Skip to main content
Chinese Medical Journal logoLink to Chinese Medical Journal
. 2017 Mar 5;130(5):566–573. doi: 10.4103/0366-6999.200550

Endometrial MicroRNA Signature during the Window of Implantation Changed in Patients with Repeated Implantation Failure

Cheng Shi 1, Huan Shen 1, Li-Juan Fan 1, Jing Guan 1, Xin-Bang Zheng 1, Xi Chen 1, Rong Liang 1, Xiao-Wei Zhang 2, Qing-Hua Cui 3, Kun-Kun Sun 4, Zhu-Ran Zhao 5, Hong-Jing Han 1,✉
PMCID: PMC5339930  PMID: 28229988

Abstract

Background:

At present, a diagnostic tool with high specificity for impaired endometrial receptivity, which may lead to implantation failure, remains to be developed. We aimed to assess the different endometrial microRNA (miRNA) signatures for impaired endometrial receptivity by microarray analysis.

Methods:

A total of 12 repeated implantation failure (RIF) patients and 10 infertile patients, who conceived and delivered after one embryo transfer attempt, were recruited as RIF and control groups, respectively. Endometrial specimens from the window of implantation (WOI) were collected from these two groups. MiRNA microarray was conducted on seven and five samples from the RIF and control groups, respectively. Comparative, functional, and network analyses were performed for the microarray results. Quantitative real-time polymerase chain reaction (PCR) was performed on other samples to validate the expression of specific miRNAs.

Results:

Compared with those in the control group, the expression levels of 105 miRNAs in the RIF group were found to be significantly up- or down-regulated (at least 2-fold) by microarray analysis. The most relevant miRNA functional sets of these dysregulated miRNAs were miR-30 family, human embryonic stem cell regulation, epithelial-mesenchymal transition, and miRNA tumor suppressors by tool for annotations of microRNA analysis. Network regulatory analysis found 176 miRNA-mRNA interactions, and the top 3 core miRNAs were has-miR-4668-5p, has-miR-429, and has-miR-5088. Expression levels of the 18 selected miRNAs in new samples by real-time PCR were found to be regulated with the same trend, as the result of microarray analysis.

Conclusions:

There is a significant different expression of certain miRNAs in the WOI endometrium for RIF patients. These miRNAs may contribute to impaired endometrial receptivity.

Keywords: Embryo Implantation, Endometrial Receptivity, MicroRNA Microarray, Repeated Implantation Failure, Window of Implantation

Introduction

In the past three decades, since the first “test tube baby”, Louise Brown, was born in 1978, in vitro fertilization-embryo transfer (IVF-ET) has experienced rapid and momentous development. However, the pregnancy rate of IVF-ET remains relatively low up to now.[1] Only approximately 30% of the embryos transferred into the uterus lead to a successful pregnancy.[2] Successful implantation depends on the embryo's quality, embryo-endometrium interaction, and endometrial receptivity, of which inadequate endometrial receptivity is responsible for approximately two-thirds of implantation failures.[3,4,5]

The term, “endometrial receptivity”, is introduced to define the state of the endometrium during the window of implantation (WOI), which onsets 4–5 days after the endogenous/exogenous progesterone stimulation and ends 9–10 days afterward.[6] During this period, the endometrium acquires new adhesive properties allowing embryo adhesion and subsequent invasion.[7] Given its key role in successful implantation, predicting and improving endometrial receptivity is critical and may ultimately improve the pregnancy success rate of IVF-ET.[8] Unfortunately, no effective diagnostic tools are yet available to precisely predict endometrial receptivity.[9]

MicroRNAs (miRNAs) are small RNA fragments (18–25 nucleotides) that act as posttranscriptional regulators of various gene targets (either negatively or positively) rather than encoding proteins themselves.[10] miRNAs play a role in some biological processes, such as cellular differentiation, proliferation, and apoptosis, which are involved in implantation.[11,12,13] Therefore, several studies have been conducted to explore their role in endometrial receptivity. The miRNA expression profiles in human endometrium at different phases have been previously investigated. Kuokkanen et al.[14] studied the mRNA and miRNA profiles of fertile women's endometrial epithelial cells in the late proliferative and mid-secretory phases, respectively. They found that miRNA played a role in influencing endometrial receptivity through regulating the relevant genes’ expression. Altmäe et al.[15] compared the miRNA profile of prereceptive (LH+2) and receptive endometrium (LH+7) from fertile, nonstimulated women and revealed miR-30b, miR-30d, and miR-494's roles in regulating endometrium receptivity. Revel's study[16] showed the different miRNA profiles of the secretory endometrium between patients with repeated implantation failure (RIF) and fertile women. These data have clearly demonstrated that miRNA expression profiles of different populations/stages may differ and therefore should be applied in the diagnosis of endometrial receptivity, but further investigation is required due to study limitations.

Despite its diverse definitions, RIF is generally defined as failure to achieve a clinical pregnancy after transferring at least four good-quality embryos in at least three fresh or frozen cycles.[17] We hypothesized that the endometrial receptivity of RIF patients is low, while that of infertile women, who conceived after only one embryo transfer attempt, is high. The aim of this study was to identify the different miRNA expression profiles between these two populations, which may further provide a good predictor for helping to differentiate the discrepant endometrial receptivity.

Methods

Patients

A total of 22 female infertile patients were enrolled in this study. Twelve patients (numbered RIF1–RIF12), who all had a history of RIF, participated in the study group (RIF group). These participants had previously received in vitro fertilization/intracytoplasmic sperm injection (IVF/ICSI) treatment and had suffered at least three embryo transfer failures, in which at least four morphologically high-grade embryos were transferred in total. Further, in this group, there were no other obvious explanations for their RIFs, such as polycystic ovary syndrome, ovarian tumors, polyps, fibroids, endometriosis, hydrosalpinx, adenomyosis, and uterine malformation. Ten infertile patients (due to male infertility, tubal factors, or unexplained infertility; numbered C1–C10), who conceived and delivered after the first attempt of embryo transfer, were recruited as the control group.

Inclusion criteria for all participants were age <40 years; regular menstrual cycles; normal uterine cavity confirmed by hysteroscopy, and more specifically, without intrauterine adhesions or inflammation; endometrial thickness in the late follicular phase of ≥7 mm in ultrasonography; normal ovarian reserve (follicle-stimulating hormone <9.6 mU/ml);[18] a normal ovarian response to the stimulation protocol (>8 oocytes retrieved in a controlled ovary hyperstimulation cycle); and no hormone (estradiol/progesterone) applied during the endometrial biopsy cycle.

The study was approved by the Institutional Review Board at Peking University People's Hospital (No. 2011-87) and all participants signed written informed consent.

Endometrial biopsy specimens

Endometrial biopsies were performed by dilation and curettage during hysteroscopy, 5–7 days after ovulation. Ovulation was determined according to ultrasound combined with morning urine LH detection. Endometrial tissue was immediately sent to the laboratory to make sure it was processed within 1 h after the biopsy. Each sample was divided into two portions: one of which was fixed in 10% formalin and processed for histological evaluation (hematoxylin-eosin [H-E]); the second portion was frozen at −80°C for subsequent RNA extraction.

MicroRNA extraction and purifying

Total RNA was isolated from endometrial specimens using Trizol reagent (Invitrogen, USA) following the suppliers’ protocol, and miRNA was then purified using the mirVan miRNA Isolation Kit (AM1561, Ambion, USA) according to the manufacturer's instructions. The purity and concentration of RNA was determined by OD260/280 from a spectrophotometer (NanoDrop, ND-1000). The RNA integrity was examined by 1% formaldehyde denaturing gel electrophoresis. RNA with an OD260/280 between 1.8 and 2.0 and no degradation by electrophoresis was considered of good-quality and was included in further experiments.

MicroRNA array and microarray experiments

The transcription analysis of miRNA was performed using an miRNA Array (ID: 046064, Agilent, USA), which contains probes interrogating 2006 human mature miRNAs from miRBase R19.0 and 2164 Agilent control probes.

The miRNA microarray experiments were conducted according to the manufacturer's instructions for the miRNA Complete Labeling and Hyb Kit (Agilent). Then, 200 ng isolated RNA per sample was dephosphorylated and ligated with Cyanine3-pCp, and the labeled RNA was purified and hybridized to miRNA arrays. Images were scanned using the Agilent microarray scanner (G2565CA, Agilent). The arrays were then gridded and analyzed using Agilent Feature Extraction software version 10.10 (Agilent).

Microarray data analysis

The miRNA array data were analyzed for data summarization, normalization, and quality control using GeneSpring software version 13.0 (Agilent). The significance (P value) of the normalized value for raw data from each sample of the RIF and control group was calculated by an unpaired t-test and then corrected by the Benjamini-Hochberg method. The fold change was also calculated using the normalized value of the raw data. Two criteria were used to select the differentially expressed genes: a fold change ≥2 and a P < 0.05. To reduce the false discovery rate of genes, we excluded from our analysis miRNAs whose expression was detected in less than three samples in either the RIF or control groups. Furthermore, we adjusted the threshold to 5- and 10-fold changes to disclose miRNAs whose expression levels were more significantly different between the two groups.

Supervised hierarchical clustering with average linkage clustering analysis was further carried out on these differentially expressed miRNAs using Cluster version 3.0 software and Java Treeview (Stanford University School of Medicine, Stanford, CA, USA) to visually assess the differentially expressed miRNA profiles of the RIF and control groups.

Functional analysis of differentially expressed microRNAs

To discover the patterns and rules of the differentially expressed miRNAs, functional enrichment analysis was performed using tool for annotations of microRNAs (TAM) software (http://www.cuilab.cn/tam).

TAM, the tool for annotations of human miRNAs, is a web-accessible program that integrates miRNAs into different sets according to various rules and provides us with functions of interested miRNAs. Currently, TAM collects 238 miRNA sets, which include 413 distinct miRNAs.[19]

Regulatory network analysis of differentially expressed microRNAs and mRNAs

Based on the idea that miRNAs reduce, at least partially, the expression of targeted mRNAs, we constructed the miRNA-mRNA regulatory network of these differentially expressed miRNAs and those differentially expressed mRNAs we found from mRNA microarray study on the same samples. To improve the quality of prediction, the regulatory relationships were predicted by combining four existing algorithms: TargetScan, miRanda, Pictar, and DIANA, which were implemented with a Bioconductor package (http://bioconductor.org/), miRNAtap, in the R software environment (http://www.r-project.org). The diagram of the network was generated by Cytoscape.

Validation of the microarray data by quantitative real-time polymerase chain reaction

To validate our microarray findings, 10 new samples consisting of 5 from the RIF group (RIF8, RIF9, RIF10, RIF11, and RIF12) and 5 from the control group (C6, C7, C8, C9, and C10) were used to assess the expression of some miRNAs by quantitative real-time polymerase chain reaction (PCR). We selected miRNAs with a high-fold change and/or miRNAs reported in other similar literature before performing the validation. The names of the selected miRNAs and the corresponding primer sequences are listed in Supplementary Table S1.

Supplementary Table S1.

Sequences of miRNAs primers used for real-time PCR amplification

Primers miRNAs
F: ATAATACAACCTGATAAGTG hsa-miR-374a-5p
F: GTCCAGTTTTCCCAGGAATCCC hsa-miR-145-5p
F: GTAAACATCCTACACTCAGC hsa-miR-30b-5p
F: TAGGTAGTTTCCTGTTGTTGGG hsa-miR-196b-5p
F: CCCAGTGTTCAGACTACCTGTTC hsa-miR-199a-5p
F: CCCAGTGTTTAGACTATCTGTTC hsa-miR-199b-5p
F: TGGCAGTGTATTGTTAGCTGGT hsa-miR-449a
F: CAGCAGCAATTCATGTTTT hsa-miR-424-5p
F: TCCCTGAGACCCTTTAACCTGTG hsa-miR-125b-5p
F: TAGCTTATCAGACTGATGTTG hsa-miR-21-5p
F: TGGCAGGGAGGCTGGGAG hsa-miR-1207-5p
F: TGGAGAGAAAGGCAGTAA hsa-miR-4306
F: CGCTCGGCGGTGGC hsa-miR-572
F: GCGGAGAGAGAATGGGGAGC hsa-miR-5739
F: AGAGATGAAGCGGGGGGG hsa-miR-6088
F: AGGGAAAAAAAAAAGGATTTGTC hsa-miR-4668-5p
F: TAATACTGTCTGGTAAAACCGT hsa-miR-429
F: CAGGGCTCAGGGATTGGATG hsa-miR-5088-5p
F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
U6

miRNAs: MicroRNAs; PCR: Polymerase chain reaction.

We applied the poly(A) method to confirm the expression of miRNAs. After being purified with the mirVanaTM miRNA Isolation Kit (Applied Biosystems, USA), total RNA was used for the RT reaction to generate the first strand cDNA using the miRcute miRNA cDNA First-Strand reverse transcription mixture (KR201). Quantitative real-time PCR was then performed according to the miRcute miRNA reverse transcription PCR (RT-PCR) protocol, using U6 as the housekeeping gene. The relative expression was calculated using 2−ΔΔCt method and analyzed with an unpaired t-test.

Results

Patients

The clinical characteristics of the two groups are listed in Table 1. There were no significant differences between the two groups in mean age, body mass index, length of menstrual cycle, menstrual duration, or endometrial thickness on the day of LH surge. Participants’ additional detailed clinical information is presented in Supplementary Table S2. The histological evaluation results for each sample reported normal mid-secretory endometrium. The micrograph of H-E staining for each sample was similar to that of RIF10 [Supplementary Figure S1 (108.5KB, tif) ].

Table 1.

Characteristics of the women undergoing endometrial biopsy sampling

Variables RIF group (n = 12) Control group (n = 10) t P
Age (years) 31.6 ± 4.1 32.1 ± 2.9 −0.33 0.74
BMI (kg/m2) 22.77 ± 2.63 21.70 ± 2.22 1.01 0.32
Cycle length (days) 30.83 ± 3.10 30.40 ± 4.34 0.27 0.79
Menses duration (days) 5.08 ± 0.90 5.05 ± 0.98 0.08 0.94
Endometrial thickness* (cm) 0.95 ± 0.23 0.97 ± 0.26 −0.19 0.85

Data were presented as mean ± SD. *Endometrial thickness: The thickness of the endometrium on the day when then biopsy was taken. BMI: Body mass index; RIF: Repeated implantation failure; SD: Standard deviation.

Supplementary Table S2.

More clinical information of the women undergoing endometrial biopsy sampling

Case number Age Cause of infertility Number of failed cycles IVF/ICSI Number of transferred embryos Number of high quality embryos Endometrial thickness on the day of LH surge Endometrial type on the day of LH surge The day of sample (post the day of LH surge)
RIF1 34 Tubal 11 ICSI 22 8 1 A +6
RIF2 33 Tubal 4 IVF 11 7 0.7 A +7
RIF3 38 Tubal 8 IVF 20 10 0.9 A +6
RIF4 23 Male 4 ICSI 11 9 0.9 A +8
RIF5 34 Unexplained 3 IVF 9 6 0.9 A +6
RIF6 31 Tubal 3 IVF 7 7 1.2 B +7
RIF7 28 Male 3 ICSI 7 6 1 A +6
RIF8 35 Male 3 ICSI 6 4 0.8 A +6
RIF9 32 Tubal 3 IVF 7 6 0.7 A +7
RIF10 32 Tubal 3 IVF 6 4 1.2 A +6
RIF11 33 Tubal 4 ICSI 8 4 1.0 A +7
RIF12 26 Male 4 IVF 9 4 0.7 A +8
C1 32 Unexplained 0 IVF 2 2 1.1 A +7
C2 35 Tubal 0 IVF 2 1 0.9 A +7
C3 29 Male 0 ICSI 2 2 1.1 A +8
C4 33 Unexplained 0 IVF 2 2 1.1 B +7
C5 26 Tubal 0 ICSI 2 1 1.2 A +7
C6 31 Male 0 IVF 2 2 0.9 A +7
C7 35 Male 0 ICSI 2 2 0.8 A +8
C8 35 Tubal 0 IVF 3 2 0.7 A +8
C9 33 Tubal 0 IVF 2 1 1.4 B +7
C10 32 Male 0 ICSI 2 2 1.2 A +7

The samples with case number marked by underline were used for real-time PCR and the other samples were used for microarray. IVF: In vitro fertilization; ICSI: Intracytoplasmic sperm injection; LH: Luteinizing hormone; PCR: Polymerase chain reaction.

Supplementary Figure S1

The micrograph of H and E dying for the sample of RIF10. The micrographs for the other 21 samples were similar to this, and all the reports were: normal mid-secretory endometrium. (a) Extreme glandular coiling secretory glands set within a spindled edematous stroma. Luminal secretion is most prominent (H and E, original magnification ×100). (b) The coiled spiral arteries are seen within an edematous stroma. Perivascular predecidual reaction has not occurred (H and E, original magnification ×200). RIF: Repeated implantation failure.

Results of microarray analysis

The miRNA array identified 105 microarray probes with expression levels in RIF patients that were 2-fold greater compared with those in the control group (93 upregulated and 12 downregulated). With a threshold of 5-fold and 10-fold changes, 70 (67 upregulated and 3 downregulated) and 49 (46 upregulated and 3 downregulated) miRNAs were identified, respectively [Table 2]. However, after the raw signal value correction (>50 for each sample), only 15 miRNAs were found to express in a significantly different way using 2-fold change as the threshold [Table 3]. All the differentially expressed genes are listed in Supplementary Table S3, and the raw data have been uploaded into the Gene Expression Omnibus database (number: GSE71332).

Table 2.

The number of differentially expressed miRNAs with different FCs*

RIF versus control Total dysregulated Upregulated Downregulated
FCs
 >2 105 93 12
 >5 70 67 3
 >10 49 46 3

*The criteria for differentially expressed genes were: a greater than 2-FC with a P<0.05 by an unpaired t-test. FCs: Fold changes; RIF: Repeated implantation failure; miRNA: MicroRNA.

Table 3.

List of the differentially expressed miRNAs between the RIF and control group with the microarray raw signal value of all samples >50

Systematic name FC Mirbase accession number
Upregulated miRNAs
 hsa-miR-374a-5p 7.74524 MIMAT0000727
 hsa-miR-145-5p 3.2018807 MIMAT0000437
 hsa-miR-30b-5p 2.9336023 MIMAT0000420
 hsa-miR-196b-5p 2.5407631 MIMAT0001080
 hsa-miR-199a-5p 2.5355365 MIMAT0000231
 hsa-miR-199b-5p 2.4879646 MIMAT0000263
 hsa-miR-449a 2.3427818 MIMAT0001541
 hsa-miR-424-5p 2.190957 MIMAT0001341
 hsa-miR-125b-5p 2.1353264 MIMAT0000423
 hsa-miR-21-5p 2.0441828 MIMAT0000076
Downregulated miRNAs
 hsa-miR-1207-5p 2.6758146 MIMAT0005871
 hsa-miR-4306 2.2878602 MIMAT0016858
 hsa-miR-572 2.0804768 MIMAT0003237
 hsa-miR-5739 2.1607096 MIMAT0023116
 hsa-miR-6088 2.1698172 MIMAT0023713

RIF: Repeated implantation failure; miRNAs: MicroRNAs; FC: Fold change.

Supplementary Table S3.

List of differentially expressed miRNAs

Systematic name FC Mirbase accession number
Upregulated miRNAs
 hsa-miR-186-5p 111.32307 MIMAT0000456
 hsa-miR-135b-5p 87.14255 MIMAT0000758
 hsa-miR-3125 76.56718 MIMAT0014988
 hsa-miR-136-5p 73.41167 MIMAT0000448
 hsa-miR-204-5p 72.42954 MIMAT0000265
 hsa-miR-3907 72.28242 MIMAT0018179
 hsa-miR-30d-3p 67.86486 MIMAT0004551
 hsa-miR-1288 66.41283 MIMAT0005942
 hsa-miR-371b-5p 59.9805 MIMAT0019892
 hsa-miR-374c-5p 53.332508 MIMAT0018443
 hsa-miR-32-5p 42.89187 MIMAT0000090
 hsa-miR-6512-5p 40.44899 MIMAT0025480
 hsa-miR-1914-3p 35.808 MIMAT0007890
 hsa-miR-205-5p 32.111767 MIMAT0000266
 hsa-miR-505-3p 29.47475 MIMAT0002876
 hsa-miR-7-1-3p 29.342558 MIMAT0004553
 hsa-miR-449b-5p 29.015373 MIMAT0003327
 hsa-miR-145-3p 28.210178 MIMAT0004601
 hsa-miR-4734 26.772724 MIMAT0019859
 hsa-miR-144-5p 25.90218 MIMAT0004600
 hsa-miR-9-5p 24.925808 MIMAT0000441
 hsa-miR-4690-5p 24.287247 MIMAT0019779
 hsa-miR-744-5p 19.679468 MIMAT0004945
 hsa-miR-4486 18.95102 MIMAT0019020
 hsa-miR-6132 18.29064 MIMAT0024616
 hsa-miR-149-5p 17.349735 MIMAT0000450
 hsa-miR-1307-5p 16.641792 MIMAT0022727
 hsa-miR-424-3p 16.024895 MIMAT0004749
 hsa-miR-4324 15.442569 MIMAT0016876
 hsa-miR-154-5p 14.907551 MIMAT0000452
 hsa-miR-10a-3p 14.901987 MIMAT0004555
 hsa-miR-141-5p 14.643423 MIMAT0004598
 hsa-miR-501-3p 14.513452 MIMAT0004774
 hsa-miR-1290 14.159889 MIMAT0005880
 hsa-miR-206 14.120981 MIMAT0000462
 hsa-miR-4257 13.665979 MIMAT0016878
 hsa-miR-3127-5p 13.506273 MIMAT0014990
 hsa-miR-375 13.398406 MIMAT0000728
 hsa-miR-3156-5p 13.002842 MIMAT0015030
 hsa-miR-598 11.697124 MIMAT0003266
 hsa-miR-5088 11.453611 MIMAT0021080
 hsa-miR-5096 11.370991 MIMAT0020603
 hsa-miR-4746-3p 11.153188 MIMAT0019881
 hsa-miR-4726-5p 11.049062 MIMAT0019845
 hsa-miR-4656 10.935905 MIMAT0019723
 hsa-miR-33a-5p 10.576019 MIMAT0000091
 hsa-let-7i-3p 9.9141245 MIMAT0004585
 hsa-miR-34c-3p 9.809227 MIMAT0004677
 hsa-miR-1285-3p 9.787075 MIMAT0005876
 hsa-miR-29c-5p 9.758672 MIMAT0004673
 hsa-miR-16-2-3p 9.330457 MIMAT0004518
 hsa-miR-142-3p 8.779017 MIMAT0000434
 hsa-miR-34a-3p 8.748133 MIMAT0004557
 hsa-miR-4695-5p 8.440075 MIMAT0019788
 hsa-miR-193a-5p 7.9020715 MIMAT0004614
 hsa-miR-374a-5p 7.74524 MIMAT0000727
 hsa-miR-182-5p 7.1148996 MIMAT0000259
 hsa-miR-203a 6.915573 MIMAT0000264
 hsa-miR-301b 6.900287 MIMAT0004958
 hsa-miR-450a-5p 6.619105 MIMAT0001545
 hsa-miR-6131 6.455001 MIMAT0024615
 hsa-miR-887 6.105473 MIMAT0004951
 hsa-miR-19b-1-5p 6.0583606 MIMAT0004491
 hsa-miR-590-5p 5.9550056 MIMAT0003258
 hsa-miR-200c-5p 5.630886 MIMAT0004657
 hsa-miR-214-5p 5.396898 MIMAT0004564
 hsa-miR-30e-3p 5.378995 MIMAT0000693
 hsa-miR-218-5p 4.7786775 MIMAT0000275
 hsa-miR-423-3p 4.703984 MIMAT0001340
 hsa-miR-455-5p 4.035282 MIMAT0003150
 hsa-miR-30c-5p 3.5054796 MIMAT0000244
 hsa-miR-1260b 3.3699887 MIMAT0015041
 hsa-miR-145-5p 3.2018807 MIMAT0000437
 hsa-miR-362-3p 3.0494413 MIMAT0004683
 hsa-miR-374b-5p 3.0005975 MIMAT0004955
 hsa-miR-30b-5p 2.9336023 MIMAT0000420
 hsa-miR-429 2.7092197 MIMAT0001536
 hsa-miR-4428 2.6921449 MIMAT0018943
 hsa-miR-196b-5p 2.5407631 MIMAT0001080
 hsa-miR-199a-5p 2.5355365 MIMAT0000231
 hsa-miR-199b-5p 2.4879646 MIMAT0000263
 hsa-miR-143-3p 2.4430275 MIMAT0000435
 hsa-miR-449a 2.3427818 MIMAT0001541
 hsa-miR-6717-5p 2.3069673 MIMAT0025846
 hsa-miR-301a-3p 2.30314 MIMAT0000688
 hsa-miR-424-5p 2.190957 MIMAT0001341
 hsa-miR-3653 2.1542947 MIMAT0018073
 hsa-miR-335-5p 2.1516027 MIMAT0000765
 hsa-miR-125b-5p 2.1353264 MIMAT0000423
 hsa-miR-1305 2.1121273 MIMAT0005893
 hsa-miR-365a-3p 2.0961003 MIMAT0000710
 hsa-miR-146b-5p 2.0629325 MIMAT0002809
 hsa-miR-21-5p 2.0441828 MIMAT0000076
Downregulated miRNAs
 hsa-miR-4668-5p 103.51767 MIMAT0019745
 hsa-miR-4254 14.588222 MIMAT0016884
 hsa-miR-4701-5p 13.288958 MIMAT0019798
 hsa-miR-134 2.7737036 MIMAT0000447
 hsa-miR-1207-5p 2.6758146 MIMAT0005871
 hsa-miR-4306 2.2878602 MIMAT0016858
 hsa-miR-3162-3p 2.2871423 MIMAT0019213
 hsa-miR-4788 2.2722929 MIMAT0019958
 hsa-miR-6088 2.1698172 MIMAT0023713
 hsa-miR-5739 2.1607096 MIMAT0023116
 hsa-miR-6165 2.133992 MIMAT0024782
 hsa-miR-572 2.0804768 MIMAT0003237

miRNAs: MicroRNAs; FC: Fold change.

In terms of the supervised hierarchical clustering analysis, the dendrograms showed satisfying segregation of the gene expression levels for samples from the two groups, based on the differentially expressed miRNAs [Figure 1]. The first branch in the miRNA heat maps was able to differentiate samples from the RIF group and the control group. This finding suggested a diverse miRNA expression profile for WOI endometrium between RIF patients and those who conceived after their first attempt of IVF/ICSI.

Figure 1.

Figure 1

Dendrogram and hierarchical clustering. Expression data from all the differentially expressed miRNAs are analyzed. Each row presents one gene and each column represents an endometrial sample. Column RIF1, RIF2, RIF3, RIF4, RIF5, RIF6, and RIF7 are RIF samples and column C1, C2, C3, C4, and C5 are control samples. Up- and down-regulated miRNAs are, respectively, indicated by yellow and blue, and miRNAs that are lack of significant change are indicated by black. miRNA: MicroRNA; RIF: Repeated implantation failure.

Functional analysis of differentially expressed microRNAs

TAM analysis was used to gain an in-depth understanding of the biological functions of the differentially expressed miRNAs. According to the TAM analysis results, mir-30 family, human embryonic stem cell regulation, epithelial-mesenchymal transition, and miRNA tumor suppressors were the most relevant miRNA functional sets [Figure 2].

Figure 2.

Figure 2

Results of the tool for annotations of microRNA analysis for the deregulated miRNAs between the RIF and control endometrial samples. Mir-30 family, human embryonic stem cell regulation and epithelial-mesenchymal transition were the top 3 relevant miRNA functional sets. miRNA: MicroRNA; RIF: Repeated implantation failure.

Construction of a regulatory network of differentially expressed microRNAs and mRNAs

The relationships between the dysregulated miRNAs and mRNAs were predicted by network regulatory analysis software. A total of 176 interactions between miRNAs and mRNAs were found, of which 122 were for upregulated miRNAs and downregulated mRNAs and 54 were for downregulated miRNAs and upregulated mRNAs. The top core mRNA was ABP1, which was regulated by 13 miRNAs, followed by AQP3, ASS1, and TIMP3 (regulated by 6 miRNAs). The top core miRNA was has-miR-4668-5p, which regulated 14 mRNAs, followed by has-miR-429 and has-miR-5088 (which regulated 9 mRNAs) [Figure 3].

Figure 3.

Figure 3

The layout of the miRNA-mRNA regulatory network. The network consists of 54 regulations (a) between downregulated miRNAs to upregulated mRNAs and 122 regulations (b) between upregulated miRNAs to downregulated mRNAs. A diamond marks miRNA and a rectangle marks the mRNA. An edge represents a regulation from miRNA to one of its targets. The miRNAs and mRNAs are colored based on their dysregulation pattern. If the miRNAs (or mRNAs) are upregulated in the RIF group, the nodes are marked by gray, otherwise they are marked by white. miRNA: MicroRNA; RIF: Repeated implantation failure.

Validation of microRNA expression using quantitative reverse transcription polymerase chain reaction

To validate the differences in transcript levels found in the microarrays, a selected set of miRNAs was chosen for quantitative RT-PCR. New endometrial samples from the RIF group (n = 5; RIF8, RIF9, RIF10, RIF11, and RIF12) and control group (n = 5; C6, C7, C8, C9, and C10) were used for this validation.

Selection for validated miRNAs was done according to the following criteria: (i) miRNAs, the raw signal for each sample in the miRNA microarray analysis was >50 and was differentially up- or down-regulated in samples from the RIF group compared with the control group; and (ii) miRNAs that were in the core mRNA-miRNA network results. The RT-PCR results were in agreement with that of the microarray for all miRNAs: hsa-miR-374a-5p, hsa-miR-145-5p, hsa-miR-30b-5p, hsa-miR-196b-5p, hsa-miR-199a-5p, hsa-miR-199b-5p, hsa-miR-449a, hsa-miR-424-5p, hsa-miR-125b-5p, and hsa-miR-21-5p were elevated and hsa-miR-1207-5p, hsa-miR-4306, hsa-miR-572, hsa-miR-5739, hsa-miR-6088, hsa-miR-4668-5p, hsa-miR-429, and hsa-miR-5088 were reduced in the RIF group compared with the control group [Figure 4].

Figure 4.

Figure 4

Validation of miRNAs by real-time PCR in new samples (RIF, n = 5; control, n = 5). Relative levels of the transcripts for the selected 18 miRNAs in the RIF group as compared to the control group are shown. The dysregulation pattern of all the selected miRNAs by real-time PCR is coincident with that by microarray. *P < 0.05, vs. control group. miRNA: MicroRNA; RIF: Repeated implantation failure; PCR: Polymerase chain reaction.

Discussion

Until now, an objective diagnosis of endometrial receptivity remained neglected, which limited the improvement of clinical IVF/ICSI success from the endometrial perspective. Therefore, we used a microarray technique to investigate the miRNA profile of women with RIF compared to women who conceived after their first attempt of embryo transfer. We found that 105 differentially expressed miRNAs could result in two distinct groups by hierarchical clustering: RIF endometrium and the control group endometrium.

Previous research using a miRNA microarray to study endometrial receptivity can be generally grouped into two categories: (i) to compare the dynamic genomic expression profiles of endometrium from the proliferative phase to the WOI in fertile women; and (ii) to investigate the differential genomic expression profiles between fertile and infertile women.

In the first category, 4 studies have been reported. Has-miR-30b, has-miR-30d, and has-miR-494 were considered to play important roles in regulating endometrial receptivity. Compared with the prereceptive endometrium, hsa-miR-30b and hsa-miR-30d were found to be significantly upregulated and hsa-miR-494 was found to be downregulated in receptive endometrium.[15] In our study, hsa-miR-30b was also found to be upregulated in the RIF group. It is indicated that the destroyed endometrial receptivity of RIF patients was related to miRNAs other than hsa-miR-30b.

For the second category, only one study by Revel et al.[16] was reported, which found 13 deregulated miRNAs (1 were upregulated and 12 were downregulated). Different microarray platforms contributed mostly to the coincidence of the numbers of dysregulated miRNAs between our results and results of Ariel Revel's study. The miRNA Array card we used contained 2006 mature human miRNAs while the card Revel's group used only contained 381 mature human miRNAs. However, we also obtained two shared deregulated miRNAs: hsa-miR-145 and has-miR-374, which were both upregulated in the RIF patients in our study. ERα, mucin1 and RTKN, which play important roles in the acquisition of endometrial receptivity, have been validated to be the target genes of has-miR-145. In Revel's study, they thought that upregulated hsa-miR-145 might destroy endometrial receptivity in RIF patients by reducing endometrial ERα and mucin1 expression, which was also validated by Western-blot as downregulated.[16] In our study, we also detected the expression of mucin1, ERα, and RTKN by RT-PCR in the WOI endometrium from the two groups. Unexpectedly, ERα and RTKN were found to be upregulated in our RIF group, while mucin1 presented with a similar expression levels in both of our groups. Such a result may due to our small sample size (i.e., bias) or by has-miR-145 impairing the endometrial receptivity via regulating the expression of other target genes. Hsa-miR-374, located on chromosome Xq13.2, has been previously shown to constitutively activate Wnt/b-catenin signaling,[20] which has been reported to participate in the implantation process in several studies.[21,22]

Since miRNAs act as the post-transcriptional regulators of mRNA, usually negatively, we created a regulatory network of differentially expressed mRNAs and miRNAs and found 176 regulated pairs. The top 3 core miRNAs were has-miR-4668-5p, has-miR-429, and has-miR-5088, of which has-miR-4668-5p was downregulated, while has-miR-429 and has-miR-5088 were upregulated in the RIF group. The targeted mRNAs of has-miR-429 and has-miR-5088, DPP4, SERPING1, and AQP3 were validated to be downregulated in the new RIF samples in our previous report. These results indicated that the endometrial receptivity of RIF patients may be impacted by the expression of these mRNAs, which were regulated by specific miRNAs. Hence, we should pay more attention to miRNAs in future studies, which may shed some light on potential treatment for RIF.

In conclusion, we performed miRNA microarray on the samples from the RIF and control groups. Differentially expressed miRNAs were found and analyzed for their role in the establishment of endometrial receptivity. We found that has-miR-145, hsa-miR-374, hsa-miR-4668-5p, hsa-miR-429, and hsa-miR-5088 may be relevant to the low endometrial receptivity of RIF patients. We hypothesize that an array including miRNAs may increase the specificity for diagnosing the endometrial receptivity of patients with RIF, and our report provides clues to this diagnostic tool.

Financial support and sponsorship

This work was supported by grants from the Peking University People's Hospital Research and Development Funds (No. RDU2011-04 and No. RDC2014-07).

Conflicts of interest

There are no conflicts of interest.

Acknowledgment

The authors would like to thank CapitalBio Corp., (Beijing, China) for the microarray service and also would like to thank Dr. Li Jiang for language editing.

Supplementary information is linked to the online version of the paper on the Chinese Medical Journal website.

Footnotes

Edited by: Li-Shao Guo

References

  • 1.Kupka MS, Ferraretti AP, de Mouzon J, Erb K, D’Hooghe T, Castilla JA, et al. Assisted reproductive technology in Europe 2010: Results generated from European registers by ESHREdagger. Hum Reprod. 2014;29:2099–113. doi: 10.1093/humrep/deu175. doi: 10.1093/humrep/deu175. [DOI] [PubMed] [Google Scholar]
  • 2.Stern JE, Cedars MI, Jain T, Klein NA, Beaird CM, Grainger DA, et al. Assisted reproductive technology practice patterns and the impact of embryo transfer guidelines in the United States. Fertil Steril. 2007;88:275–82. doi: 10.1016/j.fertnstert.2006.09.016. doi: 10.1016/j.fertnstert.2006.09.016. [DOI] [PubMed] [Google Scholar]
  • 3.Koler M, Achache H, Tsafrir A, Smith Y, Revel A, Reich R. Disrupted gene pattern in patients with repeated in vitro fertilization (IVF) failure. Hum Reprod. 2009;24:2541–8. doi: 10.1093/humrep/dep193. doi: 10.1093/humrep/dep193. [DOI] [PubMed] [Google Scholar]
  • 4.Dessolle L, Daraï E, Cornet D, Rouzier R, Coutant C, Mandelbaum J, et al. Determinants of pregnancy rate in the donor oocyte model: A multivariate analysis of 450 frozen-thawed embryo transfers. Hum Reprod. 2009;24:3082–9. doi: 10.1093/humrep/dep303. doi: 10.1093/humrep/dep303. [DOI] [PubMed] [Google Scholar]
  • 5.Liu SM, Zhou YZ, Wang HB, Sun ZY, Zhen JR, Shen K, et al. Factors Associated with effectiveness of treatment and reproductive outcomes in patients with thin endometrium undergoing estrogen treatment. Chin Med J. 2015;128:3173–7. doi: 10.4103/0366-6999.170258. doi: 10.4103/0366-6999.170258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Rashid NA, Lalitkumar S, Lalitkumar PG, Gemzell-Danielsson K. Endometrial receptivity and human embryo implantation. Am J Reprod Immunol. 2011;66(Suppl 1):23–30. doi: 10.1111/j.1600-0897.2011.01048.x. doi: 10.1111/j.1600-0897. [DOI] [PubMed] [Google Scholar]
  • 7.Achache H, Revel A. Endometrial receptivity markers, the journey to successful embryo implantation. Hum Reprod Update. 2006;12:731–46. doi: 10.1093/humupd/dml004. doi: 10.1093/humupd/dml004. [DOI] [PubMed] [Google Scholar]
  • 8.Herrler A, von Rango U, Beier HM. Embryo-maternal signalling: How the embryo starts talking to its mother to accomplish implantation. Reprod Biomed Online. 2003;6:244–56. doi: 10.1016/s1472-6483(10)61717-8. [DOI] [PubMed] [Google Scholar]
  • 9.Altmäe S, Esteban FJ, Stavreus-Evers A, Simón C, Giudice L, Lessey BA, et al. Guidelines for the design, analysis and interpretation of ’ OMICS’ data: Focus on human endometrium. Hum Reprod Update. 2014;20:12–28. doi: 10.1093/humupd/dmt048. doi: 10.1093/humupd/dmt048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ambros V. MicroRNAs: Tiny regulators with great potential. Cell. 2001;107:823–6. doi: 10.1016/s0092-8674(01)00616-x. [DOI] [PubMed] [Google Scholar]
  • 11.Galliano D, Pellicer A. MicroRNA and implantation. Fertil Steril. 2014;101:1531–44. doi: 10.1016/j.fertnstert.2014.04.023. doi: 10.1016/j.fertnstert. [DOI] [PubMed] [Google Scholar]
  • 12.Yang C, Zheng SD, Wu HJ, Chen SJ. Regulatory mechanisms of the molecular pathways in fibrosis induced by microRNAs. Chin Med J. 2016;129:2365–72. doi: 10.4103/0366-6999.190677. doi: 10.4103/0366-6999.190677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Liu W, Niu Z, Li Q, Pang RT, Chiu PC, Yeung WS. MicroRNA and embryo implantation. Am J Reprod Immunol. 2016;75:263–71. doi: 10.1111/aji.12470. doi: 10.1111/aji.12470. [DOI] [PubMed] [Google Scholar]
  • 14.Kuokkanen S, Chen B, Ojalvo L, Benard L, Santoro N, Pollard JW. Genomic profiling of microRNAs and messenger RNAs reveals hormonal regulation in microRNA expression in human endometrium. Biol Reprod. 2010;82:791–801. doi: 10.1095/biolreprod.109.081059. doi: 10.1095/biolreprod.109.081059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Altmäe S, Martinez-Conejero JA, Esteban FJ, Ruiz-Alonso M, Stavreus-Evers A, Horcajadas JA, et al. MicroRNAs miR-30b, miR-30d, and miR-494 regulate human endometrial receptivity. Reprod Sci. 2013;20:308–17. doi: 10.1177/1933719112453507. doi: 10.1177/1933719112453507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Revel A, Achache H, Stevens J, Smith Y, Reich R. MicroRNAs are associated with human embryo implantation defects. Hum Reprod. 2011;26:2830–40. doi: 10.1093/humrep/der255. doi: 10.1093/humrep/der255. [DOI] [PubMed] [Google Scholar]
  • 17.Coughlan C, Ledger W, Wang Q, Liu F, Demirol A, Gurgan T, et al. Recurrent implantation failure: Definition and management. Reprod Biomed Online. 2014;28:14–38. doi: 10.1016/j.rbmo.2013.08.011. doi: 10.1016/j.rbmo.2013.08.011. [DOI] [PubMed] [Google Scholar]
  • 18.Kdous M, Merdassi G, Zhioua F, Elloumi H, Kacem K, Zhioua A. Basal follicle stimulating hormone level correlated to age is a good prognostic criterion for the outcome of intracytoplasmic sperm microinjection. Tunis Med. 2016;94:181–5. [PubMed] [Google Scholar]
  • 19.Lu M, Shi B, Wang J, Cao Q, Cui Q. TAM: A method for enrichment and depletion analysis of a microRNA category in a list of microRNAs. BMC Bioinformatics. 2010;11:419. doi: 10.1186/1471-2105-11-419. doi: 10.1186/1471-2105-11-419. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wang Y, Xia H, Zhuang Z, Miao L, Chen X, Cai H. Axl-altered microRNAs regulate tumorigenicity and gefitinib resistance in lung cancer. Cell Death Dis. 2014;5:e1227. doi: 10.1038/cddis.2014.186. doi: 10.1038/cddis.2014.186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Sonderegger S, Pollheimer J, Knöfler M. Wnt signalling in implantation, decidualisation and placental differentiation – Review. Placenta. 2010;31:839–47. doi: 10.1016/j.placenta.2010.07.011. doi: 10.1016/j.placenta.2010.07.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.van der Horst PH, Wang Y, van der Zee M, Burger CW, Blok LJ. Interaction between sex hormones and WNT/ß-catenin signal transduction in endometrial physiology and disease. Mol Cell Endocrinol. 2012;358:176–84. doi: 10.1016/j.mce.2011.06.010. doi: 10.1016/j.mce.2011.06.010. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figure S1

The micrograph of H and E dying for the sample of RIF10. The micrographs for the other 21 samples were similar to this, and all the reports were: normal mid-secretory endometrium. (a) Extreme glandular coiling secretory glands set within a spindled edematous stroma. Luminal secretion is most prominent (H and E, original magnification ×100). (b) The coiled spiral arteries are seen within an edematous stroma. Perivascular predecidual reaction has not occurred (H and E, original magnification ×200). RIF: Repeated implantation failure.


Articles from Chinese Medical Journal are provided here courtesy of Wolters Kluwer Health

RESOURCES