Postnatal treatment with metyrapone attenuates the effects of diet-induced obesity in female rats exposed to early-life stress

Abstract

Experimental studies in rodents have shown that females are more susceptible to exhibiting fat expansion and metabolic disease compared with males in several models of fetal programming. This study tested the hypothesis that female rat pups exposed to maternal separation (MatSep), a model of early-life stress, display an exacerbated response to diet-induced obesity compared with male rats. Also, we tested whether the postnatal treatment with metyrapone (MTP), a corticosterone synthase inhibitor, would attenuate this phenotype. MatSep was performed in WKY offspring by separation from the dam (3 h/day, postnatal days 2–14). Upon weaning, male and female rats were placed on a normal (ND; 18% kcal fat) or high-fat diet (HFD; 60% kcal fat). Nondisturbed littermates served as controls. In male rats, no diet-induced differences in body weight (BW), glucose tolerance, and fat tissue weight and morphology were found between MatSep and control male rats. However, female MatSep rats displayed increased BW gain, fat pad weights, and glucose intolerance compared with control rats (P < 0.05). Also, HFD increased plasma corticosterone (196 ± 51 vs. 79 ± 18 pg/ml, P < 0.05) and leptin levels (1.8 ± 0.4 vs. 1.3 ± 0.1 ng/ml, P < 0.05) in female MatSep compared with control rats, whereas insulin and adiponectin levels were similar between groups. Female control and MatSep offspring were treated with MTP (50 µg/g ip) 30 min before the daily separation. MTP treatment significantly attenuated diet-induced obesity risk factors, including elevated adiposity, hyperleptinemia, and glucose intolerance. These findings show that exposure to stress hormones during early life could be a key event to enhance diet-induced obesity and metabolic disease in female rats. Thus, pharmacological and/or behavioral inflection of the stress levels is a potential therapeutic approach for prevention of early life stress-enhanced obesity and metabolic disease.

trends in obesity among adults in the US are showing that the age-adjusted prevalence in 2013–2014 was higher in women (40.4%) than in men (35%) (15, 51). The underlying mechanisms for this health disparity are not completely understood. However, hypothesized contributors include sex differences in lean muscle mass, glucose metabolism, body fat distribution, adipocyte size and function, hormonal regulation of body weight, adiposity influence of menopause transition, and altered susceptibility to peripheral insulin resistance (42, 47, 49).

Besides the well-established influence of genetic and lifestyle traditional risk factors, early-life stress (ELS) has been recognized as an independent risk factor for cardiovascular and metabolic disease in adulthood (1, 10, 38, 50, 61). Numerous clinical studies have documented that ELS can induce long-lasting effects by misprograming the immune, neuroendocrine, and vascular function. Recent data from the national longitudinal survey of the Americans’ Changing Lives show that women who experienced emotional stress during childhood gained weight more rapidly than men (30). Also, the Ovarian Aging Study (OVA) reports that socioeconomic disadvantage experienced during puberty may have a stronger impact on adulthood cardiometabolic risk, which is greater in women (6). Therefore, these recent findings suggest that ELS could contribute to the projected epidemic rates of obesity in a sex-specific manner.

In some physiological conditions, behavioral stress can reduce body weight (17). Besides experimental studies that combine a hypercaloric diet with behavioral stress showing a synergistic effect in body weight gain and fat expansion in adult rodents (25, 65, 66), little is known about the mechanism by which ELS, may exert permanent modifications on the metabolic homeostasis.

It is widely accepted that maternal separation (MatSep), a chronic behavioral stress model during postnatal life in rodents, exerts long-term effects on the hypothalamic-pituitary-adrenal (HPA) axis function, negatively influencing behavioral responses (34, 39). A growing number of studies have shown that this paradigm also exaggerates cardiovascular, neuroendocrine, and immune responses to “secondary insults” during adult life (7, 24, 36, 56). Importantly, the hyporesponsive period is a stage of resilience to mild stressors during early postnatal life (days 0–10) (39, 63). This phenomenon allows a natural protection of the offspring from excessive glucocorticoid levels to ensure normal tissue/organ development during this critical window of plasticity. Several studies have reported a short-term rise in plasma corticosterone levels in rat pups undergoing the MatSep procedure (5, 53, 58). Hence, rats subjected to chronic stress as offspring display exaggerated acute stress-induced plasma levels of corticosterone and ACTH as adults (21, 29, 40, 53, 55), providing evidence for persistent activation of the HPA axis in these responses.

Notably, chronic treatment with a corticosterone synthase inhibitor, metyrapone (MTP), has been used to attenuate the behavioral, cardiovascular, and metabolic responses to various models of developmental programming (3, 26, 54). Similarly, targeting corticosterone has been used in adult life as an approach for the treatment of metabolic disease in adult db/db mice, a genetic model of obesity and diabetes. Because db/db mice display increased circulating corticosterone levels compared with wild-type mice, chronic treatment with MTP reduced body weight and improved glycemic control in these mice (12). Furthermore, it has been shown that MTP treatment attenuates the behavioral and neurochemical alterations secondary to stressful experiences (8). However, there are no reports showing that the long-lasting effects of emotional stress-induced elevations in corticosterone during postnatal life can be prevented by MTP administration.

Taken together, the current study tested the hypothesis that exposure to MatSep would exaggerate diet-induced obesity phenotype in female rats compared with male rats. Also, we investigated whether the administration of MTP during postnatal life reverts the stress-induced programming of the metabolic function. Therefore, we determined the effect of diet-induced obesity on adipocyte number and morphology, plasma metabolic markers, blood pressure, glucose sensitivity, and tissue gene expression in adult female rats that were untreated or treated with MTP during postnatal life.

METHODS

Animal model and design.

All animal protocols received prior approval by the Institutional Animal Care and Use Committee at the University of Kentucky. Maternal separation (MatSep) protocol was performed as described previously (36). Briefly, approximately half of the male and female pups were separated from their mothers and littermates by having the pups transferred to a clean cage in an incubator (30 ± 1°C) for 3 h from days 2 to 14 of life. Normally reared and unhandled littermates remained with their mother and served as the control group. At weaning (4 wk of age), female rats were placed on special diets for 12 wk. Body weight and fat depot weights were determined gravimetrically and expressed in grams. Blood was obtained from a direct puncture into the abdominal aorta under anesthesia.

MTP treatment.

At postnatal day 2 (1st day of separation), a daily administration of MTP (50 µg/g body wt ip injection, solubility in water: 100 mM; Tocris, Bristol, UK) was conducted at 8:30 AM, 30 min before the exposure to MatSep (9 AM-12 PM). From postnatal days 2 to 14, 3 µl of MTP stock solution (17 mg/ml) were injected, increasing 5-µl volume with every 2 g of weight gain (3, 62).

Diet composition.

The high-fat diet (HFD) consisted of calories from 14% protein, 26% carbohydrates, and 60% fat, 5.49 kcal/g gross energy, and 0.4% NaCl (F3282; Bioserv, Frenchtown, NJ). Regular chow (ND) consisted of calories from 24% protein, 58% carbohydrates, and 18% fat, 3.1 kcal/g gross energy, and 0.4% NaCl (Teklad 8604; Teklad, Madison, WI). All rats were given tap water ad libitum.

Plasma and urine measurements.

Plasma was collected using EDTA 7.5% solution. Corticosterone (Cayman, Ann Arbor, MI), leptin (Cayman), insulin (Cayman), and adiponectin (EMD Millipore, CA) EIA kits were performed, following the manufacturer’s specifications. Glucose was determined in total blood using a glucometer (Accu-check; Roche). Plasma cholesterol and triglyceride were determined using an enzymatic kit (Wako Diagnostics, Richmond, VA).

Rats were placed in metabolic cages for determination of water and food intake as well as urine output. After 2 days of acclimation, 24-h urine collections were obtained. Proteinuria was determined by Coomassie Blue colorimetric assay.

Oral glucose tolerance test.

An oral glucose tolerance test (OGTT) was performed in rats after 9 wk of ND or HFD. Rats were fasted overnight for 16 h before glucose tolerance test. Rats were administered d-glucose (2 g/kg body wt, oral gavage), and blood glucose measurements were taken via tail prick at 0,15, 30, 60, and 120 min using a glucometer (Accu-check; Roche).

Histological analysis of adipose tissue morphology.

Adipose tissue depots, including subcutaneous, epididymal, and perirenal, were collected in 10% buffered formalin, fixed for 24 h, and paraffin-embedded. Following this, 5-µm sections were cut and stained with hematoxylin and eosin. Images of slides were obtained at ×10 magnification. Using the “detect edges,” image threshold, and object count features of NIS Elements software (Nikon Instruments, Tokyo, Japan), the area of each adipocyte and cell number within a 1,500 × 1,500 µm² measurement frame was quantified. Adipocyte size and number were quantified on two measurement frames within each section of adipose tissue (n = 2 sections/rat) from rats in each group (n = 5 rats/group).

Blood pressure, heart rate, and activity measurements.

Rats fed a HFD (4/group) were implanted with radiotelemetry transmitters at 10 wk of age (Data Sciences, St. Paul, MN) (32, 35). Briefly, rats were anesthetized with isoflurane (1–4% in O₂) in a sterile surgical field. The abdominal aorta was then exposed by a midline incision and briefly occluded. The transmitter catheter was inserted into a hole made by a 21-gauge needle just proximal to the iliac bifurcation and secured in place with tissue glue (Vetbond). The transmitter body was attached to the abdominal wall along the incision line with a 4-O proline suture as the incision was closed. The skin was closed with staples that were removed 7 days after the incision had healed. After recovery (14 days), mean arterial pressure (MAP), heart rate (HR), and activity were recorded by radiotelemetry (Data Sciences International, New Brighton, MN) in 10-s bursts every 10 min throughout the experiment.

Quantitative analysis of mRNA expression.

Total RNA was extracted from rat adipose tissue and liver using Purzol Reagent (Bio-Rad) and the RNA isolation kit Aurum Total RNA. cDNA was prepared from 1µg of total RNA. The mRNA levels in tissue were measured using I-Taq Universal SYBR Green (Bio-Rad) with a CFX96 Real Time System (Bio-Rad). The oligonucleotide primers for the different genes were designed using the NCBI Pick Primer program and made by Integrated DNA Technologies. An optimal primer concentration was determined, and a single melting curve was obtained. The co-amplification of rat GAPDH mRNA was used as the housekeeping gene. The assays were performed in triplicate, and the results were normalized to the GAPDH mRNA levels using the $2^{{}^{–\Delta \Delta C_T}}$ method.

Study in male rats.

Male control and MatSep rats were placed on a ND or a HFD upon weaning as well. Body weight was recorded weekly (n = 12/group). Glucose tolerance test (n = 6/group), white adipose tissue morphometrical analysis (n = 5/group), and plasma metabolic profile were measured as described above. Because of the lack of MatSep effects observed after 12 wk, the study in male rats was extended for an additional 5 wk.

Statistical analysis.

Data were expressed in means ± SE. Statistical analysis was performed using Graph Pad Prism 6 for Mac, Version 6.0 (GraphPad Software, La Jolla, CA). For blood pressure and body weight gain analysis, two-way repeated-measures ANOVA was performed for differences in blood pressure over time. A value of P < 0.05 was considered statistically significant. Two-way ANOVA was used to assess the interaction between MatSep and MTP treatment. Differences between control and MatSep groups were compared using unpaired Student’s t-test. The criterion for significance was P < 0.05.

RESULTS

MatSep does not affect metabolic parameters in female rats fed a ND.

Female MatSep rats showed similar body weight, plasma parameters, and metabolic profile (Table 1) compared with control rats fed a ND diet. MatSep did not increase tissue weight or alter adipose tissue morphology as well. Furthermore, gene expression in liver and gonadal white adipose tissue (gWAT) was not different between groups at baseline conditions (Table 2).

Table 1.

Metabolic parameters in 12-wk-old female rats fed a ND are not different in control or MatSep rats

	Control	MatSep
Metabolic profile
Body weight, g	205 ± 7	206 ± 5
Food intake, g/day	17.1 ± 1.5	16.3 ± 2.5
Water intake, ml/day	24.1 ± 2.3	23.1 ± 4.1
Urine flow, ml/day	10.2 ± 0.9	13.5 ± 1.0
Proteinuria, mg/day	4.3 ± 0.5	4.9 ± 0.6
Plasma profile
Fasting glucose, mg/dl	78 ± 3	80 ± 2
Insulin, ng/ml	1.6 ± 0.2	1.6 ± 0.4
Leptin, ng/ml	4.1 ± 0.3	5.3 ± 0.6
Adiponectin, ng/ml	29.2 ± 2.2	27.5 ± 1.3
Corticosterone, ng/ml	60 ± 16	74 ± 22
Cholesterol, ml/dl	189 ± 15	183 ± 10
Triglycerides, ml/dl	111 ± 17	115 ± 15
Tissue weight
Liver weight, g	4.4 ± 0.5	4.1 ± 0.7
Adrenal weight, mg	67 ± 12	71 ± 14
Kidney weight, g	1.3 ± 0.2	1.4 ± 0.3
Spleen weight, g	0.4 ± 0.6	0.4 ± 0.2

Values are means ± SE; n = 6–8. ND, normal diet; MatSep, maternal separation.

Table 2.

Gene expression is not different in 12-wk-old female control or MatSep rats fed a ND

	Control	MatSep
Liver
11β-HSD1	1.10 ± 0.20	1.57 ± 0.20
GR	1.01 ± 0.05	1.02 ± 0.06
MR	1.01 ± 0.05	0.85 ± 0.18
PEPCK	1.07 ± 0.18	1.37 ± 0.10
PC	1.08 ± 0.19	0.96 ± 0.05
G6Pase	1.11 ± 0.18	1.24 ± 0.17
gWAT
11β-HSD1	1.11 ± 0.23	0.96 ± 0.17
GR	1.09 ± 0.17	1.72 ± 0.28
MR	1.15 ± 0.25	1.81 ± 0.38
GLUT4	1.01 ± 0.05	1.67 ± 0.18
PCG-1α	1.14 ± 0.29	1.09 ± 0.17
IR	1.24 ± 0.44	1.01 ± 0.18

Values are means ± SE; n = 6–8. 11β-HSD1, 11β-hydroxysteroid dehydrogenase type 1; GR, glucocorticoid receptor; MR, mineralocorticoid receptor; PEPCK, phosphoenolpyruvate carboxykinase; PC, pyruvate carboxylase; G6Pase, glucose-6-phosphatase; GLUT4, glucose transporter 4; PGC-1α, peroxisome proliferator-activated receptor-γ coactivator-1α; IR, insulin receptor.

MTP abolishes diet-induced increases in body weight and adiposity in MatSep rats.

After 4 wk on a HFD, female MatSep rats started gaining significantly more weight than control rats (Fig. 1A). This difference was maintained throughout the 12 wk of the study, showing an overall effect of MatSep [F(1, 31) = 7.1, P < 0.05], time [F(10, 310) = 841, P < 0.05], and interaction effect [F(10, 310) = 3.84, P < 0.05] on body weight. In addition, we found that MatSep increases gonadal white adipose tissue (gWAT; P < 0.05, t = 3.4, df = 11) and subcutaneous WAT (scWAT) weight in response to HFD (gWAT; P < 0.05, t = 2.7, df = 11), with no changes in perirenal WAT (prWAT; Fig. 1C). Despite this increase in adiposity, 24-h systolic blood pressure (SBP), diastolic blood pressure (DBP), mean arterial pressure (MAP), and heart rate (HR) were similar between groups (Table 3). However, MTP treatment blunted the MatSep effect to exacerbate diet-induced-obesity (Fig. 1B) and fat pad weight (Fig. 1D). Importantly, postnatal treatment with MTP did not affect the body weight gain in control rats fed a HFD.

Fig. 1.

Body weight and fat pad weights in rats fed for 12 wk on a high-fat (HFD). Untreated rats (A and C) and metyrapone (MTP)-treated rats (B and D); n = 12 (A and C) and 6 (B and D). *P < 0.05 vs. control. MatSep, maternal separation; gWAT, gonadal white adipose tissue; prWAT, perirenal white adipose tissue; scWAT, subcutaneous white adipose tissue.

Table 3.

Blood pressure, HR, and locomotor activity obtained by radiotelemetry in 12-wk-old female rats fed a HFD

	Control	MatSep
MAP, mmHg	107 ± 5	110 ± 4
SBP, mmHg	118 ± 6	122 ± 4
DBP, mmHg	96 ± 6	99 ± 6
HR, beats/min	340 ± 5	349 ± 8
Locomtor activity (AU)	1.8 ± 0.1	2.0 ± 0.1

Values are means ± SE; n = 4/group. HR, heart rate; MAP, mean arterial pressure; SBP, systolic blood pressure; DBP, diastolic blood pressure; HR, heart rate; AU, arbitrary units.

Histological analysis (Fig. 2, A and B) determined that MatSep rats fed a HFD diet display lower adipocyte number per frame of measurement in gWAT compared with control rats (373 ± 62 vs. 491 ± 49), and this effect was abolished in MTP-treated rats [553 ± 14 vs. 562 ± 33; MatSep: F(1, 62) = 11.7, P < 0.05; MTP: F(1, 62) = 7.2, P < 0.05; interaction: F(1, 62) = 0.6, P = not significant (NS)]. Similar results were obtained in scWAT (data not shown). Whereas HFD-fed rats displayed increased cell area in gWAT (Fig. 2C), MTP-treated MatSep rats showed a significant attenuation in these parameters [MatSep: F(1, 62) = 12.9, P < 0.05; MTP: F(1, 62) = 7.4, P < 0.05; interaction: F(1, 62) = 1.9, P = NS]. The same observations were made in cell diameter [MatSep: F(1, 62) = 11.7, P < 0.05; MTP: F(1, 62) = 7.2, P < 0.05; interaction: F(1, 62) = 0.6, P = NS]. In scWAT, increased cell area in response to HFD was attenuated in MTP-treated rats [MatSep: F(1, 49) = 11.7, P < 0.05; MTP: F(1, 49) = 1.7 P = NS; interaction: F(1, 49) = 20.6, P < 0.05; Fig. 2C], whereas MTP treatment showed a significant attenuation in these parameters [MatSep: F(1, 49) = 8.2, P < 0.05; MTP: F(1, 49) = 1.4, P = NS; interaction: F(1, 49) = 6.2, P < 0.05]. These data indicate that adipocytes are bigger in MatSep rats fed a HFD, and MTP treatment abolishes fat expansion in gWAT and scWAT.

Fig. 2.

White adipose tissue morphology in HFD-fed rats untreated and treated with MTP. A and B: representative pictures. C and D: cell area. E and F: cell diameter. *P < 0.05 (separation), #P < 0.05 (treatment), and †P < 0.05 (interaction); n = 5/group. gWAT, gonadal white adipose tissue; scWAT, subcutaneous adipose tissue.

MTP reduces plasma corticosterone and leptin in MatSep rats.

MatSep enhanced corticosterone and leptin levels in untreated rats fed a HFD, whereas MTP treatment had a robust effect on lowering their levels in both groups [MatSep: F(1, 26) = 5.1, P < 0.05; MTP: F(1, 26) = 12.2, P < 0.05; interaction: F(1, 26) = 5.4, P < 0.05; Fig. 3, A and C]. MTP treatment reduced insulin levels in both groups [MatSep: F(1, 19) = 0.01, P = NS; MTP: F(1, 19) = 12.5, P < 0.05; interaction: F(1, 19) = 1.2, P = NS; Fig. 3B]. Also, no changes in adiponectin were observed between groups in untreated rats fed a HFD. Furthermore, MTP treatment increased plasma adiponectin similarly in both groups [MatSep: F(1, 20) = 3.5, P = NS; MTP: F(1,20) = 9.4, P < 0.05; interaction: F(1, 20) = 0.2, P = NS; Fig. 3D]. Taken together, these data indicate that MTP treatment exerted an overall improvement in several metabolic hormones implicated in the advancement of diet-induced metabolic derangements, particularly in MatSep rats.

Fig. 3.

Plasma profile in untreated and MTP-treated rats. A: corticosterone (CORT). B: insulin. C: leptin. D: adiponectin. *P < 0.05 (separation); #P < 0.05 (treatment); †P <0.05 (interaction). Untreated, n = 6–12; MTP, n = 6.

MTP attenuates MatSep-induced glucose intolerance.

After 12 wk of HFD feeding, OGTT was increased in MatSep rats compared with control rats (Fig. 4A). Likewise, the postnatal treatment with MTP significantly improved the OGTT in MatSep rats [MatSep: F(1, 21) = 5.6, P < 0.05; MTP: F(1, 21) = 0.1, P = NS; interaction: F(1,21) = 0.7, P = NS; Fig. 4B]. These data support the notion that MTP treatment is associated with an improvement of the glucose sensitivity in MatSep rats.

Fig. 4.

Oral glucose tolerance test in 16-h-fasted untreated and MTP-treated rats fed a HFD for 9 wk. A: plasma glucose time course. B: area under the curve. *P < 0.05 (separation) vs. control. Untreated, n = 6; MTP, n = 6. AUC, area under the curve; AU, arbitrary units.

MTP treatment exerts an effect on the glucocorticoid metabolism in adipose tissue.

MatSep did not influence hepatic mRNA levels of 11βHSD1, GR, or MR from rats fed a HFD, and MTP treatment did not have a significant effect on these genes expression (Fig. 5A). However, rats exposed to MTP treatment had significantly higher levels of adipose gWAT, 11βHSD1, GR, and MR mRNA expression, and this effect was similar between control and MatSep groups [MatSep: F(1, 22) = 1.9, P = NS; MTP: F(1, 22) = 13.9, P < 0.05; interaction: F(1, 22) = 1.8, P = NS; Fig. 5B]. Thus, these data indicate that the adipose tissue may respond to the lower plasma circulating levels of corticosterone by increasing the expression of the local glucocorticoid metabolism components. Oligonucleotide primer sequences for the different genes are presented in Table 4.

Fig. 5.

Tissue gene expression of 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1), glucocorticoid receptor (GR), and mineralocorticoid receptor (MR) mRNA levels (quantitative RT-PCR) in liver (A) and gonadal white adipose tissue (gWAT; B) from rats fed a HFD. #P < 0.05 (treatment). Untreated, n = 6–8; MTP, n = 6.

Table 4.

Primers designed for qRT-PCR

	5′–3′ (Forward)	5′–3′ (Reverse)
Liver
11β-HSD1	GAAGAAGCATGGAGGTCAAC	GCAATCAGAGGTTGGGTCAT
GR	AGGGGAGGGGGAGCGTAATGG	CCTCTGCTGCTTGGAATCTGC
MR	ACCACATACATCGCTCCGAC	ATGGTGTGAGTGCATGCGTA
PEPCK	CTTCCCTCTGGGAACACACC	GTGCCACCTTTCTTCCTCCT
PC	CCAACATCCCATTCCAGATGC	CCACCTCACAGAACTTGAAGAC
G6Pase	AAGTCGCTCCCATTCCGTTT	GGGCTTCAGCGAGTCAAAGA
gWAT
GLUT4	TGCAGTGCCTGAGTCTTCTT	GGTTCCCCATCTTCAGAGCC
PCG-1α	CATTCAGGAGCTGGATGGCT	CAAAGAGGCTGGTCCTCACC
IR	TGCTGAGGACACTAGGCCAT	GGGTGTAGTGGCTGTCACAT
Housekeeper
GAPDH	TCTCTGCTCCTCCCTGTTCT	TACGGCCAAATCCGTTCACA

11β-HSD1, 11β-hydroxysteroid dehydrogenase type 1; GR, glucocorticoid receptor; MR, mineralocorticoid receptor; PEPCK, phosphoenolpyruvate carboxykinase; PC, pyruvate carboxylase; G6Pase, glucose-6-phosphatase; gWAT, gonadal white adipose tissue; GLUT4, glucose transporter 4; PGC-1α, peroxisome proliferator-activated receptor-γ coactivator-1α; IR, insulin receptor.

MTP normalizes gene expression associated with gluconeogenesis.

In HFD-fed rats, whereas no changes were found in PEPCK mRNA abundance, MTP treatment reduced the PC mRNA levels [MatSep: F(1, 20) = 3.4, P = NS; MTP: F(1, 20) = 4.4, P = NS; interaction: F(1, 20) = 13.4, P < 0.05; Fig. 6A]. Also, MatSep increased G6Pase mRNA expression in liver, which was attenuated by the postnatal MTP treatment [MatSep: F(1, 20) = 6.7, P < 0.05; MTP: F(1, 20) = 1.8, P = NS; interaction: F(1, 20) = 4.4, P = 0.0502; Fig. 6A].

Fig. 6.

Tissue gene expression of glucose metabolism in liver (A) and gonadal white adipose tissue (gWAT; B) from rats fed a HFD. *P < 0.05 (separation); #P <0.05 (treatment); †P < 0.05 (interaction). Untreated, n = 6–8; MTP, n = 6.

In gWAT, whereas MTP treatment significantly reduced GLUT4 expression [MatSep: F(1, 22) = 0.9, P = NS; MTP: F(1, 22) = 6.4, P < 0.05; interaction: F(1, 22) = 0.5, P = NS; Fig. 6B], it did not affect IR or PGC-1α (Fig. 6B). These data indicate that MatSep could induce glucose intolerance in response to HFD by enhancing the hepatic gluconeogenic activity. Lower IR expression in fat tissue most likely contributes to impairments in glucose uptake; however MTP treatment did not change its mRNA expression [MatSep: F(1, 22) = 18.1, P < 0.05; MTP: F(1, 22) = 0.2, P = NS; interaction: F(1, 22) = 0.3, P = NS].

MTP normalizes signs of proteinuria and reduces liver and adrenal weight.

MatSep and control rats fed a HFD showed similar 24-h food intake and water intake (Fig. 7, A and B). Although urinary excretion was not increased significantly in MatSep rats (Fig. 7C), it was accompanied by signs of renal damage, as evidenced by increased proteinuria in MatSep rats (Fig. 7D); however, these outcomes were attenuated by the MTP treatment [MatSep: F(1, 20) = 8.3, P < 0.05; MTP: F(1, 20) = 26.5, P < 0.05; interaction: F(1, 20) = 4.7, P < 0.05]. In addition, there were no differences between groups in liver, kidney, adrenal, and spleen weight from rats fed a HFD (Fig. 7, E–H), and yet MTP treatment significantly lowered liver (~25%) and adrenal weight (~20%) in control and MatSep rats [MTP: F(1, 20) = 56.5, P < 0.05]. These data indicate that the MTP treatment affects the organs that are especially sensitive to glucocorticoid levels during postnatal life.

Fig. 7.

Metabolic profile. A–D: parameters obtained in 24-h metabolism cage housing for untreated and MTP-treated rats. E–H: organ weight after 12 wk on a HFD in untreated and MTP-treated rats. *P < 0.05 (separation); #P < 0.05 (treatment); †P <0.05 (interaction). Untreated, n = 6–12; MTP, n = 6.

MatSep does not influence body weight or glucose tolerance in male rats.

In a period of 12 wk on a HFD, male MatSep did not show significant increases in body weight compared with control rats. In week 17, body weight gain remained similar between MatSep and control rats (Fig. 8A), and fat pad weights were not different between groups (Fig. 8B). Exposure to MatSep during postnatal life did not induce overall changes on WAT morphology in response to HFD. MatSep did not influence cell area or diameter in gWAT and scWAT compared with control rats (Fig. 8, C and D). Accordingly, cell number was not different between MatSep and control groups in gWAT (555 ± 44 vs. 562 ± 30 cells/measurement frame, respectively, P = NS, t = 1.5, df = 18) or scWAT (344 ± 25 vs. 291 ± 40 cells/measurement frame, respectively, P = NS, t = 1.2, df = 16).

Fig. 8.

Diet-induced obesity in MatSep and control male rats. A: body weight gain over the course of 17 wk (n = 12). B: fat pad weight (n = 6).C: gonadal white adipose tissue (gWAT) morphology (n = 5). D: subcutaneous white adipose tissue (scWAT) morphology (n = 5). No significant differences were observed.

After 15 wk of HFD feeding, OGTT was not statistically different between MatSep and control rats fed a ND [area under the curve (AUC): 24.3 ± 0.7 vs. 23.2 ± 3.3 mg·dl⁻¹·120 min × 10³]. In response to HFD, the elevation in the total AUC was not statistically significant between groups (AUC: 31.2 ± 0.8 vs. 33.6 ± 1.6 mg·dl⁻¹·120 min × 10³). In addition, plasma metabolic profile in MatSep and control male rats showed similar fasting glucose (100 ± 9 vs. 105 ± 7 mg/dl, P = NS, t = 2.1, df = 18), total plasma cholesterol E (133 ± 5 vs. 128 ± 6 mg/dl, P = NS, t = 0.4, df = 14), and plasma triglycerides (121 ± 38 vs. 120 ± 21 mg/dl, P = NS, t = 0.1, df = 14).

DISCUSSION

The major finding of this study is that MatSep, well known to induce stress during postnatal life, exacerbates diet-induced obesity in female rats. Most importantly, this phenomenon can be abrogated by a postnatal treatment with MTP, a corticosterone synthase inhibitor. Specifically, female MatSep rats fed a HFD upon weaning displayed exacerbated (1) body weight gain (2), adipocyte hypertrophy (3), plasma corticosterone and leptin levels (4), glucose intolerance, and gluconeogenic gene expression (5). On the contrary, male rats exposed to MatSep did not show an increased susceptibility to develop diet-induced obesity compared with control counterparts. Our data suggest that targeting the stress-induced neuroendocrine response may serve as a mechanism to attenuate the effects of MatSep in the developmental programming of metabolic disease, specifically in female rats.

Traditional risk factors such as smoking, high cholesterol, hypertension, and diabetes have been shown to contribute to women’s cardiometabolic risk more than men; however, these traditional risk factors account for only ~40% of the variance of cardiovascular disease (2). This percentage strongly suggests that there are other veiled factors that may provide a critical contribution. Numerous studies have recognized psychosocial stress as an independent risk factor for chronic adult disease, including depression, anxiety, obesity, and high blood pressure (13, 14, 43, 46, 52, 64), all important factors associated with the development of cardiovascular disease. A recent study using 6,714 members of the 1958 British Birth Cohort Study revealed that cardiometabolic risk was higher among people with psychological distress in childhood only and persistent across the life course (64). The strengths of this study to avoid the risk of bias include the large unselected sample, a followup spanning 45 yr, prospective measures of psychological distress, and multiple data collection sources/methods. However, a number of limitations are present: 1) the measures of psychological distress were not comprehensive, 2) it is difficult to ensure no exposure to stress in the control group, 3) and the observational nature of the data raises the possibility of unmeasured confounding variables. An important next step will be to evaluate whether interventions to reduce psychological distress in childhood indeed improve subsequent risk for development of obesity and cardiovascular disease.

The influence of ELS on long-term health conditions has several origins. The multifactorial interaction among the HPA axis, the central nervous system, and nutritional status all impact the overall glucocorticoid levels. The role of glucocorticoids as stress-induced hormones is well established, in addition to their role in the regulation of energy balance (11) and the development of obesity with central distribution of fat (12). The actions of glucocorticoids mediating diet-induced obesity have been attributed in part to its capacity to activate lipogenesis and induce fat deposition (19, 27, 41). Experimental studies have shown that local (45) and systemic (16, 18) glucocorticoid inhibition attenuate obesity and derangements of the metabolic function. Based on the studies showing that MatSep deeply affects the neuroendocrine responses in rodents (21, 28, 33), we inhibited the systemic corticosterone synthesis in female rat offspring. As a result, we observed a systemic improvement in diet-induced obesity outcomes in MatSep and control rats, but importantly, we were able to attenuate the MatSep-enhanced obesity and metabolic dysfunction. Therefore, our studies suggest that ELS can sensitize the glucocorticoid metabolism in response to HFD. In addition, our data reveal specific changes at the WAT and liver level, two metabolically active tissues potentially responsible, along with the skeletal muscle, for the impaired metabolic function.

Diet composition is also a main factor to take into consideration. In an elegant study by Bernadi et al., it has been shown that MatSep male rats consuming an ω-3-deficient diet have elevated food intake and body weight gain, plasma insulin, leptin, impaired glucose tolerance, and elevated hepatic levels of PEPCK (4). Thus, these data indicate that a nutritional approach involving diet supplementation could have a therapeutic effect on the metabolic derangements induced by exposure to MatSep.

We also acknowledge some discrepancies in the literature. Paternain et al. (48) have shown that female MatSep rats fed a high-fat and sucrose diet for 10 wk exhibit significant improvements in visceral fat, insulin, and leptin levels as well as impairments in HOMA-IR compared with control rats. A potential explanation may relate to the experimental design utilized, which involved exposure to MatSep between postnatal day 2 and weaning day, showing a longer time frame of separation protocol compared with the classical protocol widely used in the literature. Also, the hypercaloric diet was initiated 4 wk following weaning, suggesting that early changes in dietary composition may play a critical role exacerbating metabolic derangements in our model. Taken together, this particular extended separation protocol may confer metabolic resilience instead of endurance, as reported previously by others (23, 59).

There is a growing body of literature addressing sex-specific comorbidities. Recent outcomes from the national longitudinal survey Americans’ Changing Lives showed for the first time that women who experienced adverse childhood experiences gained weight more rapidly throughout the 15-yr followup period compared with men (30). Since sex hormones affect the HPA axis function, it is notable that women are two to three times more likely to experience depression during the perimenopausal period, with the onset of schizophrenia and other psychotic disorders presenting after the age of 40 (44). Coincidently, this period of life is characterized by increases in BMI. In that sense, glucocorticoid metabolism has been consistently reported as one of the major factors contributing to the sex differences in glucose tolerance and adiposity in humans (39, 63).

Finally, despite the changes in fat mass, MAP and HR were not different in MatSep and control rats. Previously, it has been shown that female MatSep rats have MAP and HR that are comparable with control rats fed a regular chow as well (37). Thus, these data suggest that chronic blood pressure control is still achieved during diet-induced obesity, indicating that the metabolic derangements may precede cardiovascular dysfunction in female rats. Our studies in male rats show that MatSep does not influence diet-induced obesity or glucose intolerance, even though HFD feeding was extended for a 5-wk period. In these conditions, we have shown that blood pressure is not different between male MatSep and control rats either (31). A role for sex hormones in this model remains to be elucidated. Reduced physiological levels of estrogens during menopause are well known to increase BMI and metabolic risk in clinical (9, 57) and experimental models (11, 20, 22, 60). Therefore, the study of the mechanisms by which MatSep may impact the reproductive function could contribute to decipher the long-lasting effects of ELS on the metabolic function.

The limitations of the current study include the specificity of the treatment, the induced protein breakdown, and the role of potential precursors in the steroidogenic pathway secondary to the corticosterone synthase enzyme inhibition. Something to consider is that both control and MatSep rats subjected to postnatal treatment with MTP showed lower plasma corticosterone levels and reduced adrenal gland weight as adults. These data indicate that MTP-treated rats display a permanent adjustment on the HPA axis regulation. Therefore, a comprehensive assessment of these factors would provide the mechanistic insights by which MatSep worsens diet-induced obesity in female rats.

Overall, this study further supports the concept that ELS induces permanent changes in adult health status, reinforcing the experimental evidence that links glucocorticoids with exaggerated fat expansion and metabolic dysfunction exposed to stress during developmental stages of life in a sex-specific manner.

PERSPECTIVES

Postnatal exposure to psychosocial stress is believed to exacerbate the levels of stress hormones, inducing metabolic derangements. Growing evidence of a positive correlation among ELS and risk for obesity and diabetes, as well as depression and anxiety, may contribute to reduced quality of life and life expectancy. A greater understanding of how ELS affects metabolism might assist in the development of behavioral enrichment strategies that overcome the negative effects of ELS on the endocrine system in a sex-specific manner.

GRANTS

This study was supported by grants from the National Heart, Lung, and Blood Institute (to A. S. Loria; R00-HL-111354) and the University of Kentucky Center of Research in Obesity and Cardiovascular Disease (COBRE P20 GM103527-06; Pathology Core).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

M.O.M., C.T.W., S.G.U., D.M.C., and A.S.L. performed experiments; M.O.M., J.B.H., C.T.W., D.M.C., and A.S.L. analyzed data; M.O.M., J.B.H., and A.S.L. edited and revised manuscript; A.S.L. interpreted results of experiments; A.S.L. prepared figures; A.S.L. drafted manuscript; A.S.L. approved final version of manuscript.