Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2018 Mar 2.
Published in final edited form as: Cell Stem Cell. 2017 Feb 16;20(3):315–328.e7. doi: 10.1016/j.stem.2017.01.009

Stage-specific human induced pluripotent stem cells map the progression of myeloid transformation to transplantable leukemia

Andriana G Kotini 1,2,3,4, Chan-Jung Chang 1,2,3,4, Arthur Chow 5,6,7,8, Han Yuan 9,10, Tzu-Chieh Ho 5,6,7,8, Tiansu Wang 1,2,3,4, Shailee Vora 1,2,3,4, Alexander Solovyov 1,2,4,11, Chrystel Husser 1,2,3,4, Malgorzata Olszewska 1,2,3,4, Julie Teruya-Feldstein 11, Deepak Perumal 1,2,4, Virginia M Klimek 12, Alexandros Spyridonidis 13, Raajit K Rampal 12, Lewis Silverman 2,4, E Premkumar Reddy 2,4, Elli Papaemmanuil 14, Samir Parekh 1,2,4, Benjamin D Greenbaum 1,2,4,11, Christina S Leslie 9, Michael G Kharas 5,6,7,8,*, Eirini P Papapetrou 1,2,3,4,15,*
PMCID: PMC5337161  NIHMSID: NIHMS848611  PMID: 28215825

SUMMARY

Myeloid malignancy is increasingly viewed as a disease spectrum, comprising hematopoietic disorders that extend across a phenotypic continuum ranging from clonal hematopoiesis to myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). In this study, we derived a collection of iPSC lines capturing a range of disease stages encompassing preleukemia, low-risk MDS, high-risk MDS and secondary AML. Upon differentiation, we found hematopoietic phenotypes of graded severity and/or stage specificity that together delineate a phenotypic roadmap of disease progression culminating in serially transplantable leukemia. We also show that disease stage transitions, both reversal and progression, can be modeled in this system using genetic correction or introduction of mutations via CRISPR/Cas9, and that this iPSC-based approach can be used to uncover disease stage-specific responses to drugs. Our study therefore provides insight into the cellular events demarcating the initiation and progression of myeloid transformation and a new platform for testing genetic and pharmacological interventions.

Graphical Abstract

graphic file with name nihms848611u1.jpg

INTRODUCTION

Human hematopoiesis is sustained by hematopoietic stem and progenitor cells (HSPCs) residing in the bone marrow (BM) through processes involving self-renewal, proliferation and differentiation to distinct cell lineages ultimately giving rise to mature functional hematopoietic cells. Deregulation of these processes is believed to be central to the pathogenesis of hematopoietic disorders, which are typically grouped according to the two main blood lineages into myeloid and lymphoid, with the former generally classified as myeloproliferative disorders (MPD), myelodysplastic syndromes (MDS), syndromes with overlap of the two former categories (MDS/MPD) and the most dramatic acute myeloid leukemia (AML). AML can develop de novo or from preexisting MPD or MDS. While the development of de novo AML from preleukemic hematopoietic stem cells (HSCs) and its progression from MPDs (mainly chronic myeloid leukemia, CML) are better studied, the development of AML from MDS has not been well mapped due to the more limited biological models of MDS and the scarcity and poor growth of primary MDS cells, as opposed to cells from MPD and AML patients (Sperling et al., 2017).

Leukemogenesis has long been conceptualized as a multistep process. All current evidence points to a model whereby MDS and AML arise from HSPCs through the accumulation of multiple genetic (and potentially also epigenetic) changes (Elias et al., 2014). In recent years deep characterization of the mutational landscape of myeloid disorders through large-scale DNA sequencing solidified a model of clonal evolution through the stepwise accumulation of mutations. Clonal tracking at high resolution enabled by the identification of tens of recurrent gene mutations in MDS and AML has provided important insights into the nature and clonality status of myeloid disorders. First, it is now clear that clonal hematopoiesis is invariably established at the outset of MDS and thus MDS is a preleukemic condition not fundamentally very different from AML (Papaemmanuil et al., 2013; Walter et al., 2012; Walter et al., 2013). Second, clonal hematopoiesis (termed clonal hematopoiesis of indeterminate potential or CHIP) was found in healthy individuals with an age-dependent frequency and associated with an increased risk of developing MDS, MPD or AML (Genovese et al., 2014; Jaiswal et al., 2014; Steensma et al., 2015; Xie et al., 2014). This finding, in parallel with recent functional in vitro and in vivo studies, lend support to the existence of pre-leukemic HSCs, HSCs that are functionally normal and have multilineage potential, but harbor MDS and AML-related mutations that may give them a clonal advantage (Jan et al., 2012; Shlush et al., 2014). These recent findings invite revisiting the boundaries between normal, premalignant and malignant hematopoiesis and support an emerging view of myeloid malignancy as a disease spectrum, comprising hematopoietic disorders that extend across a phenotypic continuum, ranging from normal hematopoiesis, clonal hematopoiesis or preleukemia, MDS and MDS/AML (Pandolfi et al., 2013; Steensma et al., 2015). However the cellular events demarcating progression to overt leukemia through a premalignant myelodysplastic phase are not well defined.

Here we generated patient-derived iPSCs representative of a range of disease stages across the spectrum of myeloid malignancy, including familial predisposition, low-risk MDS, high-risk MDS and MDS/AML. We characterized the hematopoiesis derived from this panel of iPSC lines and identified phenotypes of graded severity and/or stage specificity which together delineate a phenotypic roadmap of disease progression, leading to the most dramatic phenotype of a serially transplantable leukemia. As proof of principle that transitions between stages (progression or reversal) can be modeled in our system, we show that a high-risk MDS-iPSC line can be phenotypically reverted to a premalignant state by correction of a chr7q deletion, whereas a preleukemic iPSC line can progress to either low-risk or high-risk MDS following CRISPR/Cas9-mediated inactivation of the second GATA2 allele or deletion of chr7q, respectively. We also model the stepwise progression of normal cells to preleukemia and subsequent MDS through the sequential introduction of genetic lesions associated with earlier (ASXL1 truncation) and later (chr7q deletion) disease stages. We then use this model to uncover disease stage-specific therapeutic effects of 5-AzaC – a drug used as first-line therapy in MDS and whose mechanism of action remains elusive – and of rigosertib, a small molecule inhibitor of RAS signaling. Our study provides insights into the pathophysiologic changes underlying the initiation and progression of myeloid transformation and a new platform to test genetic and pharmacologic interventions to reverse this process.

RESULTS

Integrating cell reprogramming with mutational analyses enables the generation of disease stage-specific iPSCs

We derived iPSC lines from four patients (patients #1–4) with low-risk MDS (refractory anemia, RA by FAB), high-risk MDS (refractory anemia with excess blasts, RAEB by FAB) and secondary AML (sAML or MDS/AML, i.e. AML from preexisting MDS) (Figure 1 and Table S1). For reprogramming we used bone marrow (BM) or peripheral blood (PB) mononuclear cells (BMMCs or PBMCs) (Table S1) and reasoned that it might be possible, taking advantage of the genetic and clonal heterogeneity of these cell populations, to derive iPSC lines from normal cells, cells of the major clone, as well as cells from minor subclones. We therefore performed a thorough genetic characterization (karyotype, FISH, aCGH and gene mutation analysis) to identify all known recurrent gene mutations and chromosomal abnormalities associated with myeloid neoplasms in the starting cells and the derivative iPSCs and used it to determine the provenance of each iPSC line (Figure 1). Thus we were able to establish a variety of iPSC lines, which included: (a) iPSC lines derived from the dominant clone, i.e. harboring only genetic lesions present in the majority of the starting cells; (b) iPSC lines derived from sub-clones, i.e. harboring at least one genetic lesion present in a subset of the starting cells: AML-4.10, harboring a sub-clonal KRAS G12D mutation, whereas a second line harboring a sub-clonal NRAS Q61R mutation could only be partially reprogrammed (Table S1); (c) iPSC lines derived from normal hematopoietic cells, i.e. harboring none of the somatic genetic lesions found in the starting cells and (d) one iPSC line, N-3.10, derived from patient #3, harboring a germline GATA2 T357N mutation predisposing to MDS/AML (Collin et al., 2015; Hahn et al., 2011) (Table S1). The MDS clone in this patient had acquired an additional somatic mutation in the other GATA2 allele (GATA2 390delK) (Figure S1A), together with additional mutations and a t(1;7)(q10;p10) translocation, resulting in del(7q), a deletion commonly associated with germline GATA2 mutations (Figure 1) (Wlodarski et al., 2016). All iPSC lines met all criteria of pluripotency for human cells (Figure S2). Reprogramming MDS and AML hematopoietic cells from BM or PB thus allows the derivation of iPSC lines capturing different disease stages, residual normal cells, as well as cells with predisposing mutations.

Figure 1. Generation of a panel of disease stage-specific iPSCs.

Figure 1

(A) iPSCs derived from 4 patients, one with low-risk MDS, two with high-risk MDS and one with MDS/AML. The upper panels show all recurrent gene mutations and chromosomal abnormalities detected in the starting cells used for reprogramming and their frequency. The lower panels show the individual iPSC lines that were derived and their corresponding genetic profile. Blue font indicates gene mutations of uncertain significance. Brown font indicates mutations detected in the derivative iPSCs, but not in the starting cells. Patient #4 cells and the derivative iPSCs harbor a complex translocation between chromosomes 1, 7 and 14, resulting in a deletion of 7q (confirmed by aCGH, Figure S2B) and additional material of unknown origin on chromosome 15 [46,XX,der(1)t(1;7;14)(q32;p11p22;p11.1),der(7)del(7)(p11p22)inv(7)(p11q31),der(14)t(1 ;14)(q32;p11.1),add(15)(p11.1)]. VAF: variant allele frequency.

(B) iPSC lines from A (note color code) capture distinct disease stages ranging from normal, preleukemic (i.e. cells with predisposing mutations), low-risk MDS, high-risk MDS and MDS/AML.

See also Figures S1 and S2 and Tables S1 and S2.

These reprogramming experiments together with the genetic characterization of the original cells and derivative iPSCs allowed us to make several additional observations. First, detailed genetic analysis can pinpoint iPSC lines that originate from the same starting cell and are thus not truly different lines. iPSC lines MDS-3.4 and MDS-3.5 were found to both harbor the same MYB L51fs mutation, which was not detectable in the starting population, in addition to the somatic genetic lesions found in the starting MDS cells [t(1;7)(q10;p10), GATA2 T357N, GATA2 390delK, U2AF1 Q157R, ETV6 S321fs] (Figure 1). This strongly suggested that these lines originated from the same cell, which we confirmed by integration site analysis of the lentiviral vector used for reprogramming (Kotini et al., 2015). Second, since our experiments entailed the parallel reprogramming of a mixed population of cells together with the ability to exclude lines that were not clonally independent (Figure S2D), we had a unique opportunity to directly compare the reprogramming efficiency of cells harboring malignancy-associated genetic lesions to that of normal cells of the same genetic background and determine how specific genetic lesions associated with myeloid malignancy may affect reprogramming efficiency. While we were able to readily reprogram del(7q)-MDS cells, as we have previously reported (Kotini et al., 2015), we were not able to reprogram cells from patients with del(5q)-MDS or monosomy 7 (patients #5–8, Table S1). After at least two attempts for each patient and using different aliquots of starting cells, we were only able to derive either no iPSC lines (patient #5) or only normal iPSC lines, even though normal cells comprised only a minority of the starting population. Since in other reprogramming experiments MDS or AML cells did not have a general reprogramming disadvantage over normal cells (patients #1, 3, 4, Table S1), this bias is most likely determined by the specific genetic composition of the malignant clone in each patient. In agreement with this, reprogramming of patient #2 cells, in more than one independent reprogramming experiments, gave consistently more normal than MDS iPSCs (only 2 out of 17 iPSC lines were derived from the MDS cells with the remaining 15 derived from normal cells), whereas the del(7q) was present in over 70% of the starting cells (Table S1). To further investigate this and to determine whether the in vitro culture that is necessary to initiate reprogramming or the reprogramming process per se accounts for this skewing, we compared the clonal composition of cells from patient #2 before (day 0) and after in vitro culture (day 3) (Figure S1B, C). This showed that in vitro culture did not select for normal cells, but rather resulted in preferential growth of the MDS clone over the normal cells, since the variant allele frequency (VAF) of both SRSF2 P95L and PHF6 C280Y clonal somatic mutations increased over time in culture. Similarly, cells from patients #7 and #8 analyzed for the del(5q) abnormality after culture and immediately before the initiation of reprogramming were found to consist mostly of clonal MDS cells, as the copy number of chr5q was almost 1 in both samples and 8 out of 10 metaphases of patient #7 cells harbored the del5q by karyotyping (Figure S1D, E). Finally, we compared the outcome of two different reprogramming protocols, using in vitro expansion and reprogramming of either hematopoietic progenitors or erythroblasts, performed in parallel with the same aliquot of starting cells divided in two (Table S2). Erythroblast reprogramming, similarly to hematopoietic progenitor reprogramming, preferentially gave rise to normal iPSCs. These results show that the relative reprogramming disadvantage of MDS cells from some patients is not due to in vitro culture and suggest that some MDS-associated genetic lesions, but not others, exert a negative effect on or even completely abolish reprogramming potential.

Disease stage-specific iPSCs capture cellular phenotypes of graded severity or disease specificity

We selected a panel of iPSC lines representative of the different disease stages for phenotypic characterization following hematopoietic differentiation using a protocol that enables the derivation and study of hematopoiesis with definitive features (Figure 2A and Figure S3A, B). All lines gave rise to comparable percentages of CD34+ cells early in differentiation (day 8), providing evidence against early developmental defects in mesoderm formation or hematopoietic lineage specification that could compound the identification of disease-relevant phenotypes (Figures 2B and S3C). In contrast, striking differences were observed in the timing and emergence of CD45+ hematopoietic progenitor cells (HPCs) starting at the low risk MDS stage (Figures 2C and S3D–F). Preleukemic cells, like normal cells, generated CD45+ HPCs that comprised approximately 90% of the cells by day 14 of differentiation, with approximately half having lost CD34 expression, as a sign of further maturation beyond the progenitor stage (Figures 2C and S3E, F). Low-risk MDS CD45+ HPCs appeared later and matured later than normal HPCs, as evidenced by loss of CD34 (Figures 2C and S3E, F). High-risk MDS iPSCs produced CD45+ HPCs with a delay, as well as markedly reduced overall efficiency (in contrast to low-risk MDS) (Figures 2C and S3D–F). On the other hand, MDS/AML-iPSCs gave rise to CD45+ HPCs with efficiencies comparable to those of normal cells, but failed to differentiate further and retained CD34 expression until day 18 and beyond (Figures 2C and S3D–F). Reciprocally, CD90 expression, normally lost by day 10–12 of differentiation was retained by low-risk MDS, high-risk MDS and MDS/AML cells in a stage-specific manner (Figures 2D, S3G and S4A, B).

Figure 2. Disease stage-specific iPSCs capture phenotypes of graded severity.

Figure 2

(A) Scheme of hematopoietic differentiation protocol.

(B) Fraction of CD34+ cells generated by all the different lines tested on day 8 of differentiation (extended data are shown in Figure S3C). Note color coding (key shown on the upper right panel of this figure). Mean and SEM of different lines are shown. For lines differentiated more than once (Figure S3C), the average value is shown.

(C) Fraction of more mature CD45+ cells who have lost CD34 expression by day 14 of differentiation generated by the different iPSC lines (extended data are shown in Figure S3F). Mean and SEM of different lines are shown. For lines differentiated more than once, the average value is shown.

(D) Fraction of CD34+ cells maintaining CD90 expression at the indicated days of differentiation (extended data are shown in Figure S4B, upper panel). For lines differentiated more than once, the average value is shown.

(E) Fraction of CD41a+/CD45 cells, corresponding to megakaryocyte progenitors, at the indicated days of differentiation (extended data are shown in Figure S4B, lower panel). For lines differentiated more than once, the average value is shown.

(F) Colony assays for megakaryocyte progenitors (CFU-Mk) in unsorted, CD41a+ and CD41a sorted cells from N-2.12 iPSCs at day 8 of differentiation. The average of two independent experiments is shown.

(G) Representative images of a medium (upper panel) and a large (lower panel) CFU-Mk colony. Scale bars, 50 μm.

See also Figures S3 and S4 and Table S3.

We found that megakaryocyte progenitors with the CD41a+/CD45 surface phenotype that give rise to CFU-Mk colonies emerge in these cultures on or before day 8 in normal cells (Figures 2E–G and S4B, C). Strikingly, this population was severely decreased already in preleukemic cells and effectively abolished in MDS (Figures 2E and S4B, C). While normal iPSCs gave rise to all types of hematopoietic colonies in methylcellulose cultures (Figure S5A, B), iPSCs from all disease stages exhibited reduced clonogenicity, with erythroid and multilineage colonies (BFU-E and CFU-GEMM) primarily affected already in preleukemic and, more so, in low-risk MDS cells, while high-risk MDS generated very few or no colonies (Figure 3A, B). MDS/AML cells gave rise exclusively to myeloid colonies comprised mostly of immature cells (Figure 3A, B). Morphologic assessment of HPCs on day 14 of differentiation and of more mature cells from methylcellulose cultures revealed dysplastic changes, which were milder and restricted to the erythroid lineage in preleukemic and low-risk MDS and more widespread and affecting all lineages in high-risk MDS cells (Figures 3B and S5C).

Figure 3. iPSCs from different disease stages capture stage-specific disease phenotypes.

Figure 3

(A) Methylcellulose assays on day 14 of hematopoietic differentiation. The number of colonies from 5,000 seeded cells is shown. (CFU-GEMM: colony-forming unit-granulocyte, erythrocyte, monocyte, megakaryocyte; CFU-GM: CFU-granulocyte, monocyte; CFU-G: colony-forming unit-granulocyte; CFU-M: CFU-monocyte; BFU-E: burst-forming unit-erythrocyte). Average from 3–6 independent experiments is shown for each line.

(B) Analysis of lineage markers (upper panels) and morphologic assessment of cells generated in methylcellulose cultures. One iPSC line representative of each disease stage is shown (from left to right: N-2.12, N-3.10, MDS-1.12, AML-4.16). High-risk MDS iPSCs do not give rise to colonies in methylcellulose and are therefore not represented in this panel. Dysplastic changes are observed in preleukemic (arrows: nuclear blebbing, arrowheads: pseudo Pelger-Huet cells) and low-risk MDS cells (arrows: hyper-segmented neutrophils, arrowheads: pseudo Pelger-Huet cells). Atypical monomorphic myeloid cells (arrows) are the predominant cells observed in methylcellulose cultures from MDS/AML cells. Scale bars, 10 μm.

(C) Growth competition assay. The cells were mixed 1:1 with the N-2.12 line stably expressing GFP at the beginning of hematopoietic differentiation and followed for 12 days by flow cytometry (schematic shown in Figure S5F). The relative population size was calculated as the percentage of GFP cells at each time point relative to the population size at day 2. For lines differentiated more than once, the average value is shown.

(D) Cell viability measured by DAPI staining on day 14 of hematopoietic differentiation (extended data are shown in Figure S5E). Mean and SEM of different lines are shown. For lines differentiated more than once (Figure S5E), the average value is shown.

See also Figure S5 and Table S3.

Finally, we measured the growth rate and viability of HPCs derived from the different disease stage iPSCs. Low-risk MDS showed a mild decrease in growth rate and viability, which was much more pronounced in high-risk MDS, whereas growth and viability of MDS/AML cells was completely restored to normal levels (Figures 3C, D and S5D–F).

MDS/AML-derived hematopoietic cells give rise to serially transplantable leukemia

To assess in vivo engraftment potential, we then transplanted day 8–16 HPCs derived from iPSCs of the various disease stages into NOD/SCID/IL-2Rγ−/− (NSG) mice (Figure 4A). As expected from many previous studies, HPCs derived from normal iPSCs showed no detectable engraftment (Vo and Daley, 2015) (Figure 4B, C). Similarly, HPCs from MDS iPSCs – both low-risk and high-risk – did not exhibit engraftment potential (Figure 4B, C). In contrast, MDS/AML-HPCs showed high levels (up to 80%) of human engraftment in multiple animals (Figure 4B, C). The transplantable cells showed features of myeloid leukemia, including a predominantly myeloid immunophenotype and infiltration of the bone marrow and spleen by immature human CD45+ cells with blast-like morphology, also found in the peripheral blood, which could be transplanted into secondary recipients (Figure 4D–H). The latter readily succumbed to an AML-like disease within 3 weeks from transplantation.

Figure 4. Hematopoietic cells derived from MDS/AML-iPSCs give rise to serially transplantable leukemia.

Figure 4

(A) Scheme of transplantation experiments. Various iPSC lines were differentiated along the hematopoietic lineage for 8–16 days, as shown in Figure 2A and intravenously injected into sub-lethally irradiated or busulfan-treated NSG mice.

(B) Representative flow cytometry panels assessing human cell engraftment in the bone marrow of recipient mice 8–11 weeks post-transplantation.

(C) Engraftment levels in the bone marrow of mice 8–11 weeks after transplantation with HPCs derived from different iPSC lines (Normal: N-2.12; Low-risk MDS: MDS-1.12; High-risk MDS: MDS-2.13) or with human cord blood CD34+ cells (CB). Each data point represents a unique mouse from 5 independent transplantation experiments.

(D) Fraction of myeloid (CD33+) and lymphoid (CD19+) lineage cells within the hCD45+ population in the BM of mice transplanted with human cord blood CD34+ cells (CB) or MDS/AML-iPSC-derived hematopoietic cells (from lines AML-4.24 and AML-4.10) 8–11 weeks after transplantation. CB engraftment typically gives rise to predominantly CD19+ B lymphoid cells. In contrast, MDS/AML-iPSC-derived hematopoietic cells generate predominantly myeloid cells.

(E) Spleen weight in recipient mice 8–11 weeks post-transplantation with human cord blood CD34+ cells (CB) or MDS/AML-iPSC-derived hematopoietic cells, as indicated.

(F) Engraftment levels in the bone marrow, spleen and peripheral blood of primary and secondary recipient mice transplanted with hematopoietic cells derived from lines AML-4.24 and AML-4.10 (primary) or AML-4.10 (secondary).

(G) May-Giemsa stained cytospin of bone marrow cells of a secondary recipient mouse transplanted with AML-4.10-derived hematopoietic cells. Scale bar, 100 μm.

(H) Human CD45 detection by immunohistochemistry in the bone marrow of a secondary recipient mouse transplanted with AML-4.10-derived hematopoietic cells. Scale bar, 50 μm.

(I) Schematic summary of phenotypic analyses shown in Figures 2–4.

See also Table S3.

In summary, our phenotypic analyses show that iPSCs derived from distinct disease stages across the myeloid malignancy spectrum capture hematopoietic phenotypes of graded severity and/or stage specificity that together delineate a phenotypic roadmap to myeloid transformation, ultimately leading to a fulminant serially transplantable myeloid leukemia (Figure 4I and Table S3).

Transcriptomes of disease stage-specific iPSC-derived HPCs recapitulate features of disease progression

We performed RNA sequencing (RNA-seq) of sorted CD34+ cells from 3 normal lines (2 iPSC and the H1 hESC line), 2 low-risk MDS, 3 high-risk MDS and 3 MDS/AML iPSC lines (Figures 5 and S6A). By examining the gene expression profile among the different disease stages, we found a clear clustering of samples according to disease status by principal component analysis, with the first principal component separating normal from MDS and the second separating the AML from the MDS samples (Figure 5A). Differential expression analyses identified 472 up-regulated and 329 down-regulated, 868 up-regulated and 284 down-regulated, and 760 up-regulated and 439 down-regulated genes, among AML versus normal, high-risk MDS versus normal, and low-risk MDS versus normal, respectively (log2FC > 3 or log2FC < −3 and adjusted P-value < 0.05, Figure S6B). Hierarchical clustering of all lines based on these differentially expressed genes recapitulated progression from normal to MDS/AML (Figure 5B). Based on analysis of Gene Ontology (GO) categories, genes involved in positive regulation of apoptosis and negative regulation of cell proliferation became upregulated at the transition from normal to low-risk MDS and subsequently downregulated upon transformation to MDS/AML, in agreement with our phenotypic analyses (Figure 5C). Similarly, negative regulation of differentiation was a category upregulated early on. By Gene Set Enrichment Analysis (GSEA) we identified significantly enriched disease-specific and shared functional pathways in the iPSC-derived HPCs representing the three different disease stages (Figure S6C and Table S4). Notably, both the high-risk MDS- and MDS/AML- iPSC-derived HPCs were significantly enriched for the high-risk MDS deletion 7q gene set, consistent with both their respective disease state and their specific genetic makeup (Figure 5D). Additionally, the MDS/AML-iPSC-HPCs showed specific enrichment for a gene set found in a subset of human AML patients that had a worse clinical prognosis and contained chromosome 7 abnormalities (Valk et al., 2004) (Figure 5E). Overall these data suggest that gene expression programs found in HPCs derived from our iPSC panel recapitulate disease progression and capture gene expression signatures derived from primary samples from patients with myeloid malignancies.

Figure 5. Gene expression analysis.

Figure 5

(A) Principal component analysis on regularized log transformed normalized read counts cluster samples by disease status.

(B) Hierarchical clustering of CD34+ HPCs derived from the different iPSC lines based on a total of 2,018 genes differentially expressed between MDS/AML versus normal, high-risk MDS versus normal and low-risk MDS versus normal using scaled log normalized counts.

(C) Gene Ontology (GO) enrichment for genes differentially expressed between low-risk MDS vs normal, high-risk MDS vs low-risk MDS and high-risk MDS vs MDS/AML.

(D) Gene set enrichment analysis (GSEA) of high-risk MDS-iPSC-CD34+ cells compared to normal iPSC-CD34+ cells shows negative enrichment for down-regulated genes in human high-risk MDS patients harboring a del7q.

(E) GSEA of MDS/AML-iPSC-CD34+ cells compared to normal iPSC-CD34+ cells shows negative enrichment for the human AML Valk cluster 10 patient gene set (group with worse prognosis and chr7q abnormalities) (Valk et al., 2004).

See also Figure S6 and Table S4.

Modeling disease stage transitions

We next asked if this model and the phenotypes characterized therein could guide modeling transitions between disease stages, as readouts for disease progression or reversal. We first analyzed an iPSC line derived from the high-risk MDS line MDS-2.13 after spontaneous correction of the del(7q) (Kotini et al., 2015) (Figure 6A). Following correction of the del(7q), this line only harbors a SRSF2 P95L mutation (and a PHF6 mutation of uncertain significance). Since the SRSF2 P95L mutation is an early event in MDS and alone not sufficient for the development of MDS, the corrected line (MDS-2.A3C) would be predicted to capture a preleukemic stage (Papaemmanuil et al., 2013). Consistent with this, detailed phenotypic characterization based on the phenotypic assays defined in the iPSC panel above, confirmed a phenotype corresponding to a preleukemic stage: correction of the emergence of CD45+ cells, loss of CD90 expression, re-emergence of a CD41a+/CD45 megakaryocyte progenitor population, partial rescue of clonogenicity and restored growth and viability (Figure 6B–F).

Figure 6. Modeling disease stage transitions.

Figure 6

(A) Schematic of reversal of a high-risk MDS line to a stage phenotypically consistent with a preleukemic stage through spontaneous correction of a chr7q deletion.

(B) Fraction of CD45+/CD34 cells at day 14 of differentiation. Mean and SEM from independent differentiation experiments are shown.

(C) Upper panel: Fraction of CD34+/CD90+ cells at the indicated days of differentiation. Average from independent differentiation experiments are shown for each line. Lower panel: Fraction of CD41a+/CD45 cells at the indicated days of differentiation. Average from independent differentiation experiments are shown for each line.

(D) EB surface area at day 8 of hematopoietic differentiation. Mean and SEM from independent differentiation experiments are shown for each line. 10 EBs were measured in each experiment and averaged for each data point.

(E) Cell viability measured by DAPI staining on day 14 of hematopoietic differentiation. Mean and SEM from independent differentiation experiments are shown for each line.

(F) Methylcellulose assays on day 14 of hematopoietic differentiation. The number of colonies from 5,000 seeded cells is shown.

(G) Schematic of progression of a preleukemic line (N-3.10), harboring a heterozygous germline GATA2 mutation, to a stage corresponding phenotypically to low-risk MDS through CRISPR/Cas9-mediated monoallelic or biallelic GATA2 inactivation and to a high-risk MDS stage through loss of a copy of chr7q.

(H) Fraction of CD45+/CD34 cells on day 14 of differentiation. Mean and SEM of three different GATA2-edited and three del7q-engineered clones with average values from two independent differentiations per line are shown.

(I) Left panel: Fraction of CD34+/CD90+ cells at the indicated days of differentiation. Average from three different GATA2-edited and three del7q-engineered clones with values averaged from two independent differentiation experiments per line are shown. Right panel: Fraction of CD41a+/CD45 cells at the indicated days of differentiation. Average from three different GATA2-edited and three del7q-engineered clones with values averaged from two independent differentiation experiments per line are shown.

(J) Schematic of successive progression of a normal line (N-2.12) to a preleukemic stage through CRISPR/Cas9-mediated ASXL1 mutation and subsequently to a high-risk MDS stage through engineering of del(7q).

(K) Fraction of CD45+/CD34 cells on day 14 of differentiation. Mean and SEM of two different ASXL1-edited clones, one ASXL1-edited and del7q-engineered clone and the parental line with average values from three independent differentiations per line shown.

(L) Fraction of CD34+/CD90+ cells at the indicated days of differentiation. Average from two different ASXL1-edited clones and one ASXL1-edited and del7q-engineered clone with values averaged from three independent differentiation experiments per line shown.

(M) Cell viability measured by DAPI staining on day 14 of hematopoietic differentiation. Mean and SEM of two different ASXL1-edited clones and one ASXL1-edited and del7q-engineered clone with average values of three independent differentiations per line are shown.

(N) Methylcellulose assays on day 14 of hematopoietic differentiation. Values averaged from 2–3 independent differentiation experiments per line are shown.

See also Figure S7.

Conversely, to model disease progression, we first started with the preleukemic N-3.10 line, harboring a germline GATA2 mutation. GATA2 mutations found in patients with familial predisposition syndromes are believed to be loss-of-function (Collin et al., 2015). Since the MDS clone of the same patient from whom this line was derived (patient #3, Figure 1), had acquired a second GATA2 mutation in the other allele (Figure S1A) together with additional recurrent genetic abnormalities, we sought to model the effects of inactivating the other GATA2 allele in the disease phenotype. We designed two distinct CRISPR/Cas9-based strategies and isolated two clones derived from the N-3.10 line, in which both GATA2 alleles harbored inactivating frameshift indels, as well as a third clone that retained the mutant T357N allele and harbored a deletion of the zing-finger 2 domain (where many of the mutations found in patients cluster), predicted to abolish DNA binding (Figures 6G and S7A, B) (Collin et al., 2015; Hahn et al., 2011). Since the MDS clone in this patient also had loss of chr7q in the context of a t(1;7) translocation (Figure 1), we also modeled in parallel the contribution of the del(7q) lesion to the disease progression by engineering hemizygous chr7q deletion into the preleukemic N-3.10 line (Figures 6G and S7C). Phenotypic characterization of the three independent GATA2-engineered clones and of three independent del(7q) clones compared to the patient-derived parental preleukemic N-3.10 and MDS lines, revealed a modest reduction in the CD45+ cell population concomitant with a retention of the CD90 marker in the GATA2-engineered clones, while the del(7q) clones showed a dramatic decrease in CD45+ cells and a much more prolonged expression of CD90 (Figure 6H, I). All clones showed a marked decrease of the CD41a+/CD45 population (Figure 6I). These phenotypes reflect progression to low-risk MDS driven by GATA2 inactivation and to high-risk MDS driven by the del(7q), consistent with the del(7q) being a marker of adverse prognosis in the clinic.

We then set to model disease progression along sequential stages driven by the stepwise acquisition of genetic lesions starting from a normal cell. To this end, we first introduced truncating mutations in the ASXL1 gene and selected two clones with monoallelic truncations (Figures 6J and S7D). ASXL1 C-terminus truncation is an early event in myeloid malignancies and one of the most common mutations in individuals with CHIP (Link and Walter, 2016; Steensma et al., 2015). We subsequently, in a second step, deleted one copy of chr7q in one of the ASXL1-engineered clones (Figures 6J and S7E–G). This set of clones recapitulated stepwise progression from normal to preleukemia (ASXL1 mutation) to high-risk MDS (ASXL1 mutation + del7q), assessed by CD45 and CD90 marker expression, cell viability and colony formation (Figures 6K–N). These results collectively show that our phenotypic roadmap can be used to model disease stage transitions across the spectrum of myeloid malignancy driven by a variety of genetic lesions and their combinations.

Modeling disease stage-specific effects of therapeutic interventions

5-Azacytidine (5-AzaC) is a hypomethylating agent that is used as first-line therapy in MDS. 30–50% of MDS patients show some response, but there are currently limited biomarkers to predict the responders (Bejar and Steensma, 2014). Furthermore, the mechanism by which 5-AzaC exerts its therapeutic effects is not clear. Potential mechanisms may include induction of differentiation or preferential inhibition of the growth of the MDS clone. To first test for potential effects of 5-AzaC in inducing differentiation, we cultured HPCs derived from the different iPSC lines in methylcellulose in the presence or absence of 5-AzaC (Figure 7A). Strikingly, treatment with 5-AzaC resulted in a marked rescue of BFU-E and CFU-GEMM colonies in low-risk MDS-iPSCs (Figures 7B and S7H, I). In contrast, it had no effect in colony growth from normal iPSCs or any other iPSC line from other disease stages. We then tested for selective effects in the growth of the MDS clone using a competitive growth assay. Intriguingly, 5-AzaC had an inhibitory effect in the growth of high-risk MDS-iPSC-derived HPCs, but not of those derived from other disease stage iPSCs or normal iPSCs (Figure 7C, D). These results suggest that 5-AzaC may primarily affect differentiation in earlier stages of the disease, whereas its main therapeutic action later on might be mediated through selective inhibition of the MDS clone. DNA methylation analysis of low-risk MDS-iPSC-derived HPCs (MDS-1.12 line) treated with 5-AzaC for 3 days revealed striking genome-wide hypomethylation following 5-AzaC treatment, which included gene promoters, suggesting that hypomethylation may underlie the rescue of colony formation in these cells (Figures 7E and S7J).

Figure 7. Disease stage-specific drug responses.

Figure 7

(A) Schematic of experimental design to test the effects of 5-AzaC in differentiation.

(B) Methylcellulose assays at day 14 of hematopoietic differentiation in the presence or absence of 5-AzaC. The number of colonies from 5,000 seeded cells is shown. Normal: average of H1 (two independent experiments) and N-2.12; preleukemic: N-3.10; low-risk MDS: average of MDS-1.2 and MDS-1.12 (four independent experiments); high-risk MDS: MDS-3.4; MDS/AML: AML-4.10 and AML-4.24.

(C) Schematic of growth competition assay to test the effects of 5-AzaC in cell proliferation relative to normal cells. The cells were mixed 1:1 with the N-2.12 line stably expressing GFP at day 9 of hematopoietic differentiation in the presence or absence of 5-AzaC and followed for an additional 2 days by flow cytometry.

(D) The relative population size was calculated as the percentage of GFP cells in the treated cells relative to the percentage of GFP cells in the untreated cells at each time point. iPSC lines from left to right: N-2.12, N-3.10, MDS-1.12, MDS-2.13, AML-4.24.

(E) Volcano plot showing differences in DNA methylation in 4 HPC samples independently treated with 5-AzaC derived from the MDS-1.12 line in two independent differentiation experiments compared to two untreated controls.

(F) HPCs derived from the AML-4.24 and the AML-4.10 iPSC lines treated with rigosertib. The relative population size was calculated as the number of treated cells relative to the number of untreated cells at each time point. Mean and SEM from triplicate experiments are shown.

See also Figure S7.

To further test for stage-specific drug responses, we treated HPCs derived from two MDS/AML lines from patient #4, capturing a less and a more advanced disease stage, the AML-4.24 line derived from the dominant clone and the AML-4.10 line derived from the KRAS mutated subclone (Figure 1), with rigosertib, a small molecule inhibitor of RAS signaling pathways that is currently in clinical trials for high-risk MDS (Athuluri-Divakar et al., 2016). As predicted, AML-4.10 HPCs showed marked sensitivity to rigosertib, whereas AML-4.24 cells were marginally affected (Figure 7F). These results collectively support the use of our disease progression model in drug testing.

DISCUSSION

Here we used an approach integrating cell reprogramming and cancer genetics to establish iPSC lines representative of distinct stages during the cellular transformation from normal cells to AML through an MDS stage. Detailed genetic and clonal characterization of the starting cell population and the derived iPSC lines allowed us to make additional observations regarding the degree to which the output of reprogramming is representative of the clonal composition of the primary cells. Our results show that the clonal representation of the original cells in the iPSCs is skewed, often in favor of residual normal cells over cells of the premalignant or malignant clone (Table S1). They also show that it is reprogramming per se and not the in vitro stimulation and expansion that accounts for this bias which seems to be conferred by some MDS- and AML-associated genetic lesions, but not others, while some genetic abnormalities seem to be incompatible with reprogramming (Figure S1B–E). Among the ones tested here, del(5q) and monosomy 7 could never be captured in iPSCs, despite cells harboring them comprising over 80% of the starting cell pool. It might be possible to overcome this refractoriness by using alternative reprogramming factor cocktails, which we did not test here. A negative or positive impact of specific cancer-associated gene mutations on the reprogramming “fitness” of the cells would not be surprising given well-studied positive and negative effects, respectively, of TP53 inactivation and Fanconi Anemia pathway mutations on reprogramming (Papapetrou, 2016). Importantly, despite the skewed clonal and subclonal representation, we were able to capture normal and preleukemic cells, as well as malignant clones and subclones and thus compile a panel of lines carrying genomes representative of different disease stages from normal to fully transformed states. Here we applied this strategy to hematologic malignancies, which are particularly amenable to the development of a progression model, because they are relatively genetically simple cancers and MDS is one of very few well-recognized pre-neoplastic conditions in humans (Martincorena and Campbell, 2015). Although the genetic complexity and low reprogramming efficiency may impose challenges, it is conceivable that similar models can be developed for a variety of other cancers, including solid tumors (Kim et al., 2013; Kim and Zaret, 2015; Papapetrou, 2016).

The phenotypes we characterized in our model bear direct relevance to disease phenotypes at the patient level. Morphologic dysplastic changes are a hallmark and a diagnostic criterion of MDS (Arber et al., 2016). Furthermore, our model presented a pattern of graded severity from unilineage to multilineage dysplasia, similar to what is often observed in the clinic in low-risk vs high-risk MDS cases (Figures 3B and S5B). The impaired differentiation and reduced clonogenicity affecting erythroid and multilineage progenitors first, is a very likely correlate of the ineffective hematopoiesis and cytopenias observed in MDS patients, which predominantly affect the erythroid lineage, and consistent with findings in primary MDS cells cultured ex vivo (Flores-Figueroa et al., 1999; Sato et al., 1998). The increased cell death is consistent with findings of apoptotic markers in primary patient BM, which has led to the proposition that apoptosis may be another pathophysiologic mechanism accounting for the cytopenias (Kerbauy and Deeg, 2007). The growth and viability defects of MDS cells are abolished upon transformation to full-blown AML and this is also recapitulated in our model. Our findings are also consistent with previous reports of minimal perturbation of the HSPC compartment in low-risk MDS, but a more significant one in higher-risk cases (Elias et al., 2014; Will et al., 2012; Woll et al., 2014). Interestingly, loss of megakaryocyte progenitors is the earliest event in our progression model, which is intriguing in view of recent findings on the close relationship between megakaryocyte progenitors and HSCs (Notta et al., 2016; Sanjuan-Pla et al., 2013; Woolthuis and Park, 2016).

Strikingly, hematopoietic cells derived from our MDS/AML-iPSCs through in vitro differentiation were able to robustly transplant a lethal leukemia when intravenously injected into immunodeficient mice. This is the first demonstration that HSPCs generated from hPSCs through in vitro differentiation possess engraftment ability and is an intriguing finding given the general inability of hematopoiesis derived from human pluripotent stem cells (hPSCs) to engraft (Vo and Daley, 2015). Deeper investigation into the transcriptional programs and cellular processes active in these MDS/AML-iPSC-derived hematopoietic cells may inform ongoing efforts towards the generation of HSPCs with long-term engraftment potential from pluripotent or other cell sources (Vo and Daley, 2015). These cells can also provide an attractive platform for deconstructing and reconstructing clonal evolution in AML and for testing drugs in an in vivo setting.

More than a decade ago it was proposed that myeloid transformation requires two types of events, one that induces proliferation and one that blocks differentiation, referred to respectively as class I and II mutations (Gilliland and Griffin, 2002; Gilliland and Tallman, 2002). The former would typically involve classic signaling pathways and the latter hematopoietic transcription factors. It was also suggested that class II without class I mutations might result in MDS. Whereas perturbations of proliferation, differentiation and other processes like self-renewal and cell survival are likely involved in the development of MDS and MDS/AML, it is now obvious that the picture is much more complex and this model can aid future studies in understanding these processes at a cellular and molecular level. However several limitations need to be noted. MDS is quite heterogeneous genetically and phenotypically and we only used iPSCs derived from 4 patients for this study. Our findings that phenotypes of these cells cluster with disease stage supports the well-established observation and long-held idea that diverse genotypes converge to few phenotypes at the cellular and organismal level in myeloid malignancies and cancer more generally. Thus, whereas the derivation of larger collections of MDS- and AML- iPSC lines in the future can further refine the phenotypic roadmap we delineate here, our findings can already provide a framework to aid investigation into disease mechanisms, drug responses and the cellular and molecular events driving leukemia progression. Our results align well with the newly emerging view of myeloid malignancy as a spectrum of clinical syndromes encompassing clonal hematopoiesis, MDS and AML, reflecting disordered hematopoietic processes that can often progress from one to another. However it is clear that not every patient will necessarily transition through each of these stages. For example CHIP can progress directly to AML without an MDS stage, whereas MDS and AML can potentially also develop without an antecedent CHIP phase. It is thus conceivable that different routes to myeloid transformation exist and that our findings may not apply to all.

Understanding the cellular events leading to disease stage transitions can help an enhanced understanding of the process of myeloid transformation and cellular transformation more generally and guide drug development targeting specific disease stages or preventing the progression from one stage to another. We provided here proof of principle that transitions between stages (progression or reversal) can be modeled in our system. Our model offers new opportunities to study HSPC populations in MDS and AML, which often cannot be easily obtained at sufficient numbers from primary samples or propagated in patient-derived xenograft models. It also offers the unique opportunity to study disease mechanisms in pure clonal cells devoid of the confounding cellular, genetic and clonal heterogeneity of primary patient specimens. Mutation of the second GATA2 allele upon progression to MDS has been described in familial cases of GATA2 mutation, but its role in disease progression has not been studied before (Collin et al., 2015). Our results suggest that further loss of function of GATA2 contributes to progression (Figure 6G–I). This is consistent with a fundamental role of GATA2 in hematopoiesis from studies in mouse models (de Pater et al., 2013). Our findings, however, also suggest that additional events are needed for progression to a more aggressive disease (since GATA2 KO induced rather mild phenotypic changes, Figure 6H, I), which is consistent with the finding of additional recurrent MDS-associated somatic lesions in the MDS clone of this patient (Figure 1) and our results showing more dramatic phenotypic changes driven by engineering a del(7q) (Figure 6G–I). While our results using 5-AzaC and risosertib treatment warrant further investigation, they demonstrate the usefulness of this model in testing therapeutic interventions in principle.

Despite the well-established use of iPSCs in disease modeling, their potential to model cancer has barely been explored (Papapetrou, 2016). We show here that integrated patient cell reprogramming and cancer genetics is a powerful way to dissect cancer progression, reconstruct clonal hierarchies and mimic clonal evolution leveraging CRISPR technology.

STAR METHODS

Detailed methods are provided in the online version of this paper and include the following:

CONTACT FOR REAGENTS AND RESOURCE SHARING

Requests should be addressed to and will be fulfilled by Lead Contact Eirini P. Papapetrou (eirini.papapetrou@mssm.edu)

EXPERIMENTAL MODEL AND SUBJECT DETAILS

iPSC generation

Cryopreserved BM or PB mononuclear cells were thawed and cultured in X-VIVO 15 media with 1% nonessential amino acids (NEAA), 1 mM L-glutamine and 0.1 mM β-mercaptoethanol (2ME), supplemented with 100 ng/ml stem cell factor (SCF), 100 ng/ml Flt3 ligand (Flt3L), 100 ng/ml thrombopoietin (TPO) and 20 ng/ml IL-3 for at least 1 and for up to 7 days to induce cell proliferation. For erythroblast reprogramming, the cells were cultured in X-VIVO 15 media with 20% BIT 9500 serum substitute (Stem Cell Technologies), 1% nonessential amino acids (NEAA), 1 mM L-glutamine and 0.1 mM β-mercaptoethanol (2ME), supplemented with 50 ng/ml SCF, 2U/ml erythropoietin (EPO) and 10 ng/ml IL-3 for 5–10 days. For induction of reprogramming, 10,000–300,000 cells (depending on availability) were plated on retronectin-coated 24-well dishes and transduced with the excisable OKMS lentiviral vector CMV-fSV2A (Kotini et al., 2015). One or two days later, the cells were harvested and plated on mitotically inactivated MEFs in 6-well plates and centrifuged at 500 rpm for 30 min at RT. The next day and every day thereof, half of the medium was gently changed to hESC medium with 0.5 mM valproic acid (VPA). For the first 10 days any cells contained in the medium removed were collected by centrifugation and placed back in the same well. After 3–4 weeks, colonies with hPSC morphology were manually picked and expanded. iPSCs were cultured on mitotically inactivated MEFs or in feeder-free conditions on Matrigel with hESC media supplemented with 6 ng/ml FGF2 (Papapetrou and Sadelain, 2011). Assays for characterization of pluripotency (flow cytometry, OCT4 promoter methylation analysis, teratoma formation) were performed as previously described (Papapetrou et al., 2011; Papapetrou and Sadelain, 2011; Papapetrou et al., 2009). Flow cytometry for pluripotency markers was performed with antibodies Alexa Fluor 647-SSEA3 (clone MC631, BD Pharmingen), Alexa Fluor 647-SSEA4 (clone MC813-70, BD Pharmingen), Alexa Fluor 647-Tra-1-81 (clone TRA-1-81, BD Pharmingen) and Alexa Fluor 647-Tra-1-60 (clone TRA-1-60, BD Pharmingen). For teratoma formation assays, undifferentiated iPSCs were suspended in hESC medium containing 10 μM Y-27632. Approximately 2 × 106 cells were injected intramuscularly into NOD/SCID/IL2rγ−/− mice. Eight weeks later, the tumors were surgically dissected and fixed in 4% formaldehyde. The samples were stained with hematoxylin and eosin for histological analysis. All mouse studies were performed in compliance with Icahn School of Medicine at Mount Sinai laboratory animal care regulations. Southern Blot analyses of the CMV-fSV2A vector integration sites were performed as previously described (Kotini et al., 2015; Papapetrou and Sadelain, 2011). aCGH was performed on a chromosome 7 or 20- specific array platform with a mean spacing of 365 bp (NimbleGen Human CGH 385K Chromosome 7 or 20 Tiling Array). Labeling and hybridization were performed according to the manufacturer’s instructions. The data set was assessed for quality and median background subtracted signal intensities were normalized using the Bioconductor package limma. The data were further normalized by mean centering the logFC values, where the mean was calculated from all autosomes, except chromosome 7 or 20. Patient samples were obtained with informed consent under protocols approved by a local Institutional Review Board at Memorial Sloan-Kettering Cancer Center, the Icahn School of Medicine at Mount Sinai and the University of Patras Medical School.

Mouse strain used for transplantation experiments

NOD/SCID/interleukin 2 receptor γ chain null (NOD/SCID/IL2rγ−/−, NSG) mice were purchased from Jackson Laboratories and housed at the Center of Comparative Medicine and Pathology of Memorial Sloan-Kettering Cancer Center and the Center for Comparative Medicine and Surgery at Icahn School of Medicine at Mount Sinai. All mouse studies were performed in compliance with Memorial Sloan-Kettering Cancer Center and Icahn School of Medicine at Mount Sinai laboratory animal care regulations.

METHOD DETAILS

Mutational analysis

Bone marrow or peripheral blood cells and derivative iPSCs from patients #1, #3 and #4 were analyzed by high-throughput sequencing with a targeted capture assay of 585 genes at an average coverage of 829× (with a standard deviation of 130). We aligned the reads using BWA mem 0.7.5a. We used Mutect 1.1.4 to call single nucleotide variants, comparing our samples to a sample representing a pool of normal samples sequenced on the same panel with similar coverage and keeping only high confidence variants (Cibulskis et al., 2013). We used PINDEL 0.2.5a7 to call short insertions and deletions. Each mutation was manually reviewed and artifacts were excluded using standard criteria (strand bias, low quality reads, end of read bias). We also excluded all mutations present in at least one database of known non-somatic variants (DBSNP or 1000 genomes) and not classified as somatic in COSMIC or as clinically relevant according to DBSNP. We finally cross-referenced the variants against previous population studies in myeloid malignancies (Papaemmanuil et al., 2016; Papaemmanuil et al., 2013). Patient #2 cells and derivative iPSCs were analyzed by whole exome sequencing, as described (Kotini et al., 2015).

Hematopoietic differentiation

For hematopoietic differentiation, spin embryoid bodies (EBs) were prepared and cultured in APEL medium, as described (Ng et al., 2008). Briefly, cells were dissociated into single cells with accutase and plated at 3,500 cells per well in round-bottom low-attachment 96-well plates in APEL medium containing 30 ng/ml bone morphogenetic protein 4 (BMP4) and 10 μM Y-27632. The plates were centrifuged at 800 rpm for 5 min to induce EB aggregation. After 24 hours, the medium was replaced by APEL medium containing 30 ng/mL BMP4 and 50 ng/mL FGF2. After 2 days, the cytokine cocktail was changed to 20 ng/ml vascular endothelial growth factor (VEGF), 10 ng/ml FGF2, 100 ng/ml stem cell factor (SCF), 20 ng/ml Flt3 ligand (FL), 20 ng/ml thrombopoietin (TPO), 40 ng/ml IL-3. On day 8, EBs were collected and resuspended in Stem Pro34 SFM medium with 1% nonessential amino acids (NEAA), 1 mM L-glutamine and 0.1 mM β-mercaptoethanol (2ME), supplemented with 100 ng/ml SCF, 20 ng/ml Flt3L, 20 ng/ml TPO, 40 ng/ml IL-3. The medium was thereafter replaced every two days. At the end of the EB differentiation culture (day 8, 10, 12, 14, 16 or 18, depending on the downstream readout) the cells were dissociated with accutase into single cells. T-cell differentiation was performed as described (Themeli et al., 2013). Hematopoietic differentiation was initiated as described above, with the difference that 10 ng/ml IL-6 was added to the cytokine cocktail at day 6. On day 8, EBs were collected and resuspended in Stem Pro34 SFM medium with 1% nonessential amino acids (NEAA), 1 mM L-glutamine, 50 μg/ml ascorbic acid and 0.1 mM β-mercaptoethanol (2ME), supplemented with 20 ng/ml VEGF, 100 ng/ml SCF, 20 ng/ml Flt3L, 40 ng/ml IL-3, 10 ng/ml IL-6. Day 10 EBs were dissociated by treatment with accutase for 20 min and single cells were then seeded on OP9-DL4 monolayers in α-MEM with 20% FBS, 1 mM L-glutamine, 1% NEAA, 0.1 mM 2ME and 50 μg/ml ascorbic acid, supplemented with 10 ng/ml SCF, 10 ng/ml Flt3L and 5 ng/ml IL-7. The media was replaced every other day and fresh OP9-DL4 cells were used every 5 days.

Globin gene expression analysis

Individual BFU-Es were manually picked and pooled. RNA was isolated with Trizol (Life Technologies). Reverse transcription was performed with Superscript III (Life Technologies) and qPCR was performed with the SsoFast EvaGreen Supermix (Bio-Rad) using primers shown in Table S5. Reactions were carried out in triplicate in a 7500 Fast Real-Time PCR System (Applied Biosystems).

Flow cytometry and cell sorting

For flow cytometry, the following antibodies were used: CD34-PE (clone 563, BD Pharmingen), CD41a- PE-Cy7 (clone HIP8, BD Pharmingen), CD90-PerCP/Cy5.5 (clone 5E10, BioLegend), CD45-APC (clone HI30, BD Pharmingen), CD15-FITC (clone W6D3, BD Pharmingen), CD14-APC (clone M5E2, BD Pharmingen), CD33-PE-CF594 (clone WM53, BD Horizon), CD235a-PerCP/Cy5.5 (clone HI264, BioLegend), CD7-BV510 (Clone M-T701, BD Horizon), CD4-PE-Cy7 (Clone RPA-T4, BD Pharmingen) and CD8-PerCP/Cy5.5 (Clone RPA-T8, BD Pharmingen). Cell viability was assessed with DAPI (Life Technologies). Cells were then assayed on a BD Fortessa and data were analyzed with FlowJo software (Tree Star). Sorting of CD41a+ and CD41a cells was performed on a BD FACS Aria II.

Clonogenic assays

For methylcellulose assays, the cells were resuspended in StemPro-34 SFM medium at a concentration of 3 × 104/ml. 500 μl of cell suspension were mixed with 2.5 ml MethoCult GF+ (H4435, Stem cell technologies) and 1 ml was plated in duplicate 35-mm dishes. Colonies were scored after 14 days and averaged between the duplicate dishes. Digital images of the colonies were taken with an Evos XL Core Cell Imaging System. For megakaryocyte progenitor assays, 7.5 × 103 sorted CD41a+, CD41a or total cells were mixed with MegaCult-C (#04971, Stem cell technologies) and plated in duplicate slides according to the manufacturer’s protocol. Colonies were stained and scored after 12 days and averaged between the duplicate slides. The slides were read on a Nikon Eclipse Ci microscope and digital images were taken with a Nikon DS-U3 camera and NIS-Elements BR software.

Cell growth assays

For EB size measurements, photographs of individual EBs were taken on day 8 of hematopoietic differentiation using an EVOS FL cell image system (AMG) and their size was measured with ImageJ. 10 EBs were measured in each differentiation experiment. For growth competition assays, N-2.12-GFP, a clonal line previously generated from the N-2.12 line after transduction with a lentiviral vector expressing eGFP (Kotini et al., 2015), was mixed with each test iPSC line 1:1 and 3.5 × 103 cells/well were plated in duplicate round bottom ultra low attachment 96-well plates with APEL medium and cytokines to initiate hematopoietic differentiation. 36 wells were harvested the next day (day 2) and on days 4, 8 and 12 and the GFP cells were measured by flow cytometry. The relative population size of GFP cells at each time point was calculated relative to the population size on day 2.

Cytological analyses

Approximately 200,000 cells from liquid hematopoietic differentiation cultures or methylcellulose cultures were washed twice with PBS containing 2% FBS and resuspended in PBS. Cytospins were prepared on slides using a Shandon CytoSpin III cytocentrifuge (Thermo Electron Corporation). Slides were then air-dried for 30 mins and stained with the Hema 3 staining kit (Fisher Scientific Company LLC). The slides were read on a Nikon Eclipse Ci microscope and digital images were taken with a Nikon DS-Ri2 camera and NIS-Elements D4.40.00 software.

Transplantation into NSG mice

NSG mice were purchased from Jackson Laboratories and housed at the Center of Comparative Medicine and Pathology of Memorial Sloan-Kettering Cancer Center and the Center for Comparative Medicine and Surgery at Icahn School of Medicine at Mount Sinai. One day before transplantation, the mice were either injected intraperitoneally with 30mg/kg Busulfan solution or sub-lethally irradiated (250 rad). Some of the mice also received IVIG one hour prior to irradiation and one hour prior to transplantation. Hematopoietic cells derived from iPSC lines after 8–16 days of hematopoietic differentiation were dissociated with accutase, resuspended in StemPro-34 at 1×106 single cells per 100μL and injected into the mice (1×106 cells per mouse) via the tail-vein or retro-orbital route using a 25G needle. The injected mice were monitored daily and engraftment was assessed 8–11 weeks post transplantation or earlier if recipients appeared moribund. All mouse studies were performed in compliance with Memorial Sloan-Kettering Cancer Center and Icahn School of Medicine at Mount Sinai laboratory animal care regulations.

RNA sequencing

Magnetic cell sorting of CD34+ cells was performed between days 9 and 12 of hematopoietic differentiation, using the MACS cell separation microbeads and reagents (Miltenyi Biotec). Total RNA was extracted with the RNeasy mini kit (Qiagen). PolyA-tailed mRNA was selected with beads from 1μg total RNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). cDNAs were generated using random hexamers and ligated to barcoded Illumina adaptors with the NEXTflex Rapid Directional RNA-Seq Library Prep Kit (Bioo Scientific). Sequencing of 75 nucleotide-long single-end reads was performed in a NextSeq-500 (Illumina).

CRISPR/Cas9-mediated GATA2 inactivation

For generation of biallelically inactivated clones, a lentiviral plasmid (gRNA/Cas9) co-expressing a human codon optimized Cas9 with a nuclear localization signal (obtained from George Church, Addgene plasmid # 41815) linked to mCitrine by a P2A peptide driven by the CMV immediate early promoter and gRNAs driven by the U6 promoter was constructed. A gRNA targeting exon 4 of the GATA2 gene (sequence shown in Figure S7A) was inserted downstream of the U6 promoter sequence. The N-3.10 iPSC line was dissociated with accutase into single cells and plated on Matrigel. Two days later the cells were transduced with the gRNA/Cas9 lentiviral vector supernatant. Two days later the cells were dissociated into single cells with accutase and replated at clonal density (500 cells per 60-mm dish). After 7–10 days, single colonies were picked in separate wells of a 6-well plate and allowed to grow for approximately 3–6 days. For screening individual clones, 1–3 medium-sized colonies from each clone were picked directly into a 0.2 ml tube, pelleted and lysed. Restriction Fragment Length Polymorphism (RFLP) analysis was performed after PCR with primers F: AGCACCTGCCTTTACCTGAA and R: GGGTTCCCTGTAGGGTCTGT, digestion of the product with SacII and analysis in an agarose gel stained with EtBr. For sequencing of the edited gene, PCR primers F: AGCACCTGCCTTTACCTGAA and R: GGGTTCCCTGTAGGGTCTGT were used. For generation of clones with inactivation of the wild-type allele only, a gRNA targeting exon 6 of the GATA2 gene (sequence shown in Figure S7B) was inserted downstream of the U6 promoter sequence in the gRNA/Cas9 plasmid described above. The N-3.10 iPSC line was cultured in hESC media containing 10 μM Y-27632 for at least one hour before nucleofection. The cells were dissociated into single cells with accutase and 1 million cells were used for nucleofection with 10 μg of CRISPR/Cas9 plasmid using Nucleofector II (Lonza) and program B-16. Immediately after nucleofection the cells were replated on MEFs. mCitrine+ cells were FACS-sorted 48 hours after transfection and plated as single cells at clonal density. Colonies were picked and screened as described above by RFLP analysis with primers F: GGACCCCCTCTGTCACTGT and R: CTAGCCCATGGCGGTCAC and digestion of the product with MluCI. For sequencing and allele determination, the PCR product was cloned into the PCR-4 TOPO TA vector (Invitrogen).

CRISPR/Cas9-mediated ASXL1 mutation

A gRNA targeting exon 12 of the ASXL1 gene (sequence shown in Figure S7D) was inserted downstream of the U6 promoter sequence in the gRNA/Cas9 plasmid described above. The previously described iPSC clone N-2.12-D, derived from the normal N-2.12 line, after targeting of a construct with two inverted loxP sites into one copy of chr7q (Kotini et al., 2015), was used as the parental line. Nucleofection and FACS-sorting of mCitrine+ cells were performed as described above for GATA2 gene editing and screening by RFLP was performed using primers F: CACGTATCAAACCACCCTGGGTGGT and R: GGCCACAGGCCTCACCACCATCA and digestion of the PCR product with EaeI.

Engineering of chr7q deletions

AAV-mediated gene targeting of a construct with two inverted loxP sites and an HSV-tk transgene into one copy of chr7q in iPSC line N-3.10, to derive clone N-3.10-D, was performed as described (Kotini et al., 2015). The N-3.10 iPSC line was dissociated with accutase into single cells and plated on Matrigel. One day later the cells were transduced with an AAV vector targeting chr7q by ATG-trap of the DNAJB6 gene containing a cassette consisting of two loxP sites in inverted orientation, a puromycin resistance gene and the Herpes Simplex Virus-1 Thymidine Kinase (HSV-tk) gene. Two days later the cells were replated on puromycin-resistant MEFs and selected with 0.5 μg/ml puromycin for 2–4 days. After 7–10 days single colonies were transferred in separate wells of a 6-well plate, allowed to grow for approximately 3–6 days and screened by PCR using primers: DNAJB6-3hom-F: CTTCCGGAGGACAGACACAT, DNAJB6-3hom-R: AGCACAGGCTTCCTCACAGT, DNAJB6-5hom-F: ACCTGTGTGGCTTGAATCCT and DNAJB6-5hom-R: GTGGGCTTGTACTCGGTCAT. Transduction of clones N-3.10-D and AX34 (derived from N-2.12-D with monoallelic ASXL1 truncation) with a Cre recombinase-expressing integrase-deficient lentiviral vector (IDLV) and selection of colonies for loss of the targeted chr7q copy with ganciclovir was performed as described (Kotini et al., 2015). 150.000 single cells were plated on Matrigel. The next day the cells were transduced with vector supernatants in the presence of 4 μg/ml polybrene for sixteen hours. The transduced cells were dissociated with accutase two days later and replated at clonal density. Ganciclovir selection was performed at a concentration of 200 μM for 10–15 days. Selection of ganciclovir-resistant clones was performed using TaqMan qPCR with primers and probes shown in Table S6. Clones with del(7q) were further characterized by karyotyping, aCGH and/or FISH.

Treatment with 5-AzaC

For clonogenic assays, 5-AzaC was added to the medium in the beginning of methylcellulose cultures at 100 nM and 500 nM. For competitive growth assays, each iPSC line was mixed 1:1 with the N-2.12-GFP clone. 5-AzaC was added on days 9 and 10 of hematopoietic differentiation at 100nM and 500nM. The GFP fraction was measured by flow cytometry on days 9, 10 and 11 and the relative population size of GFP cells at each time point was calculated relative to the population size of untreated cells.

QUANTIFICATION AND STATISTICAL ANALYSIS

Genome-wide gene expression analysis

Fastq files were aligned to the UCSC hg19 (NCBI GRCh37.75) human genome assembly using STAR alignment tool. Aligned bam files were filtered for uniquely aligned reads with MAQ > 10. RNA-seq reads were subsequently counted using GRCh37.75 annotation with tRNA and rRNA removed. Read counting was done using SummarizeOverlaps function from R-package “GenomicAlignments” with IntersectionNotEmpty mode. There were 10–20 million reads for each sample after read counting. Read count preprocessing was performed by keeping genes with RPKM > 1 in at least two samples and count > 10 in at least two samples. Around 18,000 genes remained after filtering. Principal component analysis was performed by R function prcomp on the regularized log transformation (rld function in R-package “DESeq2”) of normalized read counts. Differential expression analysis was performed using R-package “DESeq2” for three comparisons: AML versus normal, high-risk MDS versus normal and low-risk MDS versus normal. Genes with log2FC > 3 or log2FC < −3 and Benjamini & Hochberg (BH) adjusted P-value < 0.05 were considered significantly differentially expressed. A total of 2,018 genes differentially expressed between AML versus normal, high-risk MDS versus normal and low-risk MDS versus normal were identified. A heatmap of the scaled log normalized counts of these 2,018 genes on all samples was generated using R-package “ComplexHeatmap” with automatic row and column clustering.

Gene Set Enrichment Analysis (GSEA) (Subramanian et al., 2005) was performed on 3,494 gene sets from the Molecular Signatures Database (MSigDB, http://www.broadinstitute.org/msigdb) and additional gene sets derived using publically available microarray data from MDS patients (GSE19429) (Pellagatti et al., 2010). To generate up-regulated and down-regulated gene sets in MDS patients data matrix was downloaded with getGEO function in R-package “GEOquery”. Probe intensities were quantile normalized and summarized to gene level by taking the median. Patients of subtype RA and RARS were labeled as low-risk MDS; patients of subtype RAEB1, RAEB2 were labeled as high-risk MDS. Subsequently, four differential expression analyses were performed using “limma”: low-risk MDS versus normal, high-risk MDS versus normal, low-risk MDS with del7q versus normal, high-risk MDS with del7q versus normal. For a particular comparison, the top 50 significantly up-regulated genes and top 50 significantly down-regulated genes (BH adjusted P-value < 0.05) were curated and defined as a gene set, resulting in a total of eight gene sets. These eight gene sets were appended to the MsigDB C2 collection gene sets. We then ran GSEA using these gene sets on three comparisons: AML-iPSC versus normal, high-risk MDS-iPSC versus normal, and low-risk MDS-iPSC versus normal, using the Broad GSEA tool with default settings. Gene sets with FDR q-value < 0.05 were considered significantly enriched. RNA sequencing data are available at GSE92494.

DNA methylation analysis by ERRBS

For Enhanced Reduced Representation Bisulfite Sequencing (ERRBS) experiments, MDS-1.12 cells from the same experiments used to assess colony formation, shown in Figure 7B, were collected on day 14 of hematopoietic differentiation and treated with 0, 100 nM and 500 nM 5-AzaC every day for 3 days.

For ERRBS, genomic DNA was extracted and library fragment lengths of 150–250 bp and 250–400 bp were prepared, gel isolated and sequenced on an Illumina Hi-seq 2500 (Akalin et al., 2012a). All samples passed quality control with methylation assayed at >2 million CpG dinucleotides per sample on average 80× coverage per cytosine.

Methylation data analysis was performed using an established computational pipeline (Akalin et al., 2012a). Briefly, reads were aligned to the genome using the bismark alignment software with a maximum of 2 mismatches in a directional manner and only uniquely aligning reads were retained. Read bases aligning to positions with at least 20 phred quality score were retained for subsequent analysis. Percentage of bisulfite converted Cs (representing unmethylated Cs) and non-converted Cs (representing methylated Cs) were recorded for each C position in a CpG context. Differential methylation analysis was performed using R package methylKit (Akalin et al., 2012c). 30,599 differentially methylated loci between the 5-AzaC-treated and untreated groups were identified (25% methylation difference, q<0.01), correlating to 13,443 genes. The differentially methylated loci were annotated with hg19 to infer gene associations. ERRBS data are available at GSE93507.

Statistical analysis

Statistical analysis was performed with GraphPad Prism software. Data are shown as the mean with standard error of the mean (SEM). Pairwise comparisons between different groups were performed using a two-sided unpaired unequal variance t-test. For all analyses, P < 0.05 was considered statistically significant. Investigators were not blinded to the different groups.

DATA AND SOFTWARE AVAILABILITY

RNA-seq and ERRBS data are accessible through GEO datasets (GEO: GSE92494 and GSE93507)

ADDITIONAL RESOURCES

N/A

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Alexa Fluor 647-SSEA3 BD Pharmingen Cat#561145; RRID: AB_10893794
Alexa Fluor 647-SSEA4 BD Pharmingen Cat#560219; RRID: AB_1645442
Alexa Fluor 647-Tra-1-81 BD Pharmingen Cat#560124; RRID: AB_1645449
Alexa Fluor 647-Tra-1-60 BD Pharmingen Cat#560122; RRID: AB_1645448
CD34-PE BD Pharmingen Cat#550761; RRID: AB_393871
CD41a- PE-Cy7 BD Pharmingen Cat# 561424; RRID: AB_10642584
CD90-PerCP/Cy5.5 BioLegend Cat#328118; RRID: AB_2303335
CD45-APC BD Pharmingen Cat#555485; RRID: AB_398600
CD15-FITC BD Pharmingen Cat#562370; RRID: AB_11153493
CD14-APC BD Pharmingen Cat#555399; RRID: AB_398596
CD33-PE-CF594 BD Horizon Cat#562492
CD235a- PerCP/Cy5.5 BioLegend Cat#349110; RRID: AB_2562706
CD7-BV510 BD Horizon Cat#563650
CD4-PE-Cy7 BD Pharmingen Cat#560649; RRID: AB_1727475
CD8-PerCP/Cy5.5 BD Pharmingen Cat#560662; RRID: AB_1727513
Biological Samples
N/A N/A N/A
Chemicals, Peptides, and Recombinant Proteins
rhSCF R&D Systems Cat #255-SC
rhFlt3 ligand R&D Systems Cat #308-FK
rhTPO R&D Systems Cat #288-TP
rhIL-3 R&D Systems Cat #203-IL
BIT-9500 StemCell Technologies Cat#09500
EPO (PROCRIT) N/A Cat#NDC-59676302-00
Retronectin Clontech Cat# T100B
VPA Sigma Cat#P4543; CAS: 1069-66-5
rhFGF2 R&D Systems Cat#233-FB
Y-27632 Tocris Cat#1254; CAS: 129830-38-2
APEL StemCell Technologies Cat#05210
rhBMP4 R&D Systems Cat#314-BP
rhVEGF Peprotech Cat#100-20
StemPro-34 SFM Life technologies Cat #10639011
Ascorbic acid Sigma Cat# A4403; CAS: 50-81-7
rhIL-6 Peprotech Cat# 200-06
rhIL-7 Peprotech Cat# 200-07
MethoCult GF+ StemCell Technologies Cat#H4435
Busulfan Sigma Cat#B2635; CAS: 55-98-1
Matrigel Corning Cat#354277
Puromycin Life technologies Cat#A11138-03
Polybrene Sigma Cat#H9268; CAS: 28728
Ganciclovir Millipore Cat#345700; CAS: 82410-32-0
5-AzaC Sigma Cat#A1287; CAS: 320-67-2
Critical Commercial Assays
NimbleGen Human CGH 385K Chromosome 7 Tiling Array Roche N/A
NimbleGen Human CGH 385K Chromosome 20 Tiling Array Roche N/A
TaqMan Universal master mix Applied Biosystems Cat#4304437
Trizol Life technologies Cat#15596018
Invitrogen SuperScript III First-Strand Synthesis System Life technologies Cat#18080051
SsoFast EvaGreen Supermix Bio-Rad Cat#172-5201
MegaCult-C Complete Kit with Cytokines StemCell Technologies Cat#04971
Hema 3 staining kit Fisher Scientific Company LLC Cat#23123869
MACS cell separation microbeads Miltenyi Biotec Inc. Cat#130042201
RNeasy mini kit QIAGEN Cat#74104
NEBNext Poly(A) mRNA Magnetic Isolation Module New England Biolabs Inc. Cat#E7490S
NEXTflex Rapid Directional RNA-Seq Library Prep Kit Bioo Scientific Corporation Cat#5138
Amaxa human stem cell nucleofector kit 1 Lonza Cat#VPH-5012
Deposited Data
Raw RNA-seq and ERRBS data GEO datasets: https://www.ncbi.nlm.nih.gov/gds/ GEO: GSE92494 and GSE93507
Human reference genome NCBI build 37, GRCh37.75 Genome reference consortium http://www.ncbi.nlm.nih.gov/projects/genome/assembly/grc/human/
Molecular Signatures Data Subramanian, Tamayo, et al., 2005 www.broadinstitute.org/msigdb
Expression profile of MDS patients and healthy controls Pellagatti et al., 2010 GEO: GSE19429
COSMIC Catalogue Of Somatic Mutations In Cancer http://cancer.sanger.ac.uk/cosmic
DBSNP N/A https://www.ncbi.nlm.nih.gov/projects/SNP/
Experimental Models: Cell Lines
Mitomycin-C treated MEFs Applied StemCell Inc Cat#ASF-1223
N-2.12-GFP Kotini et al., 2015 N/A
N-2.12-D Kotini et al., 2015 N/A
Experimental Models: Organisms/Strains
NOD/SCID/interleukin 2 receptor γ chain null mice Jackson Laboratory 005557
Recombinant DNA
gRNA/Cas9 www.adgene.org Plasmid #41815
CMV-fSV2A Papapetrou et al., 2011 N/A
Sequence-Based Reagents
Exon 4 GATA2 gRNA: GTCTCCAGCCTCATCTTCCGCGG This paper N/A
Exon 6 GATA2 gRNA: GTCAGACGACAACCACCACCTTATGG This paper N/A
Exon 12 ASXL1 gRNA: CCATAGAGAGGCGGCCACCACTG This paper N/A
RFLP primer exon 4 GATA2-F: AGCACCTGCCTTTACCTGAA This paper N/A
RFLP primer exon 4 GATA2-R: GGGTTCCCTGTAGGGTCTGT This paper N/A
RFLP primer exon 6 GATA2-F: GGACCCCCTCTGTCACTGT This paper N/A
RFLP primer exon 6 GATA2-R: CTAGCCCATGGCGGTCAC This paper N/A
RFLP primer exon 12 ASXL1-F: CACGTATCAAACCACCCTGGGTGGT This paper N/A
RFLP primer exon 12 ASXL1-R: GGCCACAGGCCTCACCACCATCA This paper N/A
DNAJB6-3hom-F : CTTCCGGAGGACAGACACAT Kotini et al., 2015 N/A
DNAJB6-3hom-R: AGCACAGGCTTCCTCACAGT Kotini et al., 2015 N/A
DNAJB6-5hom-F: ACCTGTGTGGCTTGAATCCT Kotini et al., 2015 N/A
DNAJB6-5hom-R: GTGGGCTTGTACTCGGTCAT Kotini et al., 2015 N/A
Software and Algorithms
Bioconductor limma N/A https://bioconductor.org/packages/release/bioc/html/limma.html
FlowJo software TreeStar Inc. N/A
NIS-Elements BR Nikon Instruments Inc. N/A
ImageJ N/A https://imagej.nih.gov/ij/
NIS-Elements D4.40.00 Nikon Instruments Inc. N/A
Mutect Cibulskis et al., 2013 http://archive.broadinstitute.org/cancer/cga/mutect
PINDEL N/A http://gmt.genome.wustl.edu/packages/pindel/
STAR alignment tool N/A https://github.com/alexdobin/STAR
R N/A https://www.r-project.org/
Enhanced reduced representation bisulfite sequencing (ERRBS) Akalin et al., 2012a http://epicore.med.cornell.edu/services.php?option=seqoverview#seq
methylKit Akalin et al., 2012c https://github.com/al2na/methylKit
GraphPad Prism GraphPad Software, Inc. N/A
Other
7500 Fast Real-Time PCR System Applied Biosystems N/A
BD Fortessa BD Biosciences N/A
BD FACS Aria II BD Biosciences N/A
Evos XL Core Cell Imaging System Thermo Fisher Scientific Inc. N/A
Nikon DS-U3 Nikon Instruments Inc. N/A
EVOS FL cell image system (AMG) Thermo Fisher Scientific Inc. N/A
Shandon CytoSpin III Thermo Electron Corporation N/A
Nikon Eclipse Ci Nikon Instruments Inc. N/A
Nikon DS-Ri2 camera Nikon Instruments Inc. N/A
NextSeq-500 Illumina Inc N/A
Nucleofector II Lonza N/A
HiSeq 2500 Illumina Inc N/A

Supplementary Material

1
2

Acknowledgments

This work was supported by NIH grants R00DK087923 and R01HL121570, a Damon Runyon-Rachleff Innovation Award from the Damon Runyon Cancer Research Foundation, the Edward P. Evans Foundation, a New Scholar in Aging Award from the Ellison Medical Foundation and research grants from the Henry and Marilyn Taub, the Babich Family Foundation and Alex’s Lemonade Stand Foundation, to E.P.P. and by NIH grant R01DK101989, a Kimmel Scholar Award and a V-Scholar Award to M.G.K. H. Y. was supported by the Tri-Institutional Training Program in Computational Biology and Medicine.

Footnotes

AUTHOR CONTRIBUTIONS

A.G.K. performed experiments, analyzed data and assisted with manuscript preparation. C.-J.C., A.C., T.-C.H, T.W., S.V., C H. and M.O. performed experiments and analyzed data. J.T.F. performed cytological analyses. H.Y., A.S., B.D.G. and C.S.L. performed bioinformatics analyses of RNA-seq data. V.M.K., A.S. and L.S. provided patient samples. R.K.R. and E.P. analyzed gene mutation data. D.P. and S.P. generated and analyzed ERRBS data. E.P.R. provided materials. M.G.K. analyzed data and prepared the manuscript. E.P.P. conceived, designed and supervised the study, analyzed data and prepared the manuscript.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Akalin A, Garrett-Bakelman FE, Kormaksson M, Busuttil J, Zhang L, Khrebtukova I, Milne TA, Huang Y, Biswas D, Hess JL, et al. Base-pair resolution DNA methylation sequencing reveals profoundly divergent epigenetic landscapes in acute myeloid leukemia. PLoS Genet. 2012a;8:e1002781. doi: 10.1371/journal.pgen.1002781. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Akalin A, Kormaksson M, Li S, Garrett-Bakelman FE, Figueroa ME, Melnick A, Mason CE. methylKit: a comprehensive R package for the analysis of genome-wide DNA methylation profiles. Genome Biol. 2012c;13:R87. doi: 10.1186/gb-2012-13-10-r87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Arber DA, Orazi A, Hasserjian R, Thiele J, Borowitz MJ, Le Beau MM, Bloomfield CD, Cazzola M, Vardiman JW. The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute leukemia. Blood. 2016;127:2391–2405. doi: 10.1182/blood-2016-03-643544. [DOI] [PubMed] [Google Scholar]
  4. Athuluri-Divakar SK, Vasquez-Del Carpio R, Dutta K, Baker SJ, Cosenza SC, Basu I, Gupta YK, Reddy MV, Ueno L, Hart JR, et al. A Small Molecule RAS-Mimetic Disrupts RAS Association with Effector Proteins to Block Signaling. Cell. 2016;165:643–655. doi: 10.1016/j.cell.2016.03.045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bejar R, Steensma DP. Recent developments in myelodysplastic syndromes. Blood. 2014;124:2793–2803. doi: 10.1182/blood-2014-04-522136. [DOI] [PubMed] [Google Scholar]
  6. Cibulskis K, Lawrence MS, Carter SL, Sivachenko A, Jaffe D, Sougnez C, Gabriel S, Meyerson M, Lander ES, Getz G. Sensitive detection of somatic point mutations in impure and heterogeneous cancer samples. Nat Biotechnol. 2013;31:213–219. doi: 10.1038/nbt.2514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Collin M, Dickinson R, Bigley V. Haematopoietic and immune defects associated with GATA2 mutation. Br J Haematol. 2015;169:173–187. doi: 10.1111/bjh.13317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. de Pater E, Kaimakis P, Vink CS, Yokomizo T, Yamada-Inagawa T, van der Linden R, Kartalaei PS, Camper SA, Speck N, Dzierzak E. Gata2 is required for HSC generation and survival. J Exp Med. 2013;210:2843–2850. doi: 10.1084/jem.20130751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Elias HK, Schinke C, Bhattacharyya S, Will B, Verma A, Steidl U. Stem cell origin of myelodysplastic syndromes. Oncogene. 2014;33:5139–5150. doi: 10.1038/onc.2013.520. [DOI] [PubMed] [Google Scholar]
  10. Flores-Figueroa E, Gutierrez-Espindola G, Guerrero-Rivera S, Pizzuto-Chavez J, Mayani H. Hematopoietic progenitor cells from patients with myelodysplastic syndromes: in vitro colony growth and long-term proliferation. Leuk Res. 1999;23:385–394. doi: 10.1016/s0145-2126(98)00176-3. [DOI] [PubMed] [Google Scholar]
  11. Genovese G, Kahler AK, Handsaker RE, Lindberg J, Rose SA, Bakhoum SF, Chambert K, Mick E, Neale BM, Fromer M, et al. Clonal hematopoiesis and blood-cancer risk inferred from blood DNA sequence. N Engl J Med. 2014;371:2477–2487. doi: 10.1056/NEJMoa1409405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gilliland DG, Griffin JD. The roles of FLT3 in hematopoiesis and leukemia. Blood. 2002;100:1532–1542. doi: 10.1182/blood-2002-02-0492. [DOI] [PubMed] [Google Scholar]
  13. Gilliland DG, Tallman MS. Focus on acute leukemias. Cancer Cell. 2002;1:417–420. doi: 10.1016/s1535-6108(02)00081-8. [DOI] [PubMed] [Google Scholar]
  14. Hahn CN, Chong CE, Carmichael CL, Wilkins EJ, Brautigan PJ, Li XC, Babic M, Lin M, Carmagnac A, Lee YK, et al. Heritable GATA2 mutations associated with familial myelodysplastic syndrome and acute myeloid leukemia. Nat Genet. 2011;43:1012–1017. doi: 10.1038/ng.913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Jaiswal S, Fontanillas P, Flannick J, Manning A, Grauman PV, Mar BG, Lindsley RC, Mermel CH, Burtt N, Chavez A, et al. Age-related clonal hematopoiesis associated with adverse outcomes. N Engl J Med. 2014;371:2488–2498. doi: 10.1056/NEJMoa1408617. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Jan M, Snyder TM, Corces-Zimmerman MR, Vyas P, Weissman IL, Quake SR, Majeti R. Clonal evolution of preleukemic hematopoietic stem cells precedes human acute myeloid leukemia. Science translational medicine. 2012;4:149ra118. doi: 10.1126/scitranslmed.3004315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kerbauy DB, Deeg HJ. Apoptosis and antiapoptotic mechanisms in the progression of myelodysplastic syndrome. Exp Hematol. 2007;35:1739–1746. doi: 10.1016/j.exphem.2007.09.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kim J, Hoffman JP, Alpaugh RK, Rhim AD, Reichert M, Stanger BZ, Furth EE, Sepulveda AR, Yuan CX, Won KJ, et al. An iPSC line from human pancreatic ductal adenocarcinoma undergoes early to invasive stages of pancreatic cancer progression. Cell reports. 2013;3:2088–2099. doi: 10.1016/j.celrep.2013.05.036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kim J, Zaret KS. Reprogramming of human cancer cells to pluripotency for models of cancer progression. The EMBO journal. 2015;34:739–747. doi: 10.15252/embj.201490736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kotini AG, Chang CJ, Boussaad I, Delrow JJ, Dolezal EK, Nagulapally AB, Perna F, Fishbein GA, Klimek VM, Hawkins RD, et al. Functional analysis of a chromosomal deletion associated with myelodysplastic syndromes using isogenic human induced pluripotent stem cells. Nat Biotechnol. 2015;33:646–655. doi: 10.1038/nbt.3178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Link DC, Walter MJ. ‘CHIP’ping away at clonal hematopoiesis. Leukemia. 2016;30:1633–1635. doi: 10.1038/leu.2016.130. [DOI] [PubMed] [Google Scholar]
  22. Martincorena I, Campbell PJ. Somatic mutation in cancer and normal cells. Science. 2015;349:1483–1489. doi: 10.1126/science.aab4082. [DOI] [PubMed] [Google Scholar]
  23. Ng ES, Davis R, Stanley EG, Elefanty AG. A protocol describing the use of a recombinant protein-based, animal product-free medium (APEL) for human embryonic stem cell differentiation as spin embryoid bodies. Nat Protoc. 2008;3:768–776. doi: 10.1038/nprot.2008.42. [DOI] [PubMed] [Google Scholar]
  24. Notta F, Zandi S, Takayama N, Dobson S, Gan OI, Wilson G, Kaufmann KB, McLeod J, Laurenti E, Dunant CF, et al. Distinct routes of lineage development reshape the human blood hierarchy across ontogeny. Science. 2016;351:aab2116. doi: 10.1126/science.aab2116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Pandolfi A, Barreyro L, Steidl U. Concise review: preleukemic stem cells: molecular biology and clinical implications of the precursors to leukemia stem cells. Stem cells translational medicine. 2013;2:143–150. doi: 10.5966/sctm.2012-0109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Papaemmanuil E, Gerstung M, Bullinger L, Gaidzik VI, Paschka P, Roberts ND, Potter NE, Heuser M, Thol F, Bolli N, et al. Genomic Classification and Prognosis in Acute Myeloid Leukemia. N Engl J Med. 2016;374:2209–2221. doi: 10.1056/NEJMoa1516192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Papaemmanuil E, Gerstung M, Malcovati L, Tauro S, Gundem G, Van Loo P, Yoon CJ, Ellis P, Wedge DC, Pellagatti A, et al. Clinical and biological implications of driver mutations in myelodysplastic syndromes. Blood. 2013;122:3616–3627. doi: 10.1182/blood-2013-08-518886. quiz 3699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Papapetrou EP. Patient-derived induced pluripotent stem cells in cancer research and precision oncology. Nat Med. 2016;22:1392–1401. doi: 10.1038/nm.4238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Papapetrou EP, Lee G, Malani N, Setty M, Riviere I, Tirunagari LM, Kadota K, Roth SL, Giardina P, Viale A, et al. Genomic safe harbors permit high beta-globin transgene expression in thalassemia induced pluripotent stem cells. Nat Biotechnol. 2011;29:73–78. doi: 10.1038/nbt.1717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Papapetrou EP, Sadelain M. Generation of transgene-free human induced pluripotent stem cells with an excisable single polycistronic vector. Nat Protoc. 2011;6:1251–1273. doi: 10.1038/nprot.2011.374. [DOI] [PubMed] [Google Scholar]
  31. Papapetrou EP, Tomishima MJ, Chambers SM, Mica Y, Reed E, Menon J, Tabar V, Mo Q, Studer L, Sadelain M. Stoichiometric and temporal requirements of Oct4, Sox2, Klf4, and c-Myc expression for efficient human iPSC induction and differentiation. Proc Natl Acad Sci U S A. 2009;106:12759–12764. doi: 10.1073/pnas.0904825106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Pellagatti A, Cazzola M, Giagounidis A, Perry J, Malcovati L, Della Porta MG, Jadersten M, Killick S, Verma A, Norbury CJ, et al. Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells. Leukemia. 2010;24:756–764. doi: 10.1038/leu.2010.31. [DOI] [PubMed] [Google Scholar]
  33. Sanjuan-Pla A, Macaulay IC, Jensen CT, Woll PS, Luis TC, Mead A, Moore S, Carella C, Matsuoka S, Bouriez Jones T, et al. Platelet-biased stem cells reside at the apex of the haematopoietic stem-cell hierarchy. Nature. 2013;502:232–236. doi: 10.1038/nature12495. [DOI] [PubMed] [Google Scholar]
  34. Sato T, Kim S, Selleri C, Young NS, Maciejewski JP. Measurement of secondary colony formation after 5 weeks in long-term cultures in patients with myelodysplastic syndrome. Leukemia. 1998;12:1187–1194. doi: 10.1038/sj.leu.2401084. [DOI] [PubMed] [Google Scholar]
  35. Shlush LI, Zandi S, Mitchell A, Chen WC, Brandwein JM, Gupta V, Kennedy JA, Schimmer AD, Schuh AC, Yee KW, et al. Identification of pre-leukaemic haematopoietic stem cells in acute leukaemia. Nature. 2014;506:328–333. doi: 10.1038/nature13038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Sperling AS, Gibson CJ, Ebert BL. The genetics of myelodysplastic syndrome: from clonal haematopoiesis to secondary leukaemia. Nat Rev Cancer. 2017;17:5–19. doi: 10.1038/nrc.2016.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Steensma DP, Bejar R, Jaiswal S, Lindsley RC, Sekeres MA, Hasserjian RP, Ebert BL. Clonal hematopoiesis of indeterminate potential and its distinction from myelodysplastic syndromes. Blood. 2015;126:9–16. doi: 10.1182/blood-2015-03-631747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102:15545–15550. doi: 10.1073/pnas.0506580102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Themeli M, Kloss CC, Ciriello G, Fedorov VD, Perna F, Gonen M, Sadelain M. Generation of tumor-targeted human T lymphocytes from induced pluripotent stem cells for cancer therapy. Nat Biotechnol. 2013;31:928–933. doi: 10.1038/nbt.2678. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Valk PJ, Verhaak RG, Beijen MA, Erpelinck CA, Barjesteh van Waalwijk van Doorn-Khosrovani S, Boer JM, Beverloo HB, Moorhouse MJ, van der Spek PJ, Lowenberg B, et al. Prognostically useful gene-expression profiles in acute myeloid leukemia. N Engl J Med. 2004;350:1617–1628. doi: 10.1056/NEJMoa040465. [DOI] [PubMed] [Google Scholar]
  41. Vo LT, Daley GQ. De novo generation of HSCs from somatic and pluripotent stem cell sources. Blood. 2015;125:2641–2648. doi: 10.1182/blood-2014-10-570234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Walter MJ, Shen D, Ding L, Shao J, Koboldt DC, Chen K, Larson DE, McLellan MD, Dooling D, Abbott R, et al. Clonal architecture of secondary acute myeloid leukemia. N Engl J Med. 2012;366:1090–1098. doi: 10.1056/NEJMoa1106968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Walter MJ, Shen D, Shao J, Ding L, White BS, Kandoth C, Miller CA, Niu B, McLellan MD, Dees ND, et al. Clonal diversity of recurrently mutated genes in myelodysplastic syndromes. Leukemia. 2013 doi: 10.1038/leu.2013.58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Will B, Zhou L, Vogler TO, Ben-Neriah S, Schinke C, Tamari R, Yu Y, Bhagat TD, Bhattacharyya S, Barreyro L, et al. Stem and progenitor cells in myelodysplastic syndromes show aberrant stage-specific expansion and harbor genetic and epigenetic alterations. Blood. 2012;120:2076–2086. doi: 10.1182/blood-2011-12-399683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Wlodarski MW, Hirabayashi S, Pastor V, Stary J, Hasle H, Masetti R, Dworzak M, Schmugge M, van den Heuvel-Eibrink M, Ussowicz M, et al. Prevalence, clinical characteristics, and prognosis of GATA2-related myelodysplastic syndromes in children and adolescents. Blood. 2016;127:1387–1397. doi: 10.1182/blood-2015-09-669937. quiz 1518. [DOI] [PubMed] [Google Scholar]
  46. Woll PS, Kjallquist U, Chowdhury O, Doolittle H, Wedge DC, Thongjuea S, Erlandsson R, Ngara M, Anderson K, Deng Q, et al. Myelodysplastic syndromes are propagated by rare and distinct human cancer stem cells in vivo. Cancer Cell. 2014;25:794–808. doi: 10.1016/j.ccr.2014.03.036. [DOI] [PubMed] [Google Scholar]
  47. Woolthuis CM, Park CY. Hematopoietic stem/progenitor cell commitment to the megakaryocyte lineage. Blood. 2016;127:1242–1248. doi: 10.1182/blood-2015-07-607945. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Xie M, Lu C, Wang J, McLellan MD, Johnson KJ, Wendl MC, McMichael JF, Schmidt HK, Yellapantula V, Miller CA, et al. Age-related mutations associated with clonal hematopoietic expansion and malignancies. Nat Med. 2014;20:1472–1478. doi: 10.1038/nm.3733. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
2

RESOURCES