Skip to main content
NCBI home page
British Journal of Pharmacology logoLink to British Journal of Pharmacology
. 2016 Nov 28;174(1):41–56. doi: 10.1111/bph.13645

The protective effect of the natural compound hesperetin against fulminant hepatitis in vivo and in vitro

Xueting Bai 1,2, Peixuan Yang 3, Qiaoling Zhou 1, Bozhi Cai 4, Manon Buist‐Homan 2,5, He Cheng 1, Jiyang Jiang 1, Daifei Shen 1, Lijun Li 1, Xiajiong Luo 1, Klaas Nico Faber 2,5, Han Moshage 2,5,†,✉, Ganggang Shi 1,†,✉
PMCID: PMC5341490  PMID: 27714757

Abstract

Background and Purpose

Liver diseases are mostly accompanied by inflammation and hepatocyte death. Therapeutic approaches targeting both hepatocyte injury and inflammation are not available. Natural compounds are considered as potential treatment for inflammatory liver diseases. Hesperetin, a flavonoid component of citrus fruits, has been reported to have anti‐inflammatory properties. The aim of this study was to evaluate the cytoprotective and anti‐inflammatory properties of hesperetin both in vitro and in models of fulminant hepatitis.

Experimental Approach

Apoptotic cell death and inflammation were induced in primary cultures of rat hepatocytes by bile acids and cytokine mixture respectively. Apoptosis was quantified by caspase‐3 activity and necrosis by LDH release. The concanavalin A (ConA) and D‐galactosamine/LPS (D‐GalN/LPS) were used as models of fulminant hepatitis. Liver injury was assessed by alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels, liver histology and TUNEL assay and inflammation by inducible NOS (iNOS) expression.

Key Results

Hesperetin blocked bile acid‐induced apoptosis and cytokine‐induced inflammation in rat hepatocytes. Moreover, hesperetin improved liver histology and protected against hepatocyte injury in ConA‐ and D‐GalN/LPS‐induced fulminant hepatitis, as assessed by TUNEL assay and serum AST and ALT levels. Hesperetin also reduced expression of the inflammatory marker iNOS and the expression and serum levels of TNFα and IFN‐γ, the main mediators of cell toxicity in fulminant hepatitis.

Conclusion and Implications

Hesperetin has anti‐inflammatory and cytoprotective actions in models of acute liver toxicity. Hesperetin therefore has therapeutic potential for the treatment of inflammatory liver diseases accompanied by extensive hepatocyte injury, such as fulminant hepatitis.

Abbreviations

ALT

alanine aminotransferase

AST

aspartate aminotransferase

CM

cytokine mixture

CMC‐Na

sodium carboxymethylcellulose

ConA

concanavalin A

D‐GalN

D‐galactosamine

FasL

Fas ligand

GCDCA

glycochenodeoxycholic acid

HE

haematoxylin–eosin

HO1

haem oxygenase 1

iNOS

inducible NOS

TBil

total bilirubin

TLR

toll‐like receptor

TUDCA

tauroursodeoxycholic acid

Tables of Links

TARGETS
Enzymes a JNK subfamily
Caspase 3 PARP family
HO‐1 Catalytic receptors b
iNOS, inducible NO synthase TLR‐4
LIGANDS
IFN‐γ IL‐6
IL‐1β IL‐10
IL‐4 TNF‐α
Open in a new tab

These Tables list key protein targets and ligands in this article that are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Southan et al., 2016), and are permanently archived in the Concise Guide to PHARMACOLOGY 2015/16 (a,bAlexander et al., 2015a,b).

Introduction

Hesperetin is a natural compound belonging to the flavanone class of flavonoids. It is the aglycone of hesperidin (β‐7‐rutinoside of hesperetin), a predominant flavonoid component of citrus fruits (Figure 1). It is now well accepted that low consumption of high fat foods and an increased intake of fruit and vegetables will reduce the risk of some life‐threatening diseases and maintain a good health status (Parr and Bolwell, 2000). Worldwide, the dietary intake of citrus fruit products, and hence flavanones, is increasing every year (Khan et al., 2014). In Western countries, the intake of hesperetin is largely dependent on dietary habits (Knekt et al., 2002), whereas hesperetin is also known as a major active ingredient in the Chinese traditional medicinal herb Chenpi (Li et al., 2008). Because of the reported bioactivities, extensive research has been performed on hesperidin and hesperetin in various experimental models. These bioactivities include antioxidant, anti‐inflammatory and anti‐carcinogenic effects (Iranshahi et al., 2015; Parhiz et al., 2015).

Figure 1.

Figure 1

Open in a new tab

Structures of hesperetin and hesperidin.

Most liver diseases are accompanied by inflammation and oxidative stress, regardless of the aetiology of the underlying disorder. Mild and time‐restricted hepatic inflammation could be considered beneficial in the restoration of tissue homeostasis, for example, by eliminating invading pathogenic organisms and damaged or dead cells. However, excessive and uncontrolled inflammation leads to massive loss of hepatocytes as a result of apoptosis and/or necrosis (Guicciardi and Gores, 2005) irreversible damage to the liver parenchyma and loss of liver function (Brenner et al., 2013). Loss of hepatocytes and loss of liver function occurs in many forms of liver pathology, including fulminant hepatitis, reperfusion injury, (non‐)alcoholic liver diseases, cholestasis and viral hepatitis. All these conditions demonstrate high morbidity and mortality and liver transplantation is often the only life‐saving treatment (Malhi et al., 2010; Protzer et al., 2012). The management of acute and chronic inflammatory liver disease is still a challenge to modern drug development, because there are currently no effective treatments that improve liver function and/or regenerate or protect hepatic cells (Namdeo and Syed, 2014). Therefore, there is an urgent need for novel therapeutic approaches that prevent liver injury via protection against hepatocyte cell death. In particular, the potential of herbal and dietary supplements, like hesperetin, has been largely unexplored in this regard.

Although hesperidin exhibits a wide range of biological activities, including hepatoprotective properties in liver injury (Kaur et al., 2006; Chen et al., 2010; Li et al., 2014), its aglycone, hesperetin, has greater bioactivity as a result of more efficient absorption from the intestine than hesperidin (Jung et al., 2003; Kim et al., 2004; Kanaze et al., 2007; Kobayashi et al., 2008). Existing studies are mainly focused on one specific in vivo or in vitro model (Cha et al., 2001; Pari and Shagirtha, 2012), but comprehensive reports on the effectiveness of different doses of orally administered hesperetin in multiple models of fulminant hepatitis are lacking. In viral and autoimmune hepatitis, activation of T‐cells and macrophages is the initial event (Wolf et al., 2005). Experimental liver injury models were established that resemble fulminant human hepatitis, including TNFα‐ and IFN‐γ‐dependent inflammatory liver injury models, that allow the evaluation of hepatoprotective interventions, including medicinal plant components. In our study, immune‐mediated liver injury was induced by the T‐cell mitogenic plant lectin concanavalin A (Con A). Liver injury in this model is dependent on both macrophage‐derived TNFα and T‐cell‐derived IFN‐γ. In this model, the expression of various cytokines is strongly induced, including IFN‐γ, IL‐4 and IL‐2 (Sass et al., 2002). As a second model, we used an inflammation‐induced model of fulminant hepatitis. Endotoxins such as LPS are known as strong stimulators of macrophages, including Kupffer cells. TNFα alone does not induce hepatocyte cell death. However, when hepatocytes are simultaneously sensitized with D‐galactosamine (D‐GalN), preventing hepatocyte transcription, LPS‐induced TNFα becomes extremely hepatotoxic, because of extensive apoptosis of hepatocytes (Schoemaker et al., 2002).

The aim of the present study was to investigate the hepatoprotective and anti‐inflammatory properties of hesperetin in acute liver injury. We have demonstrated that hesperetin is anti‐inflammatory and cytoprotective, in part by repression of IFN‐γ expression in T‐cell‐mediated hepatitis and by repression of TNFα expression in the TNFα‐dependent D‐GalN/LPS model of liver injury.

Methods

Animals

All animal care complied with the legal requirements and guidelines approved by the ethics committee for the animal facility of Shantou University Medical College or the guidelines of Institutional Animal Care and Use Committee of Laboratory Animals of the University of Groningen (DEC‐RUG). Experimental procedures were approved by the appropriate Animal ethics Committee. All studies involving animals are reported in accordance with the ARRIVE guidelines for reporting experiments involving animals (Kilkenny et al., 2010; McGrath and Lilley, 2015).

Male Wistar rats (220–250 g; 6–8 weeks; specified pathogen free (SPF)) were purchased from Harlan (Zeist, The Netherlands) and kept in cages containing standard bedding, with at least two rats per cage. 6 week‐old male BALB/c mice (20–22 g) were obtained from Hunan SJA Laboratory Animal Co. Ltd (Changsha, China no. 43004700009427). All animals were housed in a specific pathogen‐free facility with 12 h light/dark cycle [07 to 19 h, temperature (22 ± 2°C), humidity (40–70%), controlled ventilation] and with sterile water and irradiated food available ad libitum.

Hepatocyte isolation

Hepatocytes were isolated from Wistar rat (anaesthetized first with isoflurane 5%, followed by 60 mg·kg−1 ketamine s.c. combined with 0.25 mg·kg−1 medetomidine) by a two‐step collagenase perfusion procedure as described previously (Conde de la Rosa et al., 2006). Cell viability was determined by Trypan blue staining and was more than 85%. About 112 500 cells·cm−2 were plated on Vitrogen®‐coated plates in William's E medium (Life Technologies Ltd, Breda, The Netherlands) supplemented with 50 μg·mL−1 gentamycin (Life Technologies Ltd) and penicillin‐streptomycin‐fungizone (Lonza, Verviers, Belgium). During the attachment period (4 h) 50 nmol·L−1 dexamethasone (Sigma, St Louis, USA) and 5% fetal calf serum (Life Technologies Ltd) were added to the medium. Cells were cultured in a humidified incubator at 37°C and 5% CO2.

In vitro studies

Experiments were started after the attachment period of 4 h. Monolayers of cultured primary hepatocytes were treated with different concentrations of hesperetin (10, 25, 50 μmol·L−1) to analyse the effect on cytokine mixture (CM: 20 ng·mL−1 mTNFα, 10 ng·mL−1 hIL‐1β and 10 ng·mL−1 rIFN‐γ)‐induced inflammation for 6 h. As in vitro model of cell death, we used glycochenodeoxycholic acid (GCDCA: 50 μmol·L−1)‐induced cell death for 4 h. GCDCA‐induced cell death is independent of any inflammation and induces mainly apoptosis (Schoemaker et al., 2003). Signal transduction pathways were inhibited using 10 μmol·L−1 of the ERK1/2 inhibitor U0126 (Promega, Madison, USA), 10 μmol·L−1 of the p38 inhibitor SB 203580 (Calbiochem, San Diego, CA, USA), 50 μmol·L−1 of the PI3 kinase inhibitor LY 294002 (Calbiochem, San Diego, CA, USA). All inhibitors and receptor antagonists were added to the cultured hepatocytes 30 min prior to the apoptotic or inflammatory stimuli. Every experimental condition was performed in triplicate wells, and each experiment was repeated at least five times using hepatocytes from different rats. Cells were harvested at the indicated time points using lysis buffer for protein assay or TriZol reagent for RNA isolation.

Liver injury experimental models

After 7 days of adjusting, the animals were randomly divided into 10 experimental groups.

  • Control group (n = 8): These animals were treated with the equivalent volume of PBS as used for the administration of Con A and D‐GalN/LPS.

  • Control hesperetin group (n = 8): The mice were treated with hesperetin 400 mg·kg−1 p.o. in 0.5% sodium carboxymethylcellulose (CMC‐Na) solution for 10 days.

  • Con A group (n = 15): The animals were treated with the same volume of CMC‐Na as used for administration of hesperetin for 10 days and were challenged with Con A (i.v.15 mg·kg−1).

  • Con A + hesperetin groups: The animals received various doses of hesperetin (100, 200, 400 mg·kg−1) p.o. for 10 days before Con A injection (each group n = 15).

  • D‐GalN/LPS group (n = 15): The animals were given CMC‐Na for 10 days and injected i.p. with D‐GalN (700 mg·kg−1)/LPS (5 μg·kg−1).

  • D‐GalN/LPS + hesperetin groups: Three doses of hesperetin (100, 200, 400 mg·kg−1) were given to mice once daily for 10 days. D‐GalN (700 mg·kg−1)/LPS (5 μg·kg−1) were injected i.p. (each group n = 15).

Con A from Canavalia ensiformis (Jack bean) Type IV, lyophilized powder (Sigma C2010), LPS (Escherichia coli 055:B5; Sigma L2880) and D‐(+)‐galactosamine hydrochloride (Sigma G1639) were diluted in sterile endotoxin‐free PBS. Mice were pretreated with hesperetin (3′, 5, 7‐trihydroxy‐4′‐methoxyflavanone; Afar Aesar B20528) dissolved in sterile PBS containing 0.5% CMC‐Na (Aladdin) p.o. for 10 days once day−1. Con A (15 mg·kg−1) was injected i.v., and D‐GalN (700 mg·kg−1) with LPS (5 μg·kg−1) was injected i.p. Eight hours after the challenge, mice were anaesthetized using isoflurane (3.5%) for blood collection, then immediately killed by cervical dislocation followed by removal of the liver. The left lateral lobe was used for routine histology and the remaining lobes were frozen in aliquots in liquid nitrogen and then stored at −80°C for RNA isolation and protein assays. Serum was separated by centrifugation (15 min at 1000 × g) and used for serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) determination and ELISA assays.

Routine histological analysis

Liver tissue was fixed in 4% paraformaldehyde, paraffin‐embedded, and cut into 4 μm sections. The tissue paraffin sections were deparaffinized, rehydrated following routine methods and stained with haematoxylin–eosin (HE). Quantitation of infiltrating leukocytes was performed by operators, blinded to the treatments, on individual liver sections of the Con A/D‐GalN/LPS and Con A + Hesperetin/D‐GalN/LPS + hesperetin groups (n = 15) and of the Control and Control + Hesperetin group (n = 8). Magnification of measurement area is 400X.

TUNEL assay

Apoptotic cell death was determined on paraffin‐embedded sections of liver tissue by the presence of free 3′‐hydroxy groups by TUNEL assay using DeadEnd™ Fluorometric TUNEL System (Promega, Beijing, China). The assays were performed as recommended by the manufacturer. For each liver tissue section, the number of TUNEL‐positive cells in three random 20x‐objective high‐powered fields (containing at least one portal triad and central vein each) was counted by an investigator, blinded with respect to treatment groups, using an Olympus IX81 microscope (Olympus, Japan).

Serum biochemical parameters

Activities of serum aminotransferases (ALT, AST) and total bilirubin (TBil) were determined by Bio‐sinew kits (Chengdu, China) on Automatic Chemistry Analyzer (Accute TBA‐40FR, Toshiba Medical Systems Corporation, Japan). Cytokine serum concentrations were assayed for murine TNFα, IL‐4 (4A Biotech, Beijing, China), IFN‐γ, (Boster, Wuhan, China), IL‐6 and IL‐10 (Bangyi, Shanghai, China) by ELISA as described by the manufacturer.

RNA isolation and quantitative real‐time polymerase chain reaction (PCR)

RNA was isolated from mouse liver tissue using TriZol Reagent (TaKaRa, Japan). After using PrimeScript TM RT reagent Kit with gDNA Eraser (TaKaRa, Japan), qPCR of liver tissue was performed using SYBR Green reagent (TaKaRa, Japan) on PCR detection system (ABI 7500, Applied Biosystems, USA). Rat mRNA from hepatocytes was isolated using Tri‐reagent (Sigma‐Aldrich) and assayed with TaqMan control reagents (ABI PRISM 7700, Applied Biosystems, The Netherlands). Mice primers and rat primers and probes are described in Table 1. Gene expression in vivo was normalized with respect to GAPDH and 18S for hepatocytes shown relative to control values.

Table 1.

Sequence of primers and probes used for qRT PCR

Gene Forward primer 5′‐3′ Reverse primer 5′‐3′ Accession
IL‐1β mouse CAACCAACAAGTGATATTCTCCATG GATCCACACTCTCCAGCTGCA NM_008361.3
IL‐6 mouse CAACCACGGCCTTCCCTACT TCATTTCCACGATTTCCCAGAG NM_031168.1
Tnfα mouse GACAAGGCTGCCCCGACTACG CTTGGGGCAGGGGCTCTTGAC NM_013693.3
IL‐10 mouse CAGAGCCACATGCTCCTAGA TGTCAGCTGGTCCTTTGTT NM_010548.2
Fas mouse ATGCACACTCTGCGATGAAG CAGTGTTCACAGCCAGGAGA NM_007987.2
FasL mouse GCAGAAGGAACTGGCAGAAC TTAAATGGGCCACACTCCTC NM_010177.4
Tlr4 mouse TTTCACCTCTGCCTTCACTACA AGATACACCAACGGCTCTGAAT NM_021297.2
Nos2 mouse GACGAGACGGATAGGCAGAG CTTCAAGCACCTCCAGGAAC NM_010927.3
Ifnγ mouse CAGCAACAGCAAGGCGAA A CTGGACCTGTGGGTTGTTGAC NM_008337.3
Gapdh mouse GCACAGTCAAGGCCGAGAAT GCCTTCTCCATGGTGGTGAA NM_008084.2
Nos2 Rat GTGCTAATGCGGAAGGTCATG CGACTTTCCTGTCTCAGTAGCAAA NM_012611.2
Probe 5′‐3′: CCCGCGTCAGAGCCACAGTCCT
Hmox1 Rat CTGGTCTTTGTGTTCCTCTGTCAG CACAGGGTGACAGAAGAGGCTAA NM_012580
Probe 5′‐3′ CAGCTCCTCAAACAGCTCAATGTTGAGC
18S Rat CGGCTACCACATCCAAGGA CCAATTACAGGGCCTCGAAA NM_003278
Probe 5′‐3′: CGCGCAAATTACCCACTCCCGA
Open in a new tab

Western blot analysis

Protein extracts from liver were prepared by homogenization in RIPA (P0013B Beyotime, Jiangsu, China). Protein (50 μg) from each sample was separated by SDS‐PAGE and transferred to nitrocellulose filter membranes. Following blocking, membranes were probed with primary antibodies: mouse anti‐inducible NOS (iNOS) rabbit monoclonal antibody 1:2000 (Cell Signaling Technology, USA), mouse anti‐phospho‐Stress‐associated protein kinase (SAPK)/JNK (Thr183/Tyr185) rabbit monoclonal antibody 1:2000 (Cell Signaling Technology, USA), anti‐SAPK/JNK rabbit monoclonal antibody 1:3000 (Cell Signaling Technology, USA). Mouse anti‐GAPDH monoclonal antibody 1:3000 (ZSGB‐BIO, Beijing). All primary antibody incubations were overnight at 4°C, followed by detection using HRP‐conjugated secondary mouse antibody 1:60 000 and rabbit antibody 1:80 000 (ZSGB‐BIO, Beijing) at room temperature for 1 h. Total hepatocyte lysates were analysed for PARP cleavage (1:1000 Cell Signaling Technology, Beverly, Massachusetts, USA).

Analysis of hepatocyte apoptosis and necrosis

Measurement of caspase‐3 activity was as described previously (Conde de la Rosa et al., 2006). The arbitrary fluorescence unit was corrected for the amount of protein using BioRad protein assay kit. Cell necrosis was determined by measuring LDH release according to standard laboratory protocol. Briefly, 100 μL medium was loaded in 96‐well plates followed by addition of pyruvate and NADH. LDH activity was detected by absorbance at 340 nm for 30 min. The linear portion of the kinetic curve was calculated, compared to a standard curve.

Data and statistical analysis

The data and statistical analysis in this study comply with the recommendations on experimental design and analysis in pharmacology (Curtis et al., 2015). The data were expressed as mean ± SEM. One‐way ANOVA followed by Tukey's post hoc test (GraphPad Prism 5.01 (Graphpad Software Inc., La Jolla, CA, USA)) and t‐test were used to analyse the results. Results were considered statistically different when the P values were equal to or less than 0.05.

Results

Hesperetin has anti‐inflammatory and cytoprotective effects on rat hepatocytes

The bile acid GCDCA (50 μmol·L−1) induces apoptosis in primary rat hepatocytes with caspase‐3 activity peaking after 4 h exposure (Schoemaker et al., 2002; Schoemaker et al., 2004). This model of apoptosis was used because it is not accompanied by inflammation, and GCDCA does not activate NF‐κB, and therefore, any cytoprotective effect of hesperetin is independent of an effect on inflammation. Hesperetin was added 30 min prior to GCDCA, and the effect on GCDCA‐induced caspase‐3 activity was investigated 4 h after GCDCA exposure. Hesperetin dose‐dependently reduced GCDCA‐induced caspase‐3 activity in cultured primary rat hepatocytes (Figure 2A). Maximum inhibition (80%) was observed at 50 μmol·L−1 hesperetin. Therefore, this concentration of hesperetin was used in subsequent analyses. Hesperetin alone, at 50 μmol·L−1, did not modulate caspase‐3 activity. GCDCA induced cleavage of the caspase‐3 substrate PARP, which was effectively inhibited by hesperetin (Figure 2B). The anti‐apoptotic effect of hesperetin was not accompanied by an increase in necrotic cell death as neither GCDCA nor hesperetin, nor the combination of GCDCA and hesperetin induced LDH release from hepatocytes (Figure 2C). To investigate the role of specific signal transduction pathways in the protective effect of hesperetin, we used several inhibitors of MAPKs and PI3K. Importantly, the protective effect of hesperetin against GCDCA‐induced apoptosis was not abolished by inhibition of either ERK, p38 or PI3K (Figure 2D). Hesperetin also dose‐dependently reduced CM‐induced Nos2 (iNOS) expression in hepatocytes (Figure 2E) indicating that hesperetin also has potent anti‐inflammatory properties. Interestingly, hesperetin‐induced expression of the antioxidant gene haem oxygenase 1 (HO‐1) about fourfold compared with cytokine mixture alone (Figure 2E).

Figure 2.

Figure 2

Open in a new tab

Hesperetin has cytoprotective and anti‐inflammatory effects on primary rat hepatocytes. (A) Hesperetin reduces GCDCA‐induced caspase‐3 activation (GCDCA: 50 μmol·L−1). (B) Hesperetin prevents cleavage of PARP as assessed by Western blot. (C) GCDCA and CM do not induce necrotic death of hepatocytes. The inhibitory effect of hesperetin on GCDCA‐induced apoptosis and CM‐induced inflammation is not accompanied by an increase of necrosis as assessed by LDH leakage in supernatant of cultured hepatocytes. LDH release is expressed as % of total LDH content of hepatocytes. (D) The protective effect of hesperetin is not abolished upon inhibition of the p38 and ERK MAPKs and the PI3K pathway. (E) Hesperetin attenuates the inflammatory response of hepatocytes as assessed by iNOS mRNA determination by qPCR; All experiments were performed in duplicate wells and each experiment was repeated using hepatocytes from five different isolations; Values are mean ± SD, ns indicates not significant; *P < 0.05, significantly different from GCDCA or CM.

Hesperetin attenuates Con A‐mediated hepatitis

To translate our in vitro findings into an in vivo model, we first tested the effect of hesperetin on Con A‐induced liver damage. The morphological observations are shown in Figure 3A. Macroscopically, hesperetin reversed the dark surface colour of livers with passive congestion induced by Con A (Figure 3A). Microscopically, areas of active hepatocellular degeneration and necrosis are observed, presenting single or multiple foci of pale‐staining groups of hepatocytes. In addition, there was congestion and inflammation (infiltration of mononuclear cells along with neutrophils) of pericentral areas (Figure 3B). Due to the limited period after Con A challenge, a normal liver structure is still retained. These microscopic abnormalities were prevented or reversed by hesperetin (Figure 3B). In fact, the histology of Con A‐treated groups that received 200 and 400 mg·kg−1 hesperetin was similar to that of normal liver. The number of infiltrating leukocytes in liver tissues of mice with Con A‐induced fulminant hepatitis were significantly decreased by hesperetin, especially in portal venous areas (Figure 3C). Serum ALT and AST were increased 75‐fold and sixfold, respectively, after Con A treatment. Hesperetin pretreatment dose‐dependently attenuated the Con A‐induced increase of serum AST, ALT and TBil (Figure 3D, E). The protective effect of hesperetin was paralleled by a significant dose‐dependent decrease of serum IFN‐γ levels (Figure 3F). Con A treatment also increased TNFα and IL‐4 (Figure 3F). Co‐treatment with hesperetin reduced the serum levels of these cytokines as well, albeit to a lower extent compared with IFN‐γ. IL‐6 and IL‐10 serum levels were hardly affected by Con A treatment, and hesperetin has only minor effects on the serum levels of those cytokines (Figure 3F).

Figure 3.

Figure 3

Open in a new tab

Hesperetin dose‐dependently protects against Con A‐mediated fulminant hepatitis. (A) Macroscopic appearance of livers indicating a beneficial effect of hesperetin to the dark surface of liver with passive congestion. (B) Haematoxylin–eosin staining of liver sections: in Con A hepatitis it shows hepatocellular degeneration (cloudy swelling), eosinophilic focus of cellular alteration with pale pink cytoplasm, condensed hypereosinophilic cytoplasm and shrunken nuclear occur spontaneously with one or two affected hepatocytes (arrows) and infiltration of inflammatory cells (mononuclear: lymphocytes and macrophages) (arrowheads), which are significantly reduced by hesperetin. Magnification 200X (upper panel), 400X (lower panel). (C) Quantitation of infiltrating leukocytes represented as average number of individual liver sections in Con A and Con A + Hesperetin groups. Magnification of measurement area is 400X. (D) Serum samples show increased total bilirubin levels in Con A‐treated animals, which is (partially) reversed by hesperetin. Samples represent (from left to right): Control, Con A, Con A and increasing doses of hesperetin. (E) Serum markers of liver injury, AST, ALT and total bilirubin, are significantly induced in Con A hepatitis. Hesperetin attenuates the rise in ALT, AST and TBil levels. (F) Serum levels of cytokines as assessed by elisa demonstrate a significant rise of IFN‐γ and TNFα in Con A hepatitis, which is reduced by hesperetin. Values are mean ± SD; Control group and Control Hesperetin group n = 8, Con A and Con A + Hesperetin groups n = 15, *P < 0.05, significantly different from Con A.

Hesperetin attenuates Con A‐induced hepatocyte apoptosis and hepatic Nos2 (iNOS) expression

In addition to necrosis, Con A‐induced hepatocyte apoptosis, as detected by TUNEL staining and caspase‐3 activity assay, which was markedly reduced by co‐treatment with hesperetin at 200 mg·kg−1 (Figures 4A and 5). Furthermore, hesperetin suppressed Con A‐induced iNOS protein and mRNA (Nos2) expression (Figure 4B, C). Con A treatment induced the hepatic mRNA levels of several inflammatory and T‐cell‐derived cytokines, such as TNFα, IFN‐γ, Il‐6, Il‐10, Il‐4 and Il‐1β. Expression of all these cytokines was reduced by hesperetin co‐treatment (Figure 4C), and these results generally paralleled the serum levels of these cytokines (Figure 3F).

Figure 4.

Figure 4

Open in a new tab

Apoptotic cell death and inflammation in Con A induced fulminant hepatitis are attenuated by hesperetin. (A) Apoptosis was assessed by TUNEL assay and visualized by Alexa Fluor 488: Hesperetin significantly reduced the number of TUNEL‐positive nuclei in Con A hepatitis; (B) Hesperetin attenuated Con A‐induced inflammation as assessed by iNOS Western blot analysis. GAPDH was used as a loading control. (C) Expression of cytokines in liver tissue was determined by qPCR and expressed as fold increase compared to control. Con A induced the expression of inflammatory and T‐cell derived cytokines. The induction of all cytokines, except Il‐1β, was attenuated by hesperetin. Values are mean ± SD; Control group n = 8, Con A and Con A + Hesperetin groups n = 15. *P < 0.05, significantly different from Con A.

Figure 5.

Figure 5

Open in a new tab

Hesperetin reduces caspase‐3 activity in fulminant hepatitis. Hesperetin attenuates caspase‐3 activity in fulminant hepatitis. Hesperetin was administered to animals at 200 mg·kg−1. D‐GalN/LPS and to a lesser extent Con A, induced an increase in caspase‐3 activity, which was significantly attenuated by hesperetin in the D‐GalN/LPS model. Values are mean ± SD *P < 0.05, significantly different as indicated.

Hesperetin protects mice from D‐GalN/LPS induced liver injury

Another well‐characterized murine model of acute liver failure is LPS administration to D‐GalN‐sensitized mice. In this model, hesperetin showed a protective effect as demonstrated by the reversal of the darker surface of the livers as blood‐filled on macroscopic appearance (Figure 6A). In addition, hesperetin improved histology in HE‐stained tissue sections. Hesperetin decreased the extent of piecemeal necrosis around central veins and the loss of normal morphology. Hesperetin co‐treatment also decreased the occurrence of apoptotic bodies, hydropic degeneration, nuclear fragments, autolysis and haemorrhage (Figure 6B). The number of leukocytes infiltrated in liver tissue of mice with D‐GalN/LPS‐induced fulminant hepatitis were significantly decreased by hesperetin (Figure 6C). Serum markers of liver injury (AST, ALT) were reduced by hesperetin co‐treatment, but hesperetin did not attenuate the increased levels of TBil (Figure 6D, E). Remarkably, in this model, hesperetin was most protective at 200 mg·kg−1. Treatment with both 100 mg·kg−1 and 400 mg·kg−1 hesperetin resulted in less complete or no protection at all compared with 200 mg·kg−1 hesperetin (Figure 6A–E). elisa assay on serum samples demonstrated a clear reduction of LPS/D‐GalN‐induced TNFα level by hesperetin at 200 mg·kg−1 but not at 100 or 400 mg·kg−1. The effect of hesperetin on the serum levels of other cytokines (IL‐6, IL‐10) was less conclusive (Figure 6F).

Figure 6.

Figure 6

Open in a new tab

Hesperetin protect mice from D‐GalN/LPS induced fulminant hepatitis. (A) Macroscopic appearance of livers. (B) Haematoxylin–eosin staining of liver sections: In D‐GalN/LPS‐induced fulminant hepatitis, there is pale eosinophilic staining, absence of nuclear detail, nuclear fragmentation (arrows), patchy areas of blood and abundant apoptotic hepatocytes (arrowheads). Magnification: 200X (upper panel) and 400X (lower panel). (C) Quantitation of infiltrating leukocytes, represented as average number of individual liver sections in D‐GalN/LPS and D‐GalN/LPS + Hesperetin groups. Magnification of measurement area is 400X. (D) Serum samples show hyperbilirubinemia in D‐GalN/LPS ‐treated animals, which is not reversed by hesperetin. Samples represent (from left to right): Control, Hesperetin, D‐GalN/LPS, D‐GalN/LPS and increasing doses of hesperetin. (E) Serum markers of liver injury, AST, ALT and TBil are significantly induced in D‐GalN/LPS hepatitis. Hesperetin (Hst) attenuates the rise in ALT and AST levels but not in TBil levels. (F) Serum levels of inflammatory cytokines as assessed by elisa. D‐GalN/LPS induces a strong increase in TNF serum levels, which is attenuated by Hst. Values are mean ± SD; Control group and Control Hst group n = 8, D‐GalN/LPS and D‐GalN/LPS + Hst groups n = 15. ns: not significant; *P < 0.05, significantly different from D‐GalN/LPS.

Hesperetin inhibits pro‐apoptotic JNK activation and inflammation in D‐GalN/LPS‐challenged mice

In addition to necrosis, D‐GalN/LPS induced significant apoptosis as determined by TUNEL assay and caspase‐3 activity assay. Hesperetin at 200 mg·kg−1 reduced the number of TUNEL‐positive hepatocyte nuclei and caspase‐3 activity in liver tissue (Figure 5 and Figure 7A). Moreover, the D‐GalN/LPS‐induced activation of pro‐apoptotic JNK was reduced by 49% by hesperetin treatment (200 mg·kg−1) (Figure 7B). D‐GalN/LPS‐induced acute liver failure is characterized by a strong inflammatory response. Indeed, hepatic mRNA levels of the inflammatory cytokines TNFα, IL‐1β and IL‐6 were all strongly induced after D‐GalN/LPS treatment and this induction was markedly reduced by hesperetin(Figure 7C). To better characterize the molecular mechanisms underlying the protection of hesperetin, selective genes were determined by qPCR. Both Fas ligand (FasL) and toll‐like receptor (TLR)‐4 expression were increased in the D‐GalN/LPS model, and this increased expression was attenuated by hesperetin at 200 mg·kg−1. The endotoxin receptor TLR‐4 and FasL are mainly expressed on macrophages in the liver, including Kupffer cells and immune cells and reflect increased inflammation. The effects of hesperetin on the expression of these markers indicate decreased inflammation (Figure 7C).

Figure 7.

Figure 7

Open in a new tab

Apoptotic cell death and inflammation in D‐GalN/LPS‐induced fulminant hepatitis are attenuated by hesperetin. (A) Apoptosis was assessed by TUNEL assay and visualized by Alexa Fluor 488. Hesperetin significantly reduced the number of TUNEL‐positive nuclei in D‐GalN/LPS induced hepatitis; (B) Hesperetin attenuated D‐GalN/LPS‐induced activation of JNK as assessed by Western blot analysis for phospho‐JNK. Total JNK and GAPDH were used as reference proteins. Right panel shows the quantitation of pJNK/JNK. (C) Expression of cytokines in liver tissue was determined by qRT PCR and expressed as fold increase compared with control. The inflammatory cytokines TNFα, IL‐1β and IL‐6 are induced in D‐GalN/LPS hepatitis, and this induction is attenuated by hesperetin. Furthermore, expression of FasL and TLR‐4, mainly expressed on inflammatory and immune cells, is increased in D‐GalN/LPS hepatitis, and this increase is attenuated by hesperetin. Values are mean ± SD; Control group and Control Hesperetin group n = 8, D‐GalN/LPS and D‐GalN/LPS + Hesperetin groups n = 15, *P < 0.05, significantly different from D‐GalN/LPS.

To determine whether hesperetin is also effective when administered after the challenge (therapeutic effect), we performed a proof of concept study in which hesperetin was given 1 and 3.5 h after D‐Gal/LPS challenge. In this pilot experiment, using Kunming mice, hesperetin significantly reduced AST and ALT levels compared to treatment with D‐GalN/LPS alone (data not shown).

Discussion

Use of herbal preparations can be traced back over centuries and has been described in ancient Egypt, China, India and Sumeria (Schuppan et al., 1999). It is an important component of complementary and alternative medical therapies, together with dietary supplements (Tindle et al., 2005), and many people consider herbal remedies as natural and free of side‐effects and beneficial for health maintenance (Larrey, 1997; Bailey et al., 2013). Therefore, the popularity of complementary and alternative medical therapies is increasing every year. Hesperetin is a bioactive flavanone found in citrus fruits and its consumption is increasing worldwide (Khan et al., 2014), although a systematic evaluation of p.o. administered hesperetin for the treatment of liver diseases, in particular fulminant hepatitis is still lacking. In the present study, we investigated the protective effect of hesperetin on hepatic injury using both in vivo and in vitro models. We demonstrated that hesperetin protected hepatocytes against apoptosis in an inflammation‐independent model of bile acid‐induced apoptosis and reduced markers of NF‐κB activation like iNOS, indicative of inflammatory signalling in both macrophages as well as hepatocytes. Furthermore, hesperetin proved to be protective in two in vivo models of fulminant hepatitis, reducing both inflammation and cell injury.

Virtually, all liver diseases are accompanied by inflammation. Mild and time‐restricted hepatic inflammation contributes to the restoration of tissue homeostasis. In contrast, continuous and uncontrolled inflammation leads to massive loss of hepatocytes and loss of liver function (Brenner et al., 2013) as a result of apoptosis or necrosis (Wang, 2014). Inflammation and hepatocyte death results in a vicious cycle: inflammation drives hepatocyte injury and death via increased generation of apoptotic cytokines and ROS by inflammatory cells, whereas debris of injured and dead hepatocytes drive inflammation. Because of this vicious cycle, any treatment for liver injury should ideally combine anti‐inflammatory actions on inflammatory cells and cytoprotective actions on hepatocytes. Natural products are increasingly considered in the treatment of inflammatory diseases, such as rheumatoid arthritis. Recently, we described the anti‐inflammatory activity of the n‐butanol extract from Ipomoea stolonifera in acute models of inflammation (Cai et al., 2014). This extract of I. stolonifera contains five major components, including hesperetin. In preliminary in vitro experiments, hesperetin exhibited potent anti‐inflammatory activity. Therefore, hesperetin was chosen to be evaluated in this study for the treatment of inflammatory liver diseases.

Hesperetin protected hepatocytes against bile acid (GCDCA)‐induced apoptosis. GCDCA‐induced apoptosis is dependent on the mitochondrial pathway and is accompanied by the activation of mitochondria‐specific caspase‐9. Importantly, GCDCA does not induce an inflammatory response in hepatocytes, demonstrating that the cytoprotective effect of hesperetin is independent of any anti‐inflammatory effect of hesperetin. Furthermore, the protective effect of hesperetin was independent of ERK MAPK, p38 MAPK and PI3K signalling. Previously, we reported on the protective effect of the therapeutic bile acid tauroursodeoxycholic acid (TUDCA) on GCDCA‐induced apoptosis, which is dependent on intact p38/ERK and PI3K signalling (Wagner and Nebreda, 2009; Kim and Choi, 2010). Therefore, hesperetin and TUDCA act via different mechanisms and the combination of hesperetin and TUDCA may be even more protective than either compound alone. In our study, we determined apoptosis by measuring caspase‐3 activity and cleavage of the caspase‐3 substrate PARP. So far, in all our studies, we always observed a strict correlation between caspase‐3 activity and end‐points of apoptosis, such as nuclear condensation. Importantly, the reduction of apoptotic cell death by hesperetin was not accompanied by an increase in alternative modes of cell death, such as necrosis as determined by LDH release.

To further dissect the anti‐inflammatory and cytoprotective effects of hesperetin, we also evaluated the effect of hesperetin on the cytokine‐induced inflammatory response in hepatocytes. We used NF‐κB‐dependent induction of Nos2 (iNOS) as a marker of hepatocyte inflammation. Hesperetin significantly inhibited the induction of Nos2 by cytokines in hepatocytes. Of note, the cytokine mixture alone or in combination with hesperetin did not induce any apoptosis in hepatocytes, again underscoring the independence of the anti‐inflammatory effects from the cytoprotective effects of hesperetin. Interestingly, hesperetin induced HO‐1 expression, suggesting an opposite effect of hesperetin on iNOS and HO‐1 regulation. A reciprocal regulation of iNOS and HO‐1 was previously described in intestinal epithelial cells (Dijkstra et al., 2004). The induction of HO‐1 by hesperetin could, in fact, contribute to the protective effect of hesperetin, since HO‐1 is known as a protective and antioxidant gene (Sass et al., 2003; Conde de la Rosa et al., 2008).

The in vitro effects of hesperetin were confirmed in two mouse models, the T‐cell/IFN‐γ‐mediated model of Con A‐induced fulminant hepatitis and the TNFα‐mediated model of D‐GalN/LPS‐induced fulminant hepatitis (Hase et al., 2001; Wolf et al., 2005). In these models, animals were killed 8 h after the challenge, permitting the monitoring of changes in hepatic mRNA expression and apoptosis (Ogawa et al., 2012; Zhou et al., 2012).

Apoptotic signalling within the cell is transduced mainly via the ‘death receptor’ subgroup within the TNF protein superfamily, including TNFα, CD95L (also known as FasL) and the TNF‐related apoptosis‐inducing ligand (Han et al., 2009). LPS leads to rapid activation of macrophages and high expression of TNFα in macrophages (Chang et al., 2006). Resistance to TNFα cytotoxicity is particularly important in hepatic injury, and this resistance is mainly dependent on intact NF‐κB signalling (Schoemaker et al., 2003). Therefore, in models of acute TNFα toxicity, NF‐κB signalling needs to be suppressed, and this is usually accomplished by D‐GalN or actinomycin D. In the D‐GalN/LPS model of fulminant hepatitis, we observed a very strong inflammatory response, accompanied by extensive liver damage and hepatocyte cell death. Both the inflammatory response and cell injury were strongly inhibited by hesperetin. At least part of the protective effect of hesperetin is due to suppression of inflammation as indicated by reduced leukocyte infiltration and reduced expression of apoptotic cytokines like TNFα and FasL and reduced expression of the endotoxin receptor TLR‐4 and the apoptotic ligand FasL. It has previously been shown that Fas/FasL interactions contribute to inflammation in chronic cholestatic liver injury (Gujral et al., 2004). The reduction in hepatic TLR‐4 and FasL expression could be the result of diminished expression of these receptors on inflammatory cells, and/or a reduced infiltration of inflammatory cells due to less cellular injury in the liver. On the other hand, we cannot exclude a direct cytoprotective effect of hesperetin on hepatocytes, as observed in GCDCA‐induced hepatocyte apoptosis.

Interestingly, in preliminary experiments using Kunming mice, we also demonstrated that hesperetin protects against D‐GalN/LPS‐induced fulminant hepatitis when given twice at 200 mg·kg−1 (1 and 3,5 h) after challenge, indicating that hesperetin is also therapeutically effective (data not shown).

Although hesperetin protects against apoptotic cell death, the dominant mode of cell death in our models of fulminant hepatitis appears to be necrotic cell death. Although apoptotic cell death was convincingly demonstrated in both models by counting TUNEL‐positive cells and measuring caspase‐3 activity, the extent of apoptotic cell death is probably limited compared to necrotic cell death in these models. Nevertheless, both indicators of apoptotic cell death were reduced by hesperetin, indicating that hesperetin also prevents apoptotic cell death in vivo. Therefore, in our models of fulminant hepatitis, the main protective effect of hesperetin is probably via its action on inflammatory cells resulting in the attenuation of the inflammatory response, less production of inflammatory and apoptotic cytokines and less generation of ROS. It should be noted that the contribution of necrotic and apoptotic cell death varies between different liver diseases and that apoptosis is especially relevant in mild to moderate hepatitis like viral hepatitis, (non‐)alcoholic steatohepatitis, whereas necrosis is dominant in fulminant hepatitis and acetaminophen intoxication.

Several studies have convincingly demonstrated signalling not only through the JNK as a critical mechanism of TNFα‐induced apoptosis (Kaufmann et al., 2009) but also in oxidative stress‐induced hepatocyte apoptosis (Czaja, 2002; Conde de la Rosa et al., 2006). Wang et al. particularly demonstrated that hepatic injury was markedly decreased in mice lacking JNK2 (Wang et al., 2006) although JNK1 has also been implicated in TNFα‐induced hepatitis (Chang et al., 2006). Additionally, JNK is essential for development of hepatitis and is required for TNFα expression in haematopoietic cells including resident inflammatory cells in the liver [e.g. Kupffer cells and natural killer T (NKT) cells] (Das et al., 2009). Administration of hesperetin attenuated hepatic activation of JNK as determined by Western blot analysis for phosphorylated JNK1/2 (Figure 7B). It has been demonstrated recently that JNK is also involved in necrotic cell death and that inhibition of JNK attenuates necrotic liver injury (Amir et al., 2012; Cubero et al., 2016). In our study, we observed activation (phosphorylation) of JNK and a reduction of JNK activation by hesperetin. Therefore, we conclude that hesperetin can directly inhibit necrotic cell death via inhibition of JNK activation. JNK can be activated by numerous agents, including TNFα, Fas/FasL, ROS and bile acids. Therefore, in our models of fulminant hepatitis, with increased expression of TNF and other inflammatory cytokines, as well as generation of ROS, it is very likely that JNK is activated via one or more of these ligands.

In contrast to the D‐GalN/LPS treatment, the major contributors to liver injury in the Con A model are non‐soluble membrane‐bound TNFα expressed on macrophages (Kupffer cells) (An et al., 2012) and IFN‐γ, expressed in T‐cells like NKT cells, which are particularly abundant in the liver. Indeed, high expression of several T‐cell cytokines, including IFN‐γ, IL‐4 and IL‐2 has been implicated in Con A‐induced hepatitis. Tagawa et al. showed that Con A hepatitis is suppressed in IFN‐γ−/− mice (Tagawa et al., 1997). In hepatitis B virus‐induced hepatitis, NKT cells are recruited to the hepatic parenchyma and contribute to inflammation by releasing cytokines like IL‐4 and IFN‐γ (Kakimi et al., 2000). In addition to having a direct toxic effect on hepatocytes, IFN‐γ may also sensitize liver cells to TNFα‐mediated toxicity. Of note, our data demonstrate that hesperetin significantly and dose‐dependently reduced serum levels and mRNA expression of IFN‐γ and serum level of IL‐4. These data support the conclusion that therapeutic administration of hesperetin can also be considered for immune‐mediated liver injury and that hesperetin also affects T‐cells.

The anti‐inflammatory action of hesperetin in Con A‐induced fulminant hepatitis is underscored by the reduction of iNOS, a marker for inflammation (Aram et al., 2008). This finding paralleled the in vitro observation, although in the Con A model, we did not distinguish between hepatocyte and Kupffer cell expression of iNOS. It is likely that expression of iNOS in both cell populations is reduced. Preliminary experiments indicate that hesperetin also reduces iNOS expression in the murine macrophage cell line RAW264.7 (data not shown).

In Figure 8, we propose a potential mechanism of the protective action of hesperetin in fulminant hepatitis. It is important to stress that we propose effects of hesperetin on both the inflammatory and T‐cell populations as well as on the hepatocytes. In summary, we have demonstrated the therapeutic potential of hesperetin in fulminant hepatitis, based on both anti‐inflammatory actions of hesperetin on inflammatory cells as well as direct cytoprotective effects of hesperetin on hepatocytes. Therefore, hesperetin has the potential to stop the vicious cycle of inflammation causing cell death and cell death leading to more inflammation, as observed in many inflammatory liver diseases. We propose that hesperetin is a promising candidate to be evaluated in clinical studies for the treatment of inflammatory liver diseases, including viral hepatitis, (non‐)alcoholic steatohepatitis and fulminant hepatitis.

Figure 8.

Figure 8

Open in a new tab

Potential mechanism of hesperetin in fulminant hepatitis. In acute and chronic liver injury, activation and infiltration of inflammatory cells (Kupffer cells, neutrophils) and death of functional hepatocytes occurs. Hesperetin protects hepatocytes from apoptotic cell death induced by TNFα/FasL, activating ‘death receptors’ and IFN‐γ, produced by T‐cells like NKT cells. Hesperetin has both anti‐inflammatory effects on inflammatory cells and protective effects on hepatocytes and these effects are independent. The anti‐apoptotic effects of hesperetin are in part due to reduced activation of the pro‐apoptotic MAPK JNK.

Author contributions

G.G.S, H.M., K.N.F. and X.T.B. designed the research study. X.T.B., P.X.Y., Q.L.Z. and X.J.L. acquired data. X.T.B., H.C., J.Y.J., D.F.S. and L.J.L. performed the animal experiments. B.Z.C. and M.B.H. assisted in the technical work. X.T.B. analysed data and wrote the manuscript. G.G.S., K.N.F. and H.M. revised the paper.

Conflict of interest

The authors declare no conflicts of interest.

Declaration of transparency and scientific rigour

This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research recommended by funding agencies, publishers and other organisations engaged with supporting research.

Acknowledgements

This study was supported by grants of the J. K. de Cock Foundation (UMCG, The Netherlands), the teamwork projects funded by Guangdong Natural Science Foundation (no. 9351503102000001), and the Chinese central government special funds supporting the development of local colleges and universities.

Bai, X. , Yang, P. , Zhou, Q. , Cai, B. , Buist‐Homan, M. , Cheng, H. , Jiang, J. , Shen, D. , Li, L. , Luo, X. , Faber, K. N. , Moshage, H. , and Shi, G. (2017) The protective effect of the natural compound hesperetin against fulminant hepatitis in vivo and in vitro . British Journal of Pharmacology, 174: 41–56. doi: 10.1111/bph.13645.

Contributor Information

Han Moshage, Email: a.j.moshage@umcg.nl.

Ganggang Shi, Email: ggshi@stu.edu.cn.

References

  1. Alexander SP, Fabbro D, Kelly E, Marrion N, Peters JA, Benson HE et al. (2015a). The Concise Guide to PHARMACOLOGY 2015/16: Enzymes. Br J Pharmacol 172: 6024–6109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alexander SP, Fabbro D, Kelly E, Marrion N, Peters JA, Benson HE et al. (2015b). The Concise Guide to PHARMACOLOGY 2015/16: Catalytic receptors. Br J Pharmacol 172: 5979–6023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Amir M, Liu K, Zhao E, Czaja MJ (2012). Distinct functions of JNK and c‐Jun in oxidant‐induced hepatocyte death. J Cell Biochem 113: 3254–3265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. An J, Harms C, Lattig‐Tunnemann G, Sellge G, Mandic AD, Malato Y et al. (2012). TAT‐apoptosis repressor with caspase recruitment domain protein transduction rescues mice from fulminant liver failure. Hepatology 56: 715–726. [DOI] [PubMed] [Google Scholar]
  5. Aram G, Potter JJ, Liu X, Torbenson MS, Mezey E (2008). Lack of inducible nitric oxide synthase leads to increased hepatic apoptosis and decreased fibrosis in mice after chronic carbon tetrachloride administration. Hepatology 47: 2051–2058. [DOI] [PubMed] [Google Scholar]
  6. Bailey RL, Gahche JJ, Miller PE, Thomas PR, Dwyer JT (2013). Why US adults use dietary supplements. JAMA Intern Med 173: 355–361. [DOI] [PubMed] [Google Scholar]
  7. Brenner C, Galluzzi L, Kepp O, Kroemer G (2013). Decoding cell death signals in liver inflammation. J Hepatol 59: 583–594. [DOI] [PubMed] [Google Scholar]
  8. Cai C, Chen Y, Zhong S, Ji B, Wang J, Bai X et al. (2014). Anti‐inflammatory activity of N‐butanol extract from Ipomoea stolonifera in vivo and in vitro. PLoS One 9: e95931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cha JY, Cho YS, Kim I, Anno T, Rahman SM, Yanagita T (2001). Effect of hesperetin, a citrus flavonoid, on the liver triacylglycerol content and phosphatidate phosphohydrolase activity in orotic acid‐fed rats. Plant Foods Hum Nutr 56: 349–358. [DOI] [PubMed] [Google Scholar]
  10. Chang L, Kamata H, Solinas G, Luo JL, Maeda S, Venuprasad K et al. (2006). The E3 ubiquitin ligase itch couples JNK activation to TNFalpha‐induced cell death by inducing c‐FLIP(L) turnover. Cell 124: 601–613. [DOI] [PubMed] [Google Scholar]
  11. Chen M, Gu H, Ye Y, Lin B, Sun L, Deng W et al. (2010). Protective effects of hesperidin against oxidative stress of tert‐butyl hydroperoxide in human hepatocytes. Food Chem Toxicol 48: 2980–2987. [DOI] [PubMed] [Google Scholar]
  12. Conde de la Rosa L, Schoemaker MH, Vrenken TE, Buist‐Homan M, Havinga R, Jansen PLM et al. (2006). Superoxide anions and hydrogen peroxide induce hepatocyte death by different mechanisms: involvement of JNK and ERK MAP kinases. J Hepatol 44: 918–929. [DOI] [PubMed] [Google Scholar]
  13. Conde de la Rosa L, Vrenken TE, Hannivoort RA, Buist‐Homan M, Havinga R, Slebos D‐J et al. (2008). Carbon monoxide blocks oxidative stress‐induced hepatocyte apoptosis via inhibition of the p54 JNK isoform. Free Radic Biol Med 44: 1323–1333. [DOI] [PubMed] [Google Scholar]
  14. Cubero FJ, Zoubek ME, Hu W, Peng J, Zhao G, Nevzorova YA et al. (2016). Combined activities of JNK1 and JNK2 in hepatocytes protect against toxic liver injury. Gastroenterology 150: 968–981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Curtis MJ, Bond RA, Spina D, Ahluwalia A, Alexander SPA, Giembycz MA et al. (2015). Experimental design and analysis and their reporting: new guidance for publication in BJP. Br J Pharmacol 172: 3461–3471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Czaja MJ (2002). Induction and regulation of hepatocyte apoptosis by oxidative stress. Antioxid Redox Signal 4: 759–767. [DOI] [PubMed] [Google Scholar]
  17. Das M, Sabio G, Jiang F, Rincón M, Flavell RA, Davis RJ (2009). Induction of hepatitis by JNK‐mediated expression of TNF‐α. Cell 136: 249–260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Dijkstra G, Blokzijl H, Bok L, Homan M, van Goor H, Faber KN et al. (2004). Opposite effect of oxidative stress on inducible nitric oxide synthase and haem oxygenase‐1 expression in intestinal inflammation: anti‐inflammatory effect of carbon monoxide. J Pathol 204: 296–303. [DOI] [PubMed] [Google Scholar]
  19. Guicciardi ME, Gores GJ (2005). Apoptosis: a mechanism of acute and chronic liver injury. Gut 54: 1024–1033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gujral JS, Liu J, Farhood A, Jaeschke H (2004). Reduced oncotic necrosis in Fas receptor‐deficient C57BL/6 J‐lpr mice after bile duct ligation. Hepatology 40: 998–1007. [DOI] [PubMed] [Google Scholar]
  21. Han D, Ybanez MD, Ahmadi S, Yeh K, Kaplowitz N (2009). Redox regulation of tumor necrosis factor signaling. Antioxid Redox Signal 11: 2245–2263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hase K, Xiong Q, Kadota S (2001). Hepatoprotective effect of plant components: inhibition of tumornecrosis factor‐α‐dependent inflammatory liver injury In: Atta ur Rahman. (ed.). Studies in Natural Products Chemistry, edn, Vol. 25 (part F). Elsevier: Amsterdam, The Netherlands, pp. 459–482. [Google Scholar]
  23. Iranshahi M, Rezaee R, Parhiz H, Roohbakhsh A, Soltani F (2015). Protective effects of flavonoids against microbes and toxins: The cases of hesperidin and hesperetin. Life Sci 137: 125–132. [DOI] [PubMed] [Google Scholar]
  24. Jung HA, Jung MJ, Kim JY, Chung HY, Choi JS (2003). Inhibitory activity of flavonoids from Prunus davidiana and other flavonoids on total ROS and hydroxyl radical generation. Arch Pharm Res 26: 809–815. [DOI] [PubMed] [Google Scholar]
  25. Kakimi K, Guidotti LG, Koezuka Y, Chisari FV (2000). Natural killer T cell activation inhibits hepatitis B virus replication in vivo. J Exp Med 192: 921–930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kanaze FI, Bounartzi MI, Georgarakis M, Niopas I (2007). Pharmacokinetics of the citrus flavanone aglycones hesperetin and naringenin after single oral administration in human subjects. Eur J Clin Nutr 61: 472–477. [DOI] [PubMed] [Google Scholar]
  27. Kaufmann T, Jost PJ, Pellegrini M, Puthalakath H, Gugasyan R, Gerondakis S et al. (2009). Fatal hepatitis mediated by tumor necrosis factor TNFalpha requires caspase‐8 and involves the BH3‐only proteins Bid and Bim. Immunity 30: 56–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kaur G, Tirkey N, Chopra K (2006). Beneficial effect of hesperidin on lipopolysaccharide‐induced hepatotoxicity. Toxicology 226: 152–160. [DOI] [PubMed] [Google Scholar]
  29. Khan MK, Zill EH, Dangles O (2014). A comprehensive review on flavanones, the major citrus polyphenols. J Food Compos Anal 33: 85–104. [Google Scholar]
  30. Kilkenny C, Browne W, Cuthill IC, Emerson M, Altman DG (2010). Animal research: reporting in vivo experiments: The ARRIVE guidelines. Br J Pharmacol 160: 1577–1579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kim EK, Choi E‐J (2010). Pathological roles of MAPK signaling pathways in human diseases. Biochim Biophys Acta 1802: 396–405. [DOI] [PubMed] [Google Scholar]
  32. Kim JY, Jung KJ, Choi JS, Chung HY (2004). Hesperetin: a potent antioxidant against peroxynitrite. Free Radic Res 38: 761–769. [DOI] [PubMed] [Google Scholar]
  33. Knekt P, Kumpulainen J, Jarvinen R, Rissanen H, Heliovaara M, Reunanen A et al. (2002). Flavonoid intake and risk of chronic diseases. Am J Clin Nutr 76: 560–568. [DOI] [PubMed] [Google Scholar]
  34. Kobayashi S, Tanabe S, Sugiyama M, Konishi Y (2008). Transepithelial transport of hesperetin and hesperidin in intestinal Caco‐2 cell monolayers. Biochim Biophys Acta 1778: 33–41. [DOI] [PubMed] [Google Scholar]
  35. Larrey D (1997). Hepatotoxicity of herbal remedies. J Hepatol 26: 47–51. [DOI] [PubMed] [Google Scholar]
  36. Li G, Chen MJ, Wang C, Nie H, Huang WJ, Yuan TD et al. (2014). Protective effects of hesperidin on concanavalin A‐induced hepatic injury in mice. Int Immunopharmacol 21: 406–411. [DOI] [PubMed] [Google Scholar]
  37. Li YM, Li XM, Li GM, Du WC, Zhang J, Li WX et al. (2008). In vivo pharmacokinetics of hesperidin are affected by treatment with glucosidase‐like BglA protein isolated from yeasts. J Agric Food Chem 56: 5550–5557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Malhi H, Guicciardi ME, Gores GJ (2010). Hepatocyte death: a clear and present danger. Physiol Rev 90: 1165–1194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. McGrath JC, Lilley E (2015). Implementing guidelines on reporting research using animals (ARRIVE etc.): new requirements for publication in BJP. Br J Pharmacol 172: 3189–3193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Namdeo AG, Syed SH (2014). Current status of natural products for the treatment of liver disease‐A review. IJPP 4: 7. [Google Scholar]
  41. Ogawa Y, Yoneda M, Tomeno W, Imajo K, Shinohara Y, Fujita K et al. (2012). Peroxisome proliferator‐activated receptor gamma exacerbates concanavalin A‐induced liver injury via suppressing the translocation of NF‐kappaB into the nucleus. PPAR Res 2012: 940384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Parhiz H, Roohbakhsh A, Soltani F, Rezaee R, Iranshahi M (2015). Antioxidant and anti‐inflammatory properties of the citrus flavonoids hesperidin and hesperetin: an updated review of their molecular mechanisms and experimental models. Phytother Res 29: 323–331. [DOI] [PubMed] [Google Scholar]
  43. Pari L, Shagirtha K (2012). Hesperetin protects against oxidative stress related hepatic dysfunction by cadmium in rats. Exp Toxicol Pathol 64: 513–520. [DOI] [PubMed] [Google Scholar]
  44. Parr AJ, Bolwell GP (2000). Phenols in the plant and in man. The potential for possible nutritional enhancement of the diet by modifying the phenols content or profile. J Sci Food Agric 80: 985–1012. [Google Scholar]
  45. Protzer U, Maini MK, Knolle PA (2012). Living in the liver: hepatic infections. Nat Rev Immunol 12: 201–213. [DOI] [PubMed] [Google Scholar]
  46. Sass G, Heinlein S, Agli A, Bang R, Schumann J, Tiegs G (2002). Cytokine expression in three mouse models of experimental hepatitis. Cytokine 19: 115–120. [DOI] [PubMed] [Google Scholar]
  47. Sass G, Soares MC, Yamashita K, Seyfried S, Zimmermann WH, Eschenhagen T et al. (2003). Heme oxygenase‐1 and its reaction product, carbon monoxide, prevent inflammation‐related apoptotic liver damage in mice. Hepatology 38: 909–918. [DOI] [PubMed] [Google Scholar]
  48. Schoemaker MH, Gommans WM, de la Rosa LC, Homan M, Klok P, Trautwein C et al. (2003). Resistance of rat hepatocytes against bile acid‐induced apoptosis in cholestatic liver injury is due to nuclear factor‐kappa B activation. J Hepatol 39: 153–161. [DOI] [PubMed] [Google Scholar]
  49. Schoemaker MH, Ros JE, Homan M, Trautwein C, Liston P, Poelstra K et al. (2002). Cytokine regulation of pro‐ and anti‐apoptotic genes in rat hepatocytes: NF‐kappaB‐regulated inhibitor of apoptosis protein 2 (cIAP2) prevents apoptosis. J Hepatol 36: 742–750. [DOI] [PubMed] [Google Scholar]
  50. Schoemaker MH, Conde de la Rosa L, Buist‐Homan M, Vrenken TE, Havinga R, Poelstra K et al. (2004). Tauroursodeoxycholic acid protects rat hepatocytes from bile acid‐induced apoptosis via activation of survival pathways. Hepatology 39: 1563–1573. [DOI] [PubMed] [Google Scholar]
  51. Schuppan D, Jia JD, Brinkhaus B, Hahn EG (1999). Herbal products for liver diseases: a therapeutic challenge for the new millennium. Hepatology 30: 1099–1104. [DOI] [PubMed] [Google Scholar]
  52. Southan C, Sharman JL, Benson HE, Faccenda E, Pawson AJ, Alexander SPH et al. (2016). The IUPHAR/BPS Guide to PHARMACOLOGY in 2016: towards curated quantitative interactions between 1300 protein targets and 6000 ligands. Nucl Acids Res 44 (Database Issue): D1054–D1068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Tagawa Y, Sekikawa K, Iwakura Y (1997). Suppression of concanavalin A‐induced hepatitis in IFN‐gamma(−/−) mice, but not in TNF‐alpha(−/−) mice: role for IFN‐gamma in activating apoptosis of hepatocytes. J Immunol 159: 1418–1428. [PubMed] [Google Scholar]
  54. Tindle HA, Davis RB, Phillips RS, Eisenberg DM (2005). Trends in use of complementary and alternative medicine by US adults: 1997‐2002. Altern Ther Health Med 11: 42–49. [PubMed] [Google Scholar]
  55. Wagner EF, Nebreda AR (2009). Signal integration by JNK and p38 MAPK pathways in cancer development. Nat Rev Cancer 9: 537–549. [DOI] [PubMed] [Google Scholar]
  56. Wang K (2014). Molecular mechanisms of hepatic apoptosis. Cell Death Dis 5: e996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Wang Y, Singh R, Lefkowitch JH, Rigoli RM, Czaja MJ (2006). Tumor necrosis factor‐induced toxic liver injury results from JNK2‐dependent activation of caspase‐8 and the mitochondrial death pathway. J Biol Chem 281: 15258–15267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Wolf AM, Wolf D, Rumpold H, Ludwiczek S, Enrich B, Gastl G et al. (2005). The kinase inhibitor imatinib mesylate inhibits TNF‐{alpha} production in vitro and prevents TNF‐dependent acute hepatic inflammation. Proc Natl Acad Sci U S A 102: 13622–13627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Zhou YC, Chen S, Cao JJ, Chen SY, Xie YF, Niu QX (2012). Adenovirus‐mediated viral interleukin‐10 gene transfer prevents concanavalin A‐induced liver injury. Dig Liver Dis 44: 398–405. [DOI] [PubMed] [Google Scholar]

Articles from British Journal of Pharmacology are provided here courtesy of The British Pharmacological Society

RESOURCES