Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 Mar 14.
Published in final edited form as: Arterioscler Thromb Vasc Biol. 2016 Jun 2;36(8):1598–1606. doi: 10.1161/ATVBAHA.116.307739

Central Role of P2Y6 UDP Receptor in Arteriolar Myogenic Tone

Gilles Kauffenstein 1, Sophie Tamareille 1, Fabrice Prunier 1, Charlotte Roy 1, Audrey Ayer 1, Bertrand Toutain 1, Marie Billaud 1, Brant E Isakson 1, Linda Grimaud 1, Laurent Loufrani 1, Pascal Rousseau 1, Pierre Abraham 1, Vincent Procaccio 1, Hannah Monyer 1, Cor de Wit 1, Jean-Marie Boeynaems 1, Bernard Robaye 1, Brenda R Kwak 1, Daniel Henrion 1
PMCID: PMC5350073  NIHMSID: NIHMS852999  PMID: 27255725

Abstract

Objective

Myogenic tone (MT) of resistance arteries ensures autoregulation of blood flow in organs and relies on the intrinsic property of smooth muscle to contract in response to stretch. Nucleotides released by mechanical strain on cells are responsible for pleiotropic vascular effects, including vasoconstriction. Here, we evaluated the contribution of extracellular nucleotides to MT.

Approach and Results

We measured MT and the associated pathway in mouse mesenteric resistance arteries using arteriography for small arteries and molecular biology. Of the P2 receptors in mouse mesenteric resistance arteries, mRNA expression of P2X1 and P2Y6 was dominant. P2Y6 fully sustained UDP/UTP-induced contraction (abrogated in P2ry6−/− arteries). Preventing nucleotide hydrolysis with the ectonucleotidase inhibitor ARL67156 enhanced pressure-induced MT by 20%, whereas P2Y6 receptor blockade blunted MT in mouse mesenteric resistance arteries and human subcutaneous arteries. Despite normal hemodynamic parameters, P2ry6−/− mice were protected against MT elevation in myocardial infarction–induced heart failure. Although both P2Y6 and P2Y2 receptors contributed to calcium mobilization, P2Y6 activation was mandatory for RhoA–GTP binding, myosin light chain, P42–P44, and c-Jun N-terminal kinase phosphorylation in arterial smooth muscle cells. In accordance with the opening of a nucleotide conduit in pressurized arteries, MT was altered by hemichannel pharmacological inhibitors and impaired in Cx43+/− and P2rx7−/− mesenteric resistance arteries.

Conclusions

Signaling through P2 nucleotide receptors contributes to MT. This mechanism encompasses the release of nucleotides coupled to specific autocrine/paracrine activation of the uracil nucleotide P2Y6 receptor and may contribute to impaired tissue perfusion in cardiovascular diseases.

Keywords: myocytes, smooth muscle, myogenic tone, myosin light chains, nucleotides, purinoceptor P2Y6, rhoA GTP-binding protein


Myogenic tone (MT) underlies the ability of small arteries to contract in response to increased internal pressure.1 This mechanism ensures constant organ perfusion, reducing flow as pressure increases, and increasing flow when pressure drops to prevent tissue damage and edema from elevated pressure in capillaries. Abnormal MT has been reported in vascular dysfunctions related to vasospasm,2 chronic heart failure (CHF),3 cardiomyopathies,4 and hypertension.5 Resetting of MT has been proposed as a valuable strategy to protect sensitive vascular territories.6

MT is an intrinsic property of smooth muscle cells (SMCs), occurring independently of neurohumoral or endothelial input. Pressure sensing in SMCs implicates an integrated mechanotransduction, allowing conversion of wall stress into cell contraction.6 Pressure induces conformational changes in extracellular matrix protein–binding adhesion sites in the cell membrane, mainly integrins.7 The mechanical stimulus is transmitted to the submembrane space through several mechanosensitive structures. The opening of stretch-operated channels results in cationic (predominantly Na+) current, sustaining membrane depolarization.6 The resulting secondary calcium entry through voltage-gated Ca2+ channels is essential for electromechanical coupling of MT. The molecular identity of cation channels leading to stretch-induced depolarization is unknown, but transient receptor potential channels may have a large role.8

Recent data suggest that G-protein–coupled receptors (GPCRs) contribute to MT,9 at the fore of which is angiotensin II (AngII) type 1 receptor.10 This receptor, proposed to be a mechanosensor activated in an agonist-independent manner,11 directly couples to transient receptor potential through the Gq-protein pathway. This scheme sequentially associates GPCRs and transient receptor potential channels, mediating the effects of pharmacological inhibitors of both entities on MT.10 However, several points remain to be clarified: the redundancy of the process with other GPCRs, the means of receptor activation, and the intracellular signaling pathways implicated.

In the vasculature, extracellular nucleotides participate in local control of blood flow through activation of P2 receptors. Two types of P2 receptors, ionotropic P2X1–7 and G-protein–coupled P2Y,1,2,4,6,11–14 bind both purine and pyrimidine.12 Activation of endothelial P2 receptors induces local vasorelaxation, whereas direct activation of vascular SMC receptors promotes vaso-constriction via P2X1 or pyrimidine-sensitive P2Y receptors.12 Besides the well-known granular ATP secretion by platelets and nerve terminals, nonvesicular release of nucleotides occurs in virtually all cells. Such release occurs on agonist, chemical, or mechanical stimulation, appearing to involve a variety of anionic pore-forming membrane proteins, such as pannexins, connexins, P2X7 receptor, or ATP-binding cassette transporters.13

Here, we assessed the contribution of extracellular nucleotides and specific P2 receptors to the development of pressure-induced MT.

Materials and Methods

Materials and Methods are available in the online-only Data Supplement.

Results

Expression of P2 Receptors in Mesenteric Resistance Arteries

We evaluated the expression pattern of P2 nucleotide receptors in mesenteric resistance arteries (MRAs) by quantitative reverse transcription polymerase chain reaction. P2Y6 was the most expressed P2Y receptor, followed by P2Y1 and P2Y2 and to a lesser extent P2Y12,13 and P2Y14 (no detectable P2Y4). Among P2X receptors, P2X1 was most expressed in MRAs, which is in agreement with previous work,14 followed by P2X7 and P2X4 and to a lesser extent P2X5; P2X6, P2X2, and P2X3 were barely detected (Figure 1A).

Figure 1.

Figure 1

Expression and vasoconstrictor function of P2Y6 receptor in mesenteric resistance arteries. A, Relative expression of P2Y and P2X receptors in mesenteric resistance arteries (MRAs) determined by quantitative real-time quantitative reverse transcription polymerase chain reaction (mean±SEM of 5 independent experiments). Dose-dependent contraction developed by endothelium-denuded MRAs in response to UDP (B), UDPβS (C), UTP (D), phenylephrine (PE; E), angiotensin II (AngII; F), endothelin-1 (G), and the stable thromboxane-A2 analog (U46619; H) was measured by wire myography. I and J, Dose-dependent relaxations in response to sodium nitroprusside (SNP) and acetylcholine (Ach) were measured on intact MRAs. Mean value±SEM of 5 to 8 independent experiments are shown.

Impaired Contraction in P2ry6−/− MRAs

The contractile response to the uracil nucleotide UDP, its nonhydrolyzable analog UDPβS, and UTP were abrogated in P2ry6−/− MRAs (Figure 1B through 1D). Concentration–response curves to phenylephrine, endothelin-1, AngII, and the stable thromboxane A2/PGH2 receptor agonist U46619 were unaffected by the absence of P2Y6 receptor (Figure 1E and 1H). Moreover, endothelium-dependent (acetylcholine) and endothelium-independent (sodium nitroprusside) relaxations were comparable in both mice strains (Figure 1I and 1J). As previously described in MRAs, ATP induced transient contraction through activation of the P2X1 ligand-gated channel.14 This response was prevented by pharmacological blockade (NF449) or desensitization (α,β-MeATP) of P2X1 receptor. P2X1 function was normal in P2ry6−/− arteries as shown by comparable contractile responses to α,β-MeATP (Figure I in the online-only Data Supplement).

Interference With Purinergic Signaling Impairs MT: Role of P2Y6 Receptors

Stepwise increases in pressure (10–75 mm Hg) induced MT in MRAs. This response was reproducible over time through 4 successive step increases (Figure II in the online-only Data Supplement). We compared the amplitude of successive myogenic responses after a 20-minute incubation period with inhibitors that interfered with purinergic signaling versus the appropriate vehicle. The ectonucleotidase inhibitor ARL67156 potentiated MT by 32% compared with control, whereas P2Y6 receptor blockers reactive blue-2 or MRS2578 blunted ≈50% of the response (Figure 2A and 2B). Pharmacological blockade of P2Y1 (MRS2179), P2Y2 (suramin), or P2X1 (NF449) receptors did not alter MT (Figure 2B). MT was strongly impaired in P2ry6−/− MRAs compared with those of P2ry6+/+ (Figure 2C through 2E). In human subcutaneous arteries, MT was significantly reduced by P2Y6 blockade with reactive blue-2 (Figure 2F).

Figure 2.

Figure 2

Interference with purinergic signaling affects myogenic response—exclusive contribution of P2Y6 receptor. A, Representative traces showing arterial diameter change after a step increase of intraluminal pressure (10–75 mm Hg). The ectonucleotidase inhibitor ARL67156 potentiates myogenic tone (MT), whereas a specific P2Y6 antagonist, MRS2578, inhibits MT (CT, no inhibitors). B, Quantification of the effect of ARL67156 (100 μmol/L); pharmacological antagonists of P2Y1 (MRS2179, 20 μmol/L), P2Y2 (suramin, 100 μmol/L), P2Y6 (reactive blue-2 [RB-2], 10 μmol/L; MRS2578, 10 μmol/L), and P2X1 (NF449, 10 μmol/L) receptors; and DMSO (MRS2578, vehicle) on MT. Data represent mean±SEM of 3 to 5 independent experiments. **P<0.005 and *P<0.05 (1-way ANOVA). Representative traces (C) and average of pressure-diameter relationship induced by step increases in intraluminal pressure (D). E, MT calculated as a percentage of contraction normalized to passive diameter (mean±SEM of 5 independent experiments). *P<0.05 and **P<0.005, P2ry6+/+ vs P2ry6−/−; #P<0.05 and ##P<0.005, P2ry6+/+ active vs passive diameter. F, MT developed by human cutaneous arteries with or without preincubation with the P2Y6 antagonist RB-2 (10 μmol/L). Data represent mean±SEM of 2 separate donors; **P<0.05. Graphs corresponding to the measurement of raw arterial diameter in pressurized human arteries are available in Figure XIV in the online-only Data Supplement. CBX indicates carbenoxolone; CT, control; FFA, flufenamic acid; and MFQ, mefloquine.

Elastic properties of MRAs—passive diameter, media thickness, cross-sectional compliance, distensibility, and passive wall tension—were not modified in P2ry6−/− mice (Figure III in the online-only Data Supplement). MT was decreased in P2ry6−/− arteries compared with P2ry6+/+vessels with comparable diameters (Figure IIIf in the online-only Data Supplement), confirming an intrinsic defect in contractility. P2Y6 receptor contribution to MT may vary along the vasculature. We measured P2Y6 receptor expression level, pharmacological contraction, and MT in tail arteries: in P2ry6−/−, when compared with P2ry6+/+, lower receptor expression correlated with the absence of uracil nucleotide–induced contraction (data not shown) and comparable MT (Figure IV in the online-only Data Supplement).

P2ry6 Deletion Protects Against Pathological Increase in MT

To evaluate the potential impact of P2Y6 receptor on blood pressure in vivo, we monitored cardiovascular parameters in conscious, freely moving mice. Three days of continuous recording showed no significant changes in blood pressure of P2ry6−/− animals, but heart rate slightly increased (Figure V in the online-only Data Supplement). In contrast, blood pressure in anesthetized (isoflurane) animals significantly increased. When subjected to AngII treatment (1 mg/kg per day for 3 weeks), P2ry6−/− mice displayed reduced hypertension compared with wild-type littermates (Figure VI in the online-only Data Supplement). Resistance to AngII-dependent hypertension was recently reported,15 consistent with a P2Y6 receptor effect on blood pressure regulation in pathological conditions.

CHF is known to induce increased peripheral vascular resistance, partly through enhanced MT.3 In P2ry6+/+animals, CHF (induced by coronary artery ligation; Figure VII in the online-only Data Supplement) was associated with a significant increase in MT ( range, 50–100 mm Hg), an increase not observed in P2ry6−/− animals (Figure 3A). Concentration–response curves to phenylephrine were comparable in both genotypes and not modified by CHF (Figure 3B).

Figure 3.

Figure 3

P2ry6 deletion prevents myogenic tone (MT) increase associated with chronic heart failure. Chronic heart failure (CHF) induced by permanent coronary artery ligation significantly enhanced MT in P2ry6+/+ but not P2ry6−/− in mice as shown by mesenteric resistance artery diameter changes (A) and calculated MT (B). C, Phenylephrine-induced contraction was equivalent in both genotypes and unaffected by CHF condition. Data represent mean±SEM of 4 to 6 experiments; *P<0.05 and **P<0.01 according to the genotype; #P<0.05 and ###<0.0005 according to the experimental group (CHF or control; 2-way ANOVA). PE indicates phenylephrine.

P2Y6 Receptor-Induced Signaling Pathways

Besides intracellular calcium mobilization, several signaling pathways participate in MT, including RhoA/Rho kinase, P38 and P42–P44 (extracellular signal–regulated kinases 1 and 2) mitogen-activated protein kinase, and PI3-kinase-γ.16–18 We evaluated the ability of P2Y6 receptor to trigger these pathways. UDP, UTP, and ATP induced intracellular calcium increase in wild-type arterial SMCs in a concentration-dependent manner. In P2ry6−/− cells, calcium mobilization was abrogated in response to UDP but only slightly diminished in response to UTP and normal in response to ATP, suggesting that P2Y2 receptors (UTP/ATP) are functional and can mobilize calcium in the absence of P2Y6 (Figure 4A). As the expression pattern of receptors in arterial SMCs may vary in culture, we compared nucleotide-induced calcium mobilization in freshly dissociated and early passage (P2) SMCs isolated from MRAs, which gave similar results (Figure VIII in the online-only Data Supplement).

Figure 4.

Figure 4

P2Y6 receptor signaling in arterial smooth muscle cells (SMCs) favors myogenic tone (MT). Dose–response curves measuring intracellular calcium were performed on FURA-2–loaded vascular SMCs isolated from P2ry6+/+ and P2ry6−/− mice. A, Compared with wild-type cells, P2ry6 deficiency abolished UDP-induced calcium increase and significantly reduced UTP response but did not affect ATP response in P2ry6−/− SMCs. Data represent mean±SEM of 3 experiments performed on independent cell cultures; *P<0.05 and **P<0.005 (2-way ANOVA). B, RhoA activation, measured through its GTP binding by pull-down, was absent in P2ry6−/− aortic rings after stimulation with UDP (100 μmol/L), UTP (100 μmol/L), and UDPβS (10 μmol/L) but remained unaffected after U46619 (1 μmol/L) stimulation. C, Reduced phosphorylation assessed by Western blot of MLC, P42–44, and c-Jun N-terminal kinase (JNK) kinases in arterial SMCs isolated from P2ry6−/− mesenteric resistance arteries and stimulated with UDP. Data represent mean±SEM of 3 experiments performed on independent cell cultures; *P<0.05 and **P<0.005 (2-way ANOVA). The P value according to the genotype is indicated. MLC indicates myosin light chain; P-ERK, phosphorylated form of extracellular signal-regulated kinase; and P-MYPT, phosphorylated form of myosin light chain phosphatase.

The active form (GTP bound) of the small G-protein RhoA was quantified by pull-down after nucleotide stimulation. UDP, UTP, or UDPβS increased GTP binding to Rho in aortic rings. This response was abrogated in P2ry6−/− arteries, whereas response to the thromboxane-A2 analog U46619 was preserved (Figure 4B).

In P2ry6+/+ SMCs, P2Y6 stimulation (UDP) induced concentration-dependent phosphorylation of myosin light chain associated with a trend toward increased myosin light chain phosphatase (ser-696 and ser-853) and mitogen-activated protein kinase extracellular signal–regulated kinase (P42–P44), P38, and c-Jun N-terminal kinase. These phosphorylations were abrogated in P2ry6−/− cells (Figure 4C; Figure X in the online-only Data Supplement).

Hemichannel-Dependent Nucleotide Release

Endogenous extracellular nucleotide release can occur through the opening of membrane pore-forming proteins belonging mainly to the Panx and Cx families. We evaluated the expression and potential contribution of these proteins to MT. Quantitative reverse transcription polymerase chain reaction performed on RNA isolated from mouse MRAs revealed the presence of Cx, commonly described in the vasculature (Cx37>Cx45≈Cx40>Cx43) and Panx1, but not in Panx2 and Panx3 (Figure 5A). Panx1 expression was further shown by immunolabeling (Figure XIII in the online-only Data Supplement). Pharmacological blockers of connexin channels (18α-glycyrrhetinic acid, flufenamic acid, and carbenoxolone) reduced MT significantly, whereas the more selective Panx1 blockers (probenecid, mefloquine, or 10Panx-blocking peptide) had no effect (Figure 5B), consistent with normal MT in Panx1−/− mice despite reduced phenylephrine-induced contraction (Figure 5C and 5D), as previously described.19 Although Cx37 deletion did not diminish MT (Figure 5E), the response was significantly reduced in Cx43+/− and P2rx7−/− animals (Figure 5F and 5G). MT was inhibited by KN62, a P2X7 antagonist (Figure 5B). However, P2rx7−/− arteries did not display obvious dysfunction, as shown by contraction and relaxation induced by phenylephrine and ACh, respectively (Figure XI in the online-only Data Supplement). ATP, BzATP (benzoylbenzoyl ATP; P2 receptor agonist with good affinity for P2X7), and α,β-MeATP (P2X1 receptor agonist) induced comparable contraction in P2rx7+/+ and P2rx7−/− mice arteries, suggesting the sole involvement of P2X1 in arterial contraction but no involvement of P2X7 receptors (Figure XI in the online-only Data Supplement).

Figure 5.

Figure 5

Functional hemichannels contribute to nucleotide release in myogenic response. A, Determination of the relative expression of vascular connexins and pannexins by quantitative reverse transcription polymerase chain reaction in mesenteric resistance arteries (MRAs). B, Effect of pharmacological inhibitors on myogenic tone (MT; 75 mm Hg). Inhibition of connexins by 18α-glycyrrhetinic acid (18αGA; 100 μmol/L), flufenamic acid (FFA, 100 μmol/L), and carbenoxolone (CBX, 100 μmol/L) reduced the MT in MRAs, as did a P2X7 antagonist, KN62 (0.3 μmol/L). Pharmacological inhibitors of the pannexins mefloquine (MFQ; 10 μmol/L), probenecid (2 mmol/L) and 10Panx peptide (200 μmol/L) did not affect the response. C, Panx1−/− mice display normal MT despite (D) altered contraction in response to phenylephrine. E, MT was slightly enhanced in cx37−/− arteries. F, MT is altered in cx43−/− (mean±SEM of 5 independent experiments) and (G) P2rx7−/− mice MRAs (mean±SEM of 5 independent experiments); *P<0.05, **P<0.01, and ***P<0.001 (2-way ANOVA). The graphs corresponding to the measurement of the raw arterial diameter in pressurized arteries is available in Figure XII in the online-only Data Supplement. PE indicates phenylephrine; and PSS, physiological salt solution.

Discussion

In addition to the well-described neurogenic release of ATP with noradrenaline that contributes to sympathetic tone, uracil nucleotides are vasoconstrictor mediators in many vascular territories through activation of P2Y2,4,6 receptors. Despite many in vitro investigations of purinergic signaling in the cardiovascular system, the pathophysiological implications remain misunderstood.12 In this study, we show that P2Y6 UDP receptor, the most expressed P2Y receptor in mouse resistance arteries, is required for maintaining proper arterial tone. This receptor fully supports in vitro arterial contraction in response to UDP and UTP and substantially contributes to MT through an autocrine/paracrine activation loop.

Our results indicate that MT was also sensitive to pharmacological inhibition of P2Y6 by reactive blue-2 in human subcutaneous arteries, suggesting that some human small arteries may develop MT, at least in part, through the mechanism described here.

This observation adds to the emerging concept that GPCRs participate in MT.9 A comprehensive scheme of P2Y6 receptor activation and its contribution to MT is represented in Figure 6.

Figure 6.

Figure 6

Functional scheme integrating extracellular nucleotide release and P2Y6-dependent pathway in myogenic tone. CaM indicates calmodulin; ERK, extracellular signal–regulated kinases; JNK, c-Jun N-terminal kinase; MLC, myosin light chain; MLCK, myosin light chain kinase; MLCP, myosin light chain phosphatase; PKC, protein kinase C; PLCβ, phospholipase C beta; and pMLP, phosphorylated myosin light chain.

As a Gq-coupled receptor, P2Y6 activates phospholipase-Cβ and increases intracellular calcium through inositol triphosphate-sensitive stores20 and protein kinase C activity through diacyl glycerol formation. We showed that calcium increase was abrogated in P2ry6−/− arterial SMCs (freshly dissociated and cultured cells) stimulated by UDP but only marginally affected after UTP/ATP stimulation. These results suggest efficient coupling of P2Y2 (UTP/ATP) receptor to calcium mobilization, whereas P2Y6 modestly contributes to this response. Unlike P2ry6−/− animals, P2ry2−/− mice did not display altered MT (Figure IX in the online-only Data Supplement) highlighting a nonredundant role of P2Y6 receptor in MT where intracellular calcium increase is minimally involved.21

P2Y6 receptor activation induced phosphorylation of mitogen-activated protein kinase, including P38, P42–44, and c-Jun N-terminal kinase. P38 is involved in MT17 and contributes to blood pressure rise after CHF, a condition characterized by elevated peripheral resistance with a major myogenic component. 22 In contrast, P42/44 extracellular signal–regulated kinase 1/2 is activated by cell stretch with no causal relationship with MT.23 c-Jun N-terminal kinase is a stress-activated protein kinase sensitive to UV irradiation, heat, and osmotic shock.24 P2Y6 receptor has also been implicated in the cellular response to these stresses25,26; thus, c-Jun N-terminal kinase activation by P2Y6 receptor may represent a cellular stress response, such as SMC response to stretch.

Gα12/13 proteins activate the small G-protein RhoA and constitute, with Rho-kinase, a calcium-sensitizing pathway, promoting myosin light chain phosphorylation through inhibition of phosphatase. GTP binding to RhoA in response to UDP/UTP was suppressed in P2ry6−/− mice. We have already shown that the RhoA–Rho kinase pathway contributes to MT.27 Thus, activation of the G12/13 Rho-kinase pathway may explain a large part of the exclusive contribution of P2Y6 to MT.

Although the real trigger of MT remains to be established, in physiology, maintenance of the response (myogenic contraction) is consistent with protection of downstream capillaries pressure overload: MT lasts when pressure remains elevated. How the same mechanism participates in both triggering and sustaining the response to pressure is an old debate. Although the molecular determinants remain to be identified, membrane tensegrity seems to be central to mechanosensation. Tensegrity stabilizes cell shape by providing continuous tension that depends on cytoskeletal integration of mechanical forces through interactions with the extracellular matrix and adhesion molecules; it results in tangential forces that develop at the membrane.28 The resulting signal transduction converges on actin–myosin interaction and cellular contraction.1 Our hypothesis (Figure 6) places the P2Y6 activation loop below mechanical perception, which should therefore be maintained as the tangential forces are applied to the membrane. Moreover, P2Y6 displays slow desensitization29; this, combined with the fact that the receptor activates the calcium-sensitizing pathway, suggests that a single activation after UDP release may last over time.

Mechanical strains are well known to trigger nucleotide release.30 Here, we propose that vascular cell stretch caused by a rise in intraluminal pressure induces the release of nucleotides that stimulate P2Y6 and promote SMC contraction. This hypothesis may diverge from recent data showing that AngII type 1 receptor can be activated by stretch in an agonist-independent manner.10 Key observations argue in favor of autocrine/paracrine nucleotide release rather than direct activation by stretch. First, diminishing extracellular nucleotide hydrolysis with an ectonucleoside triphosphate diphosphohydrolase-1 (or CD39) inhibitor, the dominant arterial ectonucleotidase, enhanced MT, in agreement with our previous work showing that MT is exacerbated in Entpd1−/− mouse arteries.31 Second, pharmacological interference with nucleotide-releasing molecules reduced MT similarly to P2Y6 receptor blockade or deletion, in accordance with the effect of a pharmacological connexin channel blockade on MT.32,33

Candidate protein-releasing nucleotides should be permeable to anions and mechanosensitive. Such properties are held by connexins and pannexins, suggesting that they open in response to mechanical forces.34 Unlike connexins, pannexins do not form cell-to-cell channels but only single-membrane channels.35 Notably, Panx1 is involved in ATP release in response to adrenergic receptor stimulation.19 Nevertheless, MT was not diminished in Panx1−/− arteries and not affected by Panx1 inhibitors, ruling out its contribution to MT.

Similarly, Cx37 can function as a hemichannel.36 A reverse relationship exists between Cx37 expression level and arterial diameter37; we found that Cx37 displayed the largest expression level in MRAs. However, MT was not reduced in Cx37−/− arteries—it was potentiated—ruling out its contribution in mechanosensitive-nucleotide release. However, MT was reduced in Cx43+/− mice arteries. Notably, the MRAs of Cx43−/− mice could not be studied because of the lethality of these mice at birth.38 The opening of Cx43 hemichannels may involve other partners, among them P2X7 receptors.39 MT was similarly reduced in MRAs from P2rx7−/− mice, and a pharmacological blockade of P2X7 strongly reduced it. P2X7 receptors can form large pores,40 and heterologous expression allows cells to release ATP in response to hypotonic swelling.41 The receptor has a long C-terminal cytoplasmic tail that binds to integrins or cytoskeletal elements (α-actin, α-actinin, supervillin)42 putatively implicated in mechanosensation. These data suggest that the P2X7 opening is sensitive to membrane stretch. P2Y6 and P2X7 receptors are characterized by slow desensitization29,40; thus, their contribution to MT may occur in a nontransient manner. Their sensitivity to mechanical deformation and their ability to release nucleotides suggest that P2X7 and Cx43 are involved in MT through cellular nucleotide release. A direct molecular association of the 2 proteins was described in macrophages39 and could potentially occur in arterial SMCs. Moreover, Cario-Toumaniantz et al43 reported P2X7-dependent vascular contraction in human saphenous veins: P2X7 activation formed membrane pores permeable to large molecules, promoting myocyte contraction followed by cell lysis when stimulation was maintained. For unknown reasons, we did not observe P2X7-dependent contraction in our setting (Figure XI in the online-only Data Supplement). P2X7 receptor was initially described as an apoptosis promotor; since then, it has been implicated in many complex cellular processes, including potassium efflux and NLRP3/inflammasome activation,44 transglutaminase-2 secretion,45 permeability to chloride,46 and amyloid precursor protein secretion.47 Intriguingly, these mechanisms could be dissociated from cellular depolarization. Hence, P2X7 function remains enigmatic; characterization of its activation mechanism in the context of MT represents a challenging future investigation.

Thus, besides the existing therapeutic tools targeting arterial tone, drugs targeting P2Y6 or associated pressure-sensitive pores could more selectively target MT. This is especially important as MT so far cannot be selectively targeted, although resetting it may represent a new therapeutic option.6 The emergence of GPCRs, such as sphingosine-1-phosphate, prostanoids, cysteinyl leukotriene, or AngII receptors9,48 as MT modulators, may offer such opportunity.

As demonstrated in this study, purinergic signaling, often presented as a danger signal,49 is involved in acute arterial response to pressure. This may be important in various vascular disorders at the foreground CHF, a condition associated with increased peripheral vascular resistance and exacerbated MT.3 We found that the absence of P2Y6 receptor protects against the increase in MT in heart failure after myocardial infarction. In the long-term, chronic overstimulation of P2Y6 may play a role not only in defective tissue perfusion (ie, brain)50 but also in deleterious arterial remodeling associated with ischemic/inflammatory arteriopathies.51 Interestingly, recent investigations reported that P2Y6 is also involved in long-term arterial remodeling associated with aging and hypertension through specific synergistic interaction with AngII receptors.15 Altogether these data indicate that P2Y6 receptor might constitute a valuable target in vascular diseases associated with impaired tissue perfusion.

We describe a new mechanism contributing to MT development that shares a common pathway with cellular stress (inflammation and swelling). GPCRs to date represent the target for nearly half of currently available drugs, but drugs exploit only a limited number of receptors52; thus, unraveling the expression and contribution of arterial GPCRs is mandatory. Specific targeting of P2Y6 may be advantageous in a pathological context in which MT is impaired (heart failure, diabetes mellitus, and hypoxia).

METHODS

Ethical policies

The investigation for animals handling was performed in agreement with the guidelines from Directive 2010/63/EU of the European Parliament on the protection of animals used for scientific purposes (authorization of the laboratory # 00577). Human subjects gave informed consent that was approved by an institutional review committee.

Chemicals

18α-glycyrrhetinic acid, flufenamic acid, carbenoxolone, probenecid, mefloquine (QUO24-1, Bioblocks, CA, USA). Reactive Blue-2 (RB-2) was from Tebu (Le Perrayen-Yvelines, France). Antagonists, NF449, MRS2578, MRS2179, ARL67156 and suramin were from Tocris Bioscience (R&D Systems Europe, Lille, France). Other compounds were purchased from Sigma Aldrich (Saint Quentin Fallavier, France). Stock solutions of drugs were prepared according to the manufacturers’ protocol, and appropriate vehicle controls were used. The effect of pharmacological blockers was tested after an incubation period of at least 15 minutes vs control vehicle.

Animals

Mice genetically invalidated for P2Y6 (P2ry6−/−), P2Y2 (P2ry2−/−), P2X7 (P2rx7−/−), pannexin1 (panx1−/−), connexin37 (Cx37−/−) 1 and connexin43 (Cx43+/−) were generated as previously described 2–4. All animals were manipulated in accordance with the European Community Standards on the Care and Use of Laboratory Animals (Ministère de l’Agriculture, France, authorization No. 6422). The protocol was approved by the Committee on the Ethics of Animal Experiments of “Pays de la Loire” (permit # CEEA.2011.14).

Quantitative real time reverse transcription-polymerase chain reaction (RT-PCR) analysis

Mesenteric arterial field were dissected in ice cold PSS, dried and stored at −20°C in RNAlater Stabilization Reagent (Qiagen). RNA extraction was performed using the RNeasy® micro kit (Qiagen). 100 ng of RNA extract were used to synthesize cDNA using the QuantiTect® Reverse Transcription kit (Qiagen). Quantitative real-time PCR was performed with Sybr® Select Master Mix (Applied Biosystems) using a Light cycler 480 Real-Time PCR System (Roche). Primer pairs were designed using primer 3 and those presenting a single peak of dissociation and an efficacy ranging from 1.85 to 2.1 were retained (Table 1). Gapdh, Gusb and Hprt were used as housekeeping genes for normalisation. Results were expressed as: 2(Ct target gene − Ct mean of ref genes).

Table 1.

Gene Protein Gene ID Amplicon size Primers sequence
forward reverse
Gapdh GAPDH NM_008084.2 121 ccggggctggcattgctctc ggggtgggtggtccagggtt
Gusb GUSB NM_010368.1 72 ctctggtggccttacctgat cagttgttgtcaccttcacctc
Hprt HPRT NM_013556.2 125 ggggtgggtggtccagggtt aagacattctttccagttaaagttgag
Gja4 Connexin37 NM_008120 59 tcctgggaaaaagcactgat ctgtgtctgtccaggtgacg
Gja1 Connexin43 NM_010288.3 86 tcctttgacttcagcctcca ccatgtctgggcacctct
Gja5 ter Connexin40 NM_008121.2 64 acaggagttctggtgaacagg ctagcaggcgagtcaggaag
Gjc1 (Gja7) Connexin45 NM_001159382.1 70 acaggagttctggtgaacagg ctagcaggcgagtcaggaag
P2rx1 P2X1 NM_008771.3 86 ccgaagccttgctgagaa ggtttgcagtgccgtacat
P2rx2 P2X2 NM_153400.3 77 agtcagcatcatcaccagga ctgtgaaccctcatgctctct
P2rx3 P2X3 NM_145526 77 catcattcccaccatcatca aggatgatgtcacagagaacagtc
P2rx4 P2X4 NM_011026.2 89 ccaacacttctcagcttggat tggtcatgatgaagagggagt
P2rx5 P2X5 NM_033321.3 77 cacagtcatcaacattggttcc aggtagataagtaccaggtcacagaag
P2rx6 P2X6 NM_011028.2 64 tgtccccagtactccttcca caccagtgattggctgtcc
P2rx7 P2X7 NM_011027.2 76 ctggttttcggcactgga ccaaagtaggacagggtgga
P2ry1 P2Y1 NM_008772.4 60 ctgtgtggaccccattcttt tcgggacagtctccttctga
P2ry2 P2Y2 NM_008773.3 127 tgcgctgatgaactttgttt ggcaggaaacaggaagaaca
P2ry4 P2Y4 NM_020621.3 114 gaagaagcagcagaacacca caaggagtctgcactggtca
P2ry6 P2Y6 NM_183168.1 80 tcttccatcttgcatgagaca ggatggtgccattgtcct
P2ry12 P2Y12 NM_027571.3 94 gagacactcatatccttcagattcag tcgggacagtctccttctga
P2ry13 P2Y13 NM_028808.3 60 atgtgtgagatggggaaagg gtcccaggggagaaggtg
P2ry14 P2Y14 NM_001008497.2 59 ctttgcctccagaggtgaga ggctggtttggagggtct
Panx1 pannexin-1 NM_019482.2 61 agaccaagggagaggacca gctgctcaggtccaaatctt
Panx2 pannexin-2 NM_001002005.2 122 gtaccccctgccctacca gatttccttctcggggagtg
Panx3 pannexin-3 NM_172454.2 63 gaaatctctctggcctcacaa atacatggccacagccaga

Animal model of heart failure

Heart failure (HF) was induced by experimental myocardial infarction. Preoperative analgesic buprenorphine injection (Temgesic® 0.1mg/kg subcutaneous) was performed. Animals were anaesthetized by intraperitoneal injection of a mixture of ketamine (50 mg/kg) and Xylazine (6 mg/kg) and intubated-ventilated at 120–130 breaths per minute (tidal volume 200 μL). Myocardial infarction was performed by permanent ligation of the left anterior descending coronary artery. In sham-operated controls, the thorax and pericardium were opened, but no ligation was performed. After either procedure, the chest was closed and the mice were extubated and allow recovering on spontaneous respiration. After 6 to 8 weeks, mice developed altered left ventricular dilatation and reduced shortening fraction.

Functional analysis of MRA

Animals were sacrificed by CO2 inhalation. Mesenteric arteries were dissected in ice-cold physiological salt solution (PSS) of the following composition (mmol/L): 130.0, NaCl; 15.0, NaHCO3; 3.7, KCl; 1.6, CaCl2; 1.2, MgSO4 and 11.0, glucose.

Pharmacological study was performed on 2-mm-long arterial segments mounted on a wire-myograph (DMT, Aarhus, DK) 5. Cumulative concentration-dependent contraction was tested on arteries with a disrupted endothelium (flushed with 1ml Triton X-100 0.04 %). Cumulative concentration-response curve to acetylcholine was performed on arteries contracted with phenylephrine (1 μM). Endothelium-independent relaxation was tested at the end of the protocol in response to the nitric oxide donor, sodium-nitroprusside (SNP).

For pressure myography, third order mesenteric arteries (internal diameter 140–220 μm) were cannulated between two glass pipettes and bathed in PSS (pH 7.4, PO2 160 mmHg, and PCO2 37 mmHg). Pressure was controlled by a servo-perfusion system and diameter changes and arterial wall thickness were measured continuously. MT was determined in response to stepwise increases in intra luminal pressure from 10 to 125 mmHg using a video-monitored perfusion system (LSI) 6. At each pressure, a 5–6 min-equilibration period was allowed to achieve stable vessel diameter. The experiment was repeated with Ca2+-free PSS containing ethylenbis-(oxyethylenenitrolo) tetra-acetic acid EGTA (2 mM), the non specific phosphodiesterases inhibitor papaverin (100 μmol/L) and sodium nitroprusside (10 μM) to ensure complete arterial relaxation, and the passive diameter was recorded for each pressure. MT at a given perfusion pressure was defined as the magnitude of the percent myogenic tone (%MT) at that pressure. The %MT was expressed by the active (AD) and passive vessel diameters (PD) such that %MT = [(PD − AD)/PD] · 100%.

Calcium mobilization assay

Early passages (P3–4) VSMC cultures prepared from enzymatically digested mesenteric arteries were used for in vitro experiments 7. Cells were cultured in DMEM supplemented with 10% FBS and antibiotics. Intracellular calcium mobilization was measured on Fura-2-acetoxymethyl ester (Invitrogen) loaded cells. Dual excitation at 340/380 nm with single emission at 510 nm was assessed using a Flexstation-3 Microplate Reader (Molecular Devices). Data represent area under the curve of the ratio 340/380 signal normalized to maximal signal obtained by cells permeabilization with 0.1% saponine.

Freshly dissociated cells were used to avoid any bias linked to cell culturing. Smooth muscle cells were dissociated from arteries using a HEPES-buffered isolation solution containing: (in mM) 140 NaCl, 80 sodium glutamate, 5.6 KCl, 2 MgCl2, 10 HEPES, and 10 glucose (pH 7.35 with NaOH). Briefly, mesenteric arteries were placed into isolation solution containing 1 mg/ml papain, 1 mg/ml dithioerythreitol and 1 mg/ml bovine serum albumin (BSA) for 25 minutes at 37°C. Arteries were then immediately transferred to isolation solution containing 0,7 mg/ml collagenase F and 0,3 mg/ml collagenase H (Sigma), 100 μM CaCl2 and 1 mg/ml BSA for 8 minutes at 37°C. Arteries were subsequently washed in isolation solution and dispersed using a pipette to yield single smooth muscle cells. Cells were allowed to adhere in 96 well micro plate coated with type I rat-tail collagen (Santa Cruz) in DMEM cultured medium containing 10% FBS and antibiotics for one night. Intracellular calcium mobilization was measured as described above.

Measurement of GTP-bound RhoA

RhoA activation was assessed in agonists-stimulated aorta. Thoracic aortas were dissected from perivascular fat and adventitial tissue in icecold PSS and the endothelium was disrupted by perfusion of PSS containing Triton X-100 (0.04 %, 1mL). Aortic rings (2 mm) were stimulated for 10 min in 37°C heated PSS containing nucleotides or the thromboxane A2 analogue U46619. Tissues were snap frozen in liquid nitrogen, reduced to powder and resuspended in ice-cold homogenization buffer. GTP-bound RhoA content was determined with using G-LISATM (Cytoskeleton, Denver, CO) according to the manufacturer instructions.

Western Blot

Smooth muscle cells were obtained from the whole mesentery arterial bed. After removing adventitial peripheral fat with thin forceps MRA were enzymatiquely digested using elastase (0.125 U/ml) and collagenase (2 U/ml) (Worthington, Lakewood NJ) over night at 37°C with agitation in DMEM medium without serum. Cells between P2 and P4 were seeded in 48 well plates and starved once reached 80% of confluence for 12h. Stimulation was performed for 3 min at 37°C stopped with ice cold PBS and directly lysed and homogenized in loadding Buffer: 1% SDS, 10 mmol/L Tris, 1mmol/L Sodium orthovanadate 1 mmol/L, Sodium fluoride 10 mmol/L, β-glycerophosphate 10 mmol/L, complete protease inhibitor cocktail (Roche), 5% β-mercapto ethanol. After boiling 5 min at 90°C, proteins were separated by SDS-PAGE (12% acrylamide) and transferred to nitrocellulose membranes (GE Healthcare). Membranes were analyzed for phosphorylated proteins using the appropriated antibodies (Table 2).

Table 2.

Target protein Reference Provider
Phospho-p38 (Thr180/Tyr182) 4511 Cell Signaling Technology
p38 MAPK 9212 Cell Signaling Technology
Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) 9101 Cell Signaling Technology
ERK1 610031 BD biosciences
Phospho-Akt (Ser473) 4060 Cell Signaling Technology
Akt (pan) (C67E7) 4691 Cell Signaling Technology
Phospho-MYPT-1 (Thr850) 04–773 Merck Millipore
Phospho MYPT-1 (Thr 696) sc-17556 Santa Cruz Biotechnology
MYPT-1 612164 BD biosciences
Phospho-SAPK/JNK (Thr183/Tyr185) 9251 Cell Signaling Technology
JNK1 551197 BD biosciences
Phospho-Myosin Light Chain 2 (Thr18/Ser19) 3674 Cell Signaling Technology
Myosin Light Chain 2 3672 Cell Signaling Technology
Beta-Actin A5316 SIGMA-ALDRICH

Statistical analyses

Data are presented as mean ± SEM. Statistical analyses were performed using Graphpad PRISM (La Jolla, CA, USA). Differences between groups were assessed using two-way ANOVA followed by Fisher’s LSD Multiple-Comparison Test except for single dose of inhibitors comparison where one-way ANOVA was used. P values <0.05 were considered statistically significant.

Supplementary Material

supplement methods
supplemental files

Online Figure I. Representative traces illustrating that the stable ATP analogue, ATPγS, induces contraction of MRA through the exclusive involvement of P2X1 receptor. (a) The response to ATPgS stimulation (●) was not observed after P2X1 receptor desensitization (αβMeATP 10 μM) nor in the presence of P2X1 receptor antagonist (NF449 10 μM). (b) Pic contraction elicited by P2X1 activation in P2ry6−/− arteries is comparable to the one measured in P2ry6+/+arteries. Values are reported as means ± SEM of 5 to 8 independent experiments.

Online Figure II. Reproducibility of the myogenic contraction induced by a single step increase from 10 to 75 mmHg in mouse MRA. The level of contraction was stable for 4 successive protocols. Upper panel: representative traces. Lower panel: quantification of four independent experiments ± SEM

Online Figure III. Comparison of elastic properties of mesenteric arteries isolated from P2ry6−/− compared to wild type mice P2ry6+/+. (a) Passive arterial diameter, (b) arterial wall thickness, (c) cross sectional compliance, (d) distensibility and (e) passive wall tension were evaluated on MRA following step increase of intraluminal pressure using a pressure myograph. Mean ± SEM of 10 arteries from 5 different mice. (f) Correlation between passive arterial diameter and MT illustrates that MT is systematically lower in P2ry6−/− MRA with equivalent diameter to P2ry6+/+.

Online Figure IV. (a) Comparison of the expression levels of P2Y6 receptor by RTqPCR in thoracic aorta (Tho Ao), mesenteric resistance artery (MRA), tail caudal artery (CA) and kidney. Lower panel shows equivalent MT in P2ry6+/+ and P2ry6−/− caudal artery. Values represent the mean ± SEM of 7 independent experiments.

Online Figure V. Hemodynamic parameters were measured in conscious mice using telemetric implants. Arterial pressure (systolic, mean, diastolic) and heart rate are shown as 24h mean values (a) or separated according to day and night (b). Arterial pressure was not different between P2ry6−/− and wild type mice and both genotypes displayed a circadian rhythm with enhanced values at night time (b, * indicates p<0.05 vs. day). Heart rate was significantly increased in P2ry6−/− animals (indicated by #). Data represent mean ± SEM of parameters registered on 4 separate animals of each genotype. Values were collected for 3 consecutive days and a mean value was calculated for each animal from these data.

Online Figure VI. Mice were treated with Angiotensin-II (1mg/kg/day, Alzet sub cutaneous osmotic pump) for 21 days. Mean arterial blood pressure was measured under isoflurane anesthesia using intra arterial catheter connected to a pressure transducer and a blood Pressure Analyser-200A (Micro-Med, Tustin, CA).

Online Figure VII. Chronic heart failure (CHF) was evaluated by cardiac dysfunction and gross cardiac morphology 6–8-weeks after permanent coronary artery ligation. a Left ventricular diastolic dimension (LVEDD) and b fractional shortening were determined using echocardiography (n=4 in each group). Mice were sacrificed one week after echocardiography and cardiac gross morphology was analyzed. c Representative hearts with and without CHF from P2rY6+/+ and P2rY6−/− mice. d Left ventricle (LV) weight/body weight ratio showing LV hypertrophy. Data are expressed as mean ± sem. *P<0,05 vs. same genotype without CHF.

Online Figure VIII. Comparison of intracellular calcium mobilization measured on freshly dissociated (left) or cultured vascular SMCs (right) isolated from P2ry6+/+ and P2ry6−/− mouse MRA. (a, b) Basal fluorescence ratio (FURA-2 ex 340/380; em 510 nm) as a indicator of resting intracellular calcium level was not modified by P2Y6 receptor deletion in cultured or dissociated cells. (c, d) Tracings representing the kinetic of calcium mobilization (F/F0 ratio) induced by the indicated nucleotides (UDP, ATP, UTP 10 μM, 1min injection). (e, f) quantification of intracellular calcium mobilization as measured by the area under the curve (AUC) of the F/F0 signal (represented in c and d). Data represent the mean ± SEM of experiments performed in duplicate on 3 independent primary cell cultures or triplicate dissociated cell preparations, *P<0.05 (2-way ANOVA).

Online Figure IX. MT developed by MRA from P2Y2 deficient mice (P2ry2−/−) was not altered compared to the response of their wild type littermates (P2ry2+/+) (mean ± SEM of 5 independent experiments).

Online Figure X. Representative western blots of protein phosphorylation in P2ry6+/+ vs P2ry6−/− arterial SMCs. Cells were stimulated with UDP (1, 10, 100 μM) for 5 min, lysed and protein were analyzed for phosphorylation using specific antibodies (see Table 2).

Online Figure XI. Arterial reactivity of P2rx7−/− mice was evaluated with a pressure myograph. (a) Phenylephrine (PE)-dependent contraction and acetylcoline (ACh)-dependent relaxation are not affected in P2rx7−/− arteries as compared to their control. Data represent the mean ± SEM of 11 arteries from 5 different mice. (b) Kinetic of contraction of arteries from P2rx7+/+ (black) vs P2rx7−/− (red) mice in response to ATP, P2X7 agonist BzATP (100 μM), and P2X1 agonist αβMeATP (10 μM). Data represent the mean ± SEM of n=3 to 5.

Online Figure XII. Myogenic Tone evaluation in MRA from Panx1−/−; Cx37−/−; Cx43+/− and P2rx7−/− mice was determined using a pressure myograph as described in the experimental section. Left panels represent arterial diameter monitoring following step pressure increases in intraluminal pressure in active and passive (PSS 0 calcium, EDTA, plus sodium nitroprusside and papaverine) conditions. Right panels represent the MT as a percentage of contraction normalized to passive diameter. Data represent mean ± SEM of 5 to 13 independent experiments as indicated in the legend (*** p < 0.001; ** p < 0.01; * p < 0.05).

Online Figure XIII. Expression of Panx1 but not Panx2 or Panx3 was evidenced by immunofluorescence and immunolabelling coupled to transmission electron microscopy (TEM) in MRA and quantified by the number of beads/μm2 in endothelial cells (EC), myoendothelial junction (MEJ) and vascular SMC (upper panel). The immunostaining represents Panx1 in red, autofluorescence of the internal elastic lamina (IEL) in green and DAPI (nuclei) in blue. Scale bar for immune-TEM is 1 μm, for ICC is 10 μm and asterisks indicates the lumen of the vessel.

Online Figure XIV. Myogenic Tone evaluation in human cutaneous arteries was determined using a pressure myograph as described in the experimental section. Left panels represent arterial diameter monitoring following step pressure increases in intraluminal pressure in active and passive (PSS 0 calcium, EDTA, plus sodium nitroprusside and papaverine) conditions. Right panels represent the MT as a percentage of contraction normalized to passive diameter. Data represent the mean ± SEM of 2 separate donors, ****P<0.0001.).

Highlights.

  • Tissue perfusion, vascular resistance, and microcirculation integrity rely on pressure-induced myogenic tone. Many aspects of mechanotransduction underlying myogenic tone remain undefined.

  • Cellular nucleotides are danger signals released in cell stress conditions, including mechanical strain.

  • Several P2 nucleotide receptors are expressed in vascular smooth muscle cells and coupled to vasocontraction, including P2Y6 receptors.

  • P2Y6 is the most expressed P2Y receptor in resistance arteries and is mandatory for uracil (UTP and UDP) nucleotide–mediated constriction.

  • P2Y6 activation is characterized by Rho-kinase pathway activation, moderated calcium mobilization, and mitogen-activated protein kinase triggering.

  • P2Y6 receptors contribute to myogenic tone in physiological conditions and chronic heart failure, a condition associated with exaggerated arterial tone and vascular resistance.

  • P2Y6 receptor activation occurs after endogenous nucleotide release through cellular hemichannels, likely involving connexin43 and P2X7 receptor but not connexin37 or pannexin.

  • A clear understanding of the cellular and molecular determinants of myogenic tone is lacking. Combining a pharmacological with a gene-targeting approach, we demonstrate the contribution of extracellular nucleotides to this process. Nucleotides can be released by cellular strain and signal danger in inflammatory disease and thrombosis. We show that extracellular nucleotides participate in tonic control of resistance arteries in response to pressure increase through autocrine activation of G-protein–coupled receptor P2Y6. Identification of such partners in the myogenic process may lead to new therapeutic approaches in the treatment of vascular ischemic disorders.

Acknowledgments

We thank Jean Kanellopoulos for providing P2rx7−/− mice and Jennifer Deschamps and Celine Beaujean for maintenance and care of animals.

Sources of Funding

MITOVASC was supported by INSERM, CNRS, University of Angers, CHU of Angers, Région Pays de la Loire, Angers-Loire Métropole, and Département du Maine et Loire. This work was supported by grants from the Fondation Lefoulon Delalande and Fondation pour la Recherche Médicale (V. Procaccio, D. Henrion, and G. Kauffenstein, contract no. 20121125554) and the Swiss National Science Foundation (310030_143343 and 310030_162579 to B.R. Kwak).

Nonstandard Abbreviations and Acronyms

AngII

angiotensin II

CHF

chronic heart failure

GPCR

G-protein–coupled receptor

MRA

mesenteric resistance artery

MT

myogenic tone

SMC

smooth muscle cell

Footnotes

References

  • 1.Davis MJ, Hill MA. Signaling mechanisms underlying the vascular myogenic response. Physiol Rev. 1999;79:387–423. doi: 10.1152/physrev.1999.79.2.387. [DOI] [PubMed] [Google Scholar]
  • 2.Cipolla MJ, Curry AB. Middle cerebral artery function after stroke: the threshold duration of reperfusion for myogenic activity. Stroke. 2002;33:2094–2099. doi: 10.1161/01.str.0000020712.84444.8d. [DOI] [PubMed] [Google Scholar]
  • 3.Gschwend S, Henning RH, Pinto YM, de Zeeuw D, van Gilst WH, Buikema H. Myogenic constriction is increased in mesenteric resistance arteries from rats with chronic heart failure: instantaneous counteraction by acute AT1 receptor blockade. Br J Pharmacol. 2003;139:1317–1325. doi: 10.1038/sj.bjp.0705367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Maron BJ, Wolfson JK, Epstein SE, Roberts WC. Intramural (“small vessel”) coronary artery disease in hypertrophic cardiomyopathy. J Am Coll Cardiol. 1986;8:545–557. doi: 10.1016/s0735-1097(86)80181-4. [DOI] [PubMed] [Google Scholar]
  • 5.Izzard AS, Bund SJ, Heagerty AM. Myogenic tone in mesenteric arteries from spontaneously hypertensive rats. Am J Physiol. 1996;270(1 pt 2):H1–H6. doi: 10.1152/ajpheart.1996.270.1.H1. [DOI] [PubMed] [Google Scholar]
  • 6.Hill MA, Meininger GA, Davis MJ, Laher I. Therapeutic potential of pharmacologically targeting arteriolar myogenic tone. Trends Pharmacol Sci. 2009;30:363–374. doi: 10.1016/j.tips.2009.04.008. [DOI] [PubMed] [Google Scholar]
  • 7.Davis MJ, Wu X, Nurkiewicz TR, Kawasaki J, Davis GE, Hill MA, Meininger GA. Integrins and mechanotransduction of the vascular myogenic response. Am J Physiol Heart Circ Physiol. 2001;280:H1427–H1433. doi: 10.1152/ajpheart.2001.280.4.H1427. [DOI] [PubMed] [Google Scholar]
  • 8.Earley S, Brayden JE. Transient receptor potential channels in the vasculature. Physiol Rev. 2015;95:645–690. doi: 10.1152/physrev.00026.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kauffenstein G, Laher I, Matrougui K, Guérineau NC, Henrion D. Emerging role of G protein-coupled receptors in microvascular myogenic tone. Cardiovasc Res. 2012;95:223–232. doi: 10.1093/cvr/cvs152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Mederos y Schnitzler M, Storch U, Gudermann T. At1 receptors as mechanosensors. Curr Opin Pharmacol. 2011;11:112–116. doi: 10.1016/j.coph.2010.11.003. [DOI] [PubMed] [Google Scholar]
  • 11.Zou Y, Akazawa H, Qin Y, et al. Mechanical stress activates angiotensin II type 1 receptor without the involvement of angiotensin II. Nat Cell Biol. 2004;6:499–506. doi: 10.1038/ncb1137. [DOI] [PubMed] [Google Scholar]
  • 12.Burnstock G, Ralevic V. Purinergic signaling and blood vessels in health and disease. Pharmacol Rev. 2014;66:102–192. doi: 10.1124/pr.113.008029. [DOI] [PubMed] [Google Scholar]
  • 13.Lazarowski ER, Boucher RC, Harden TK. Mechanisms of release of nucleotides and integration of their action as P2X- and P2Y-receptor activating molecules. Mol Pharmacol. 2003;64:785–795. doi: 10.1124/mol.64.4.785. [DOI] [PubMed] [Google Scholar]
  • 14.Vial C, Evans RJ. P2X(1) receptor-deficient mice establish the native P2X receptor and a P2Y6-like receptor in arteries. Mol Pharmacol. 2002;62:1438–1445. doi: 10.1124/mol.62.6.1438. [DOI] [PubMed] [Google Scholar]
  • 15.Nishimura A, Sunggip C, Tozaki-Saitoh H, Shimauchi T, Numaga-Tomita T, Hirano K, Ide T, Boeynaems JM, Kurose H, Tsuda M, Robaye B, Inoue K, Nishida M. Purinergic P2Y6 receptors heterodimerize with angiotensin AT1 receptors to promote angiotensin II-induced hypertension. Sci Signal. 2016;9:ra7. doi: 10.1126/scisignal.aac9187. [DOI] [PubMed] [Google Scholar]
  • 16.Dubroca C, You D, Lévy BI, Loufrani L, Henrion D. Involvement of RhoA/Rho kinase pathway in myogenic tone in the rabbit facial vein. Hypertension. 2005;45:974–979. doi: 10.1161/01.HYP.0000164582.63421.2d. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Massett MP, Ungvari Z, Csiszar A, Kaley G, Koller A. Different roles of PKC and MAP kinases in arteriolar constrictions to pressure and agonists. Am J Physiol Heart Circ Physiol. 2002;283:H2282–H2287. doi: 10.1152/ajpheart.00544.2002. [DOI] [PubMed] [Google Scholar]
  • 18.Carnevale D, Vecchione C, Mascio G, et al. PI3Kγ inhibition reduces blood pressure by a vasorelaxant Akt/L-type calcium channel mechanism. Cardiovasc Res. 2012;93:200–209. doi: 10.1093/cvr/cvr288. [DOI] [PubMed] [Google Scholar]
  • 19.Billaud M, Lohman AW, Straub AC, Looft-Wilson R, Johnstone SR, Araj CA, Best AK, Chekeni FB, Ravichandran KS, Penuela S, Laird DW, Isakson BE. Pannexin1 regulates α1-adrenergic receptor- mediated vasoconstriction. Circ Res. 2011;109:80–85. doi: 10.1161/CIRCRESAHA.110.237594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Govindan S, Taylor CW. P2Y receptor subtypes evoke different Ca2+ signals in cultured aortic smooth muscle cells. Purinergic Signal. 2012;8:763–777. doi: 10.1007/s11302-012-9323-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Mauban JR, Zacharia J, Fairfax S, Wier WG. PC-PLC/sphingomyelin synthase activity plays a central role in the development of myogenic tone in murine resistance arteries. Am J Physiol Heart Circ Physiol. 2015;308:H1517–H1524. doi: 10.1152/ajpheart.00594.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Hoefer J, Azam MA, Kroetsch JT, Leong-Poi H, Momen MA, Voigtlaender-Bolz J, Scherer EQ, Meissner A, Bolz SS, Husain M. Sphingosine-1-phosphate-dependent activation of p38 MAPK maintains elevated peripheral resistance in heart failure through increased myogenic vasoconstriction. Circ Res. 2010;107:923–933. doi: 10.1161/CIRCRESAHA.110.226464. [DOI] [PubMed] [Google Scholar]
  • 23.Loufrani L, Lehoux S, Tedgui A, Lévy BI, Henrion D. Stretch induces mitogen-activated protein kinase activation and myogenic tone through 2 distinct pathways. Arterioscler Thromb Vasc Biol. 1999;19:2878–2883. doi: 10.1161/01.atv.19.12.2878. [DOI] [PubMed] [Google Scholar]
  • 24.Rosette C, Karin M. Ultraviolet light and osmotic stress: activation of the JNK cascade through multiple growth factor and cytokine receptors. Science. 1996;274:1194–1197. doi: 10.1126/science.274.5290.1194. [DOI] [PubMed] [Google Scholar]
  • 25.Takai E, Tsukimoto M, Harada H, Kojima S. Involvement of P2Y6 receptor in p38 MAPK-mediated COX-2 expression in response to UVB irradiation of human keratinocytes. Radiat Res. 2011;175:358–366. doi: 10.1667/RR2375.1. [DOI] [PubMed] [Google Scholar]
  • 26.Tamaishi N, Tsukimoto M, Kitami A, Kojima S. P2Y6 receptors and ADAM17 mediate low-dose gamma-ray-induced focus formation (activation) of EGF receptor. Radiat Res. 2011;175:193–200. doi: 10.1667/rr2191.1. [DOI] [PubMed] [Google Scholar]
  • 27.Dubroca C, Loyer X, Retailleau K, Loirand G, Pacaud P, Feron O, Balligand JL, Lévy BI, Heymes C, Henrion D. RhoA activation and interaction with caveolin-1 are critical for pressure-induced myogenic tone in rat mesenteric resistance arteries. Cardiovasc Res. 2007;73:190–197. doi: 10.1016/j.cardiores.2006.10.020. [DOI] [PubMed] [Google Scholar]
  • 28.Wang N, Butler JP, Ingber DE. Mechanotransduction across the cell surface and through the cytoskeleton. Science. 1993;260:1124–1127. doi: 10.1126/science.7684161. [DOI] [PubMed] [Google Scholar]
  • 29.Robaye B, Boeynaems JM, Communi D. Slow desensitization of the human P2Y6 receptor. Eur J Pharmacol. 1997;329:231–236. [PubMed] [Google Scholar]
  • 30.Praetorius HA, Leipziger J. ATP release from non-excitable cells. Purinergic Signal. 2009;5:433–446. doi: 10.1007/s11302-009-9146-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Kauffenstein G, Drouin A, Thorin-Trescases N, Bachelard H, Robaye B, D’Orléans-Juste P, Marceau F, Thorin E, Sévigny J. NTPDase1 (CD39) controls nucleotide-dependent vasoconstriction in mouse. Cardiovasc Res. 2010;85:204–213. doi: 10.1093/cvr/cvp265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Matchkov VV, Rahman A, Peng H, Nilsson H, Aalkjaer C. Junctional and nonjunctional effects of heptanol and glycyrrhetinic acid derivates in rat mesenteric small arteries. Br J Pharmacol. 2004;142:961–972. doi: 10.1038/sj.bjp.0705870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Lagaud G, Karicheti V, Knot HJ, Christ GJ, Laher I. Inhibitors of gap junctions attenuate myogenic tone in cerebral arteries. Am J Physiol Heart Circ Physiol. 2002;283:H2177–H2186. doi: 10.1152/ajpheart.00605.2001. [DOI] [PubMed] [Google Scholar]
  • 34.Scemes E, Spray DC, Meda P. Connexins, pannexins, innexins: novel roles of “hemi-channels”. Pflugers Arch. 2009;457:1207–1226. doi: 10.1007/s00424-008-0591-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sosinsky GE, Boassa D, Dermietzel R, Duffy HS, Laird DW, MacVicar B, Naus CC, Penuela S, Scemes E, Spray DC, Thompson RJ, Zhao HB, Dahl G. Pannexin channels are not gap junction hemichannels. Channels (Austin) 2011;5:193–197. doi: 10.4161/chan.5.3.15765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Derouette JP, Desplantez T, Wong CW, Roth I, Kwak BR, Weingart R. Functional differences between human Cx37 polymorphic hemichannels. J Mol Cell Cardiol. 2009;46:499–507. doi: 10.1016/j.yjmcc.2008.12.018. [DOI] [PubMed] [Google Scholar]
  • 37.Hill CE, Rummery N, Hickey H, Sandow SL. Heterogeneity in the distribution of vascular gap junctions and connexins: implications for function. Clin Exp Pharmacol Physiol. 2002;29:620–625. doi: 10.1046/j.1440-1681.2002.03699.x. [DOI] [PubMed] [Google Scholar]
  • 38.Reaume AG, de Sousa PA, Kulkarni S, Langille BL, Zhu D, Davies TC, Juneja SC, Kidder GM, Rossant J. Cardiac malformation in neonatal mice lacking connexin43. Science. 1995;267:1831–1834. doi: 10.1126/science.7892609. [DOI] [PubMed] [Google Scholar]
  • 39.Fortes FS, Pecora IL, Persechini PM, Hurtado S, Costa V, Coutinho-Silva R, Braga MB, Silva-Filho FC, Bisaggio RC, De Farias FP, Scemes E, De Carvalho AC, Goldenberg RC. Modulation of intercellular communication in macrophages: possible interactions between GAP junctions and P2 receptors. J Cell Sci. 2004;117(pt 20):4717–4726. doi: 10.1242/jcs.01345. [DOI] [PubMed] [Google Scholar]
  • 40.North RA. Molecular physiology of P2X receptors. Physiol Rev. 2002;82:1013–1067. doi: 10.1152/physrev.00015.2002. [DOI] [PubMed] [Google Scholar]
  • 41.Pellegatti P, Falzoni S, Pinton P, Rizzuto R, Di Virgilio F. A novel recombinant plasma membrane-targeted luciferase reveals a new pathway for ATP secretion. Mol Biol Cell. 2005;16:3659–3665. doi: 10.1091/mbc.E05-03-0222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Kim M, Jiang LH, Wilson HL, North RA, Surprenant A. Proteomic and functional evidence for a P2X7 receptor signalling complex. EMBO J. 2001;20:6347–6358. doi: 10.1093/emboj/20.22.6347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Cario-Toumaniantz C, Loirand G, Ladoux A, Pacaud P. P2X7 receptor activation-induced contraction and lysis in human saphenous vein smooth muscle. Circ Res. 1998;83:196–203. doi: 10.1161/01.res.83.2.196. [DOI] [PubMed] [Google Scholar]
  • 44.Di Virgilio F. Liaisons dangereuses: P2X(7) and the inflammasome. Trends Pharmacol Sci. 2007;28:465–472. doi: 10.1016/j.tips.2007.07.002. [DOI] [PubMed] [Google Scholar]
  • 45.Adamczyk M, Griffiths R, Dewitt S, Knäuper V, Aeschlimann D. P2X7 receptor activation regulates rapid unconventional export of transgluta-minase-2. J Cell Sci. 2015;128:4615–4628. doi: 10.1242/jcs.175968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Tsukimoto M, Harada H, Ikari A, Takagi K. Involvement of chloride in apoptotic cell death induced by activation of ATP-sensitive P2X7 purinoceptor. J Biol Chem. 2005;280:2653–2658. doi: 10.1074/jbc.M411072200. [DOI] [PubMed] [Google Scholar]
  • 47.Darmellah A, Rayah A, Auger R, Cuif MH, Prigent M, Arpin M, Alcover A, Delarasse C, Kanellopoulos JM. Ezrin/radixin/moesin are required for the purinergic P2X7 receptor (P2X7R)-dependent processing of the amyloid precursor protein. J Biol Chem. 2012;287:34583–34595. doi: 10.1074/jbc.M112.400010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Storch U, Blodow S, Gudermann T, Mederos Y, Schnitzler M. Cysteinyl leukotriene 1 receptors as novel mechanosensors mediating myogenic tone together with angiotensin II type 1 receptors-brief report. Arterioscler Thromb Vasc Biol. 2015;35:121–126. doi: 10.1161/ATVBAHA.114.304844. [DOI] [PubMed] [Google Scholar]
  • 49.Eltzschig HK, Sitkovsky MV, Robson SC. Purinergic signaling during inflammation. N Engl J Med. 2013;368:1260. doi: 10.1056/NEJMc1300259. [DOI] [PubMed] [Google Scholar]
  • 50.Yang J, Noyan-Ashraf MH, Meissner A, et al. Proximal cerebral arteries develop myogenic responsiveness in heart failure via tumor necrosis factor-α-dependent activation of sphingosine-1-phosphate signaling. Circulation. 2012;126:196–206. doi: 10.1161/CIRCULATIONAHA.111.039644. [DOI] [PubMed] [Google Scholar]
  • 51.Levy BI, Schiffrin EL, Mourad JJ, Agostini D, Vicaut E, Safar ME, Struijker-Boudier HA. Impaired tissue perfusion: a pathology common to hypertension, obesity, and diabetes mellitus. Circulation. 2008;118:968–976. doi: 10.1161/CIRCULATIONAHA.107.763730. [DOI] [PubMed] [Google Scholar]
  • 52.Maguire JJ, Davenport AP. Regulation of vascular reactivity by established and emerging GPCRs. Trends Pharmacol Sci. 2005;26:448–454. doi: 10.1016/j.tips.2005.07.007. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supplement methods
supplemental files

Online Figure I. Representative traces illustrating that the stable ATP analogue, ATPγS, induces contraction of MRA through the exclusive involvement of P2X1 receptor. (a) The response to ATPgS stimulation (●) was not observed after P2X1 receptor desensitization (αβMeATP 10 μM) nor in the presence of P2X1 receptor antagonist (NF449 10 μM). (b) Pic contraction elicited by P2X1 activation in P2ry6−/− arteries is comparable to the one measured in P2ry6+/+arteries. Values are reported as means ± SEM of 5 to 8 independent experiments.

Online Figure II. Reproducibility of the myogenic contraction induced by a single step increase from 10 to 75 mmHg in mouse MRA. The level of contraction was stable for 4 successive protocols. Upper panel: representative traces. Lower panel: quantification of four independent experiments ± SEM

Online Figure III. Comparison of elastic properties of mesenteric arteries isolated from P2ry6−/− compared to wild type mice P2ry6+/+. (a) Passive arterial diameter, (b) arterial wall thickness, (c) cross sectional compliance, (d) distensibility and (e) passive wall tension were evaluated on MRA following step increase of intraluminal pressure using a pressure myograph. Mean ± SEM of 10 arteries from 5 different mice. (f) Correlation between passive arterial diameter and MT illustrates that MT is systematically lower in P2ry6−/− MRA with equivalent diameter to P2ry6+/+.

Online Figure IV. (a) Comparison of the expression levels of P2Y6 receptor by RTqPCR in thoracic aorta (Tho Ao), mesenteric resistance artery (MRA), tail caudal artery (CA) and kidney. Lower panel shows equivalent MT in P2ry6+/+ and P2ry6−/− caudal artery. Values represent the mean ± SEM of 7 independent experiments.

Online Figure V. Hemodynamic parameters were measured in conscious mice using telemetric implants. Arterial pressure (systolic, mean, diastolic) and heart rate are shown as 24h mean values (a) or separated according to day and night (b). Arterial pressure was not different between P2ry6−/− and wild type mice and both genotypes displayed a circadian rhythm with enhanced values at night time (b, * indicates p<0.05 vs. day). Heart rate was significantly increased in P2ry6−/− animals (indicated by #). Data represent mean ± SEM of parameters registered on 4 separate animals of each genotype. Values were collected for 3 consecutive days and a mean value was calculated for each animal from these data.

Online Figure VI. Mice were treated with Angiotensin-II (1mg/kg/day, Alzet sub cutaneous osmotic pump) for 21 days. Mean arterial blood pressure was measured under isoflurane anesthesia using intra arterial catheter connected to a pressure transducer and a blood Pressure Analyser-200A (Micro-Med, Tustin, CA).

Online Figure VII. Chronic heart failure (CHF) was evaluated by cardiac dysfunction and gross cardiac morphology 6–8-weeks after permanent coronary artery ligation. a Left ventricular diastolic dimension (LVEDD) and b fractional shortening were determined using echocardiography (n=4 in each group). Mice were sacrificed one week after echocardiography and cardiac gross morphology was analyzed. c Representative hearts with and without CHF from P2rY6+/+ and P2rY6−/− mice. d Left ventricle (LV) weight/body weight ratio showing LV hypertrophy. Data are expressed as mean ± sem. *P<0,05 vs. same genotype without CHF.

Online Figure VIII. Comparison of intracellular calcium mobilization measured on freshly dissociated (left) or cultured vascular SMCs (right) isolated from P2ry6+/+ and P2ry6−/− mouse MRA. (a, b) Basal fluorescence ratio (FURA-2 ex 340/380; em 510 nm) as a indicator of resting intracellular calcium level was not modified by P2Y6 receptor deletion in cultured or dissociated cells. (c, d) Tracings representing the kinetic of calcium mobilization (F/F0 ratio) induced by the indicated nucleotides (UDP, ATP, UTP 10 μM, 1min injection). (e, f) quantification of intracellular calcium mobilization as measured by the area under the curve (AUC) of the F/F0 signal (represented in c and d). Data represent the mean ± SEM of experiments performed in duplicate on 3 independent primary cell cultures or triplicate dissociated cell preparations, *P<0.05 (2-way ANOVA).

Online Figure IX. MT developed by MRA from P2Y2 deficient mice (P2ry2−/−) was not altered compared to the response of their wild type littermates (P2ry2+/+) (mean ± SEM of 5 independent experiments).

Online Figure X. Representative western blots of protein phosphorylation in P2ry6+/+ vs P2ry6−/− arterial SMCs. Cells were stimulated with UDP (1, 10, 100 μM) for 5 min, lysed and protein were analyzed for phosphorylation using specific antibodies (see Table 2).

Online Figure XI. Arterial reactivity of P2rx7−/− mice was evaluated with a pressure myograph. (a) Phenylephrine (PE)-dependent contraction and acetylcoline (ACh)-dependent relaxation are not affected in P2rx7−/− arteries as compared to their control. Data represent the mean ± SEM of 11 arteries from 5 different mice. (b) Kinetic of contraction of arteries from P2rx7+/+ (black) vs P2rx7−/− (red) mice in response to ATP, P2X7 agonist BzATP (100 μM), and P2X1 agonist αβMeATP (10 μM). Data represent the mean ± SEM of n=3 to 5.

Online Figure XII. Myogenic Tone evaluation in MRA from Panx1−/−; Cx37−/−; Cx43+/− and P2rx7−/− mice was determined using a pressure myograph as described in the experimental section. Left panels represent arterial diameter monitoring following step pressure increases in intraluminal pressure in active and passive (PSS 0 calcium, EDTA, plus sodium nitroprusside and papaverine) conditions. Right panels represent the MT as a percentage of contraction normalized to passive diameter. Data represent mean ± SEM of 5 to 13 independent experiments as indicated in the legend (*** p < 0.001; ** p < 0.01; * p < 0.05).

Online Figure XIII. Expression of Panx1 but not Panx2 or Panx3 was evidenced by immunofluorescence and immunolabelling coupled to transmission electron microscopy (TEM) in MRA and quantified by the number of beads/μm2 in endothelial cells (EC), myoendothelial junction (MEJ) and vascular SMC (upper panel). The immunostaining represents Panx1 in red, autofluorescence of the internal elastic lamina (IEL) in green and DAPI (nuclei) in blue. Scale bar for immune-TEM is 1 μm, for ICC is 10 μm and asterisks indicates the lumen of the vessel.

Online Figure XIV. Myogenic Tone evaluation in human cutaneous arteries was determined using a pressure myograph as described in the experimental section. Left panels represent arterial diameter monitoring following step pressure increases in intraluminal pressure in active and passive (PSS 0 calcium, EDTA, plus sodium nitroprusside and papaverine) conditions. Right panels represent the MT as a percentage of contraction normalized to passive diameter. Data represent the mean ± SEM of 2 separate donors, ****P<0.0001.).

RESOURCES