a WSSV solution that was diluted 80-fold from a virus stock. Shrimp cephalothoraxes and pleopods from 5 shrimp in each group were collected at baseline and every 24 h postinfection for 48 h and used for RNA extraction and DNA extraction, respectively. A cumulative mortality test was performed in the manner described above, with mortality rates being recorded every 12 h postinfection over a period of 240 h. Shrimp were removed from tanks immediately after death. The data obtained from the cumulative mortality test was charted by using Kaplan-Meier survival analysis. P values of <0.05 were considered statistically significant.

Determination of dsRNA knockdown efficiency by Western blotting.

To establish a correlation between protein amounts and YY1 knockdown efficiency, muscle tissues from shrimp injected with PBS, dsGFP, or dsYY1 were homogenized by using a Precellys 24 homogenizer (Bertin). Sliced tissues were suspended in 1 ml radioimmunoprecipitation assay (mRIPA) buffer (50 mM Tris-HCl [pH 7.8], 150 mM NaCl, 5 mM EDTA, 0.5% Triton X-100, 0.5% IGEPAL, 0.1% sodium deoxycholate) containing 10 μg/ml each of leupeptin, aprotinin, and 4-(2-aminoethyl)-benzenesulfonyl fluoride and ground for 15 s at 1,500 rpm three times. Lysates were cleared by centrifugation at 13,800 × g for 15 min at 4°C twice, and a Bradford assay was then conducted to determine protein levels. Equal amounts of proteins from five shrimp of the same treatment group were mixed together, and 30 μg proteins was loaded onto each lane of a gel for immunoblot analysis.

Quantitative real-time PCR analysis.

To determine WSSV copy numbers, total DNA of infected and mock-infected shrimp was extracted from pleopods by using a dodecyltrimethylammonium bromide (DTAB)-cetyltrimethylammonium bromide (CTAB) DNA extraction kit (BioMi, Taiwan). Concentrations of purified DNA were determined with a spectrophotometer, and quantitative real-time PCR (qPCR) amplification was then performed by using FastStart Universal SYBR green Master (Roche, Mannheim, Germany) and the CFX96 real-time PCR detection system (Bio-Rad). The WSSV285 gene was amplified to estimate virus copy numbers, and the EF-1α gene was amplified as an internal control, with the relevant primers shown in Table 1. All samples were prepared in duplicate. The standard curves were generated from serial dilutions (10 to 10⁷) of plasmids containing fragments of the WSSV285 and EF-1α genes. The WSSV genomic DNA copy numbers were then calculated according to these two standard curves. For ie1 mRNA assessment, total RNA from shrimp cephalothoraxes was extracted and reverse transcribed. cDNA products were then subjected to qPCR amplification with specific primers (Table 1). The amplification of EF-1α served as an internal control for the normalization of ie1 expression levels. The data obtained from qPCR analysis were subjected to one-way ANOVA using SPSS software 12.0. P values of <0.05 were considered statistically significant.

Chromatin immunoprecipitation assay.

A ChIP assay was performed according to a previously reported protocol (61). Shrimp that were mocked infected or infected with WSSV for 48 h were sacrificed. Muscle tissues were sliced into small pieces and incubated with a 1% formaldehyde–PBS solution for 1 h with gentle mixing. The cross-linking reaction was quenched with glycine treatment, and the tissues were washed three times with PBS. A total of 300 mg of tissue was then suspended in 1 ml ChIP lysis buffer (12 mM HEPES [pH 7.9], 1% SDS, 10 mM EDTA) containing 10 μg/ml each of leupeptin, aprotinin, and 4-(2-aminoethyl)-benzenesulfonyl fluoride, followed by sonication for 20 min on ice with intervals of a 10-s sonication and a 10-s pause at 20% amplitude (catalog no. VCX750; Vibra-cell). The lysates were then centrifuged at 13,800 × g for 15 min at 4°C and stored at −80°C. For immunoprecipitation, 100 μl of the lysate was diluted 10-fold with dilution buffer (12 mM HEPES [pH 7.9], 0.1% IGEPAL, 1 mM EDTA), 0.5 μg anti-YY1 antibody or 0.5 μg anti-GST antibody was added, and the mixture was incubated overnight at 4°C. Immunoprecipitated complexes were incubated with 50 μl protein A-Sepharose beads for 2 h at 4°C and then sequentially washed with dilution buffer four times, followed by a double wash using a high-salt wash buffer (12 mM HEPES [pH 7.9], 500 mM NaCl, 1 mM EDTA, 0.1% SDS, 0.1% deoxycholate [DOC], 1% Triton X-100) and another double wash with TE buffer (10 mM Tris-Cl [pH 8.0], 1 mM EDTA). The washed beads were then eluted twice by using 250 μl elution buffer (50 mM Tris-HCl [pH 8.0], 10 mM EDTA, 1% SDS) for 1 h at 55°C with gentle mixing. The eluates were added with 40 μl of 5 N NaCl, followed by incubation overnight at 65°C to reverse formaldehyde cross-linking. The unlinked samples were treated with proteinase K and purified with phenol-chloroform extraction, followed by ethanol precipitation. The presence of the ie1 promoter was further detected by qPCR using primers pIE1-F and pIE1-R (Table 1). Data analysis was conducted according to methods described previously by Nelson et al. (62) and Haring et al. (63).

Accession number(s).

The newly determined sequence was deposited in GenBank under accession number KT820172.