Distinctive Frequencies of +874T/A IFN‐γ Gene Polymorphism in a Healthy Serbian Population

Abstract

Purpose: Single nucleotide polymorphism (SNP) in IFN‐γ gene (+874T/A) that determines high (TT), low (AA), and intermediate (TA) responder phenotypes has shown associations with susceptibility to infectious and chronic inflammatory diseases, as well as disease outcome. Therefore, the susceptibility to and outcome of certain diseases can vary in different ethnic populations partially due to the notable differences in frequencies of genotypes and alleles between them. The aim of this study was to determine the distribution of +874T/A genotype and allele frequencies in a healthy Serbian population as a reference for further disease association studies.

Materials and Methods: Genomic DNA samples from 166 healthy volunteers were evaluated for IFN‐γ SNP at position +874 using TaqMan SNP genotyping assay.

Results: The frequencies of AA, AT, and TT genotypes were 28.9%, 49.4%, and 21.7%, respectively. The A and T allele frequencies were 53.6% and 46.4%.

Conclusions: Analysis of genotype and allele frequencies for IFN‐γ+874T/A SNP in healthy subjects revealed, for the first time, the genetic profile for this polymorphism in a Serbian population resembling most European populations, but differing from some Asian and African ethnic groups. Clin Trans Sci 2012; Volume 5: 461–463

Introduction

The degree of cytokine expression depends not only on the type and intensity of the stimulation but also on host genetic factors, such as polymorphisms located in the coding and regulatory regions of the cytokine genes. ¹ Single nucleotide polymorphisms (SNPs) in the promoter and/or untranslated regions of a gene may influence cytokine gene expression whereas variations in the coding region may affect the biological activity of the encoded cytokine. ² , ³ , ⁴ , ⁵ A number of cytokine and cytokine receptor gene polymorphisms directly linked to development of human disease has increased considerably. While positive associations of cytokine SNPs with human diseases have been increasingly documented in the last decade, ¹ association can vary in different ethnic populations due to notable interethnic differences in frequencies of genotypes and alleles. ⁶

Interferon‐γ (IFN‐γ) is a cytokine central to the innate and adaptive immunity against viral and intracellular bacterial infections as well as in tumor control. ⁷ Increased IFN‐γ production is associated with a number of inflammatory and autoimmune diseases. IFN‐γ is predominantly produced by CD4⁺ effector T cells, namely Th1 CD4⁺ T cells, and natural killer (NK) cells, as part of the innate immunity response. The importance of IFN‐γ in the immune system stems from its property to activate diverse genes, the majority of which encode molecules involved in immunoregulation. ⁷ The human IFN‐γ gene is located on chromosome 12q24.1. ⁸ As aforementioned, cytokine gene polymorphism may cause high or low cytokine production, or it may be silent. The SNP (rs2430561) in the first intron of IFN‐γ gene at position +874 is related to high (TT), intermediate (TA), or low (AA) IFN‐γ secretion. ⁵ , ⁹

Significant interethnic differences in allele and genotype frequencies of IFN‐γ SNPs have been reported, ⁶ , ¹⁰ , ¹¹ but there are no data available for the Serbian population. Considering the centrality of IFN‐γ in inflammatory responses, genotyping for IFN‐γ gene polymorphisms may be an important tool for predicting individual susceptibility in the development of certain inflammatory diseases. The aim of this study was to determine the allele and genotype frequencies of IFN‐γ+874 gene polymorphism in a healthy Serbian population, and to compare it with results obtained from other ethnic groups.

Materials and Methods

Subjects

We obtained blood samples from 166 healthy blood donors using centralized procurement through the National Blood Transfusion Institute. Informed written consent was obtained from all individuals before blood sampling, and this study was approved by the ethics committee of the National Blood Transfusion Institute.

Genotyping

Genomic DNA was isolated from peripheral blood, sampled with EDTA, using the GeneJET whole blood genomic DNA purification mini kit (Fermentas Thermo Fisher Scientific Inc, St. Leon‐Rot, Germany). For determination of IFN‐γ T/A SNP at position +874 (rs 2430561) we designed specific oligonucleotides (Table 1).

Table 1.

Oligonucleotide sequences, labels, and final concentrations.

Oligonucleotide	Sequence and modifications 5′→3′	Final concentration (nM)
F‐IFN‐γ T/A +874	TCCAAACATGTGCGAGTGT	600
R‐IFN‐γ T/A +874	AATATTCAGACATTCACAATTGATTT	600
A‐IFN‐γ+874	FAM‐ATCAAATCACACACA‐MGB	250
T‐IFN‐γ+874	VIC‐AATCAAATCTCACACA‐MGB	400

PCR experiments were performed in 96‐well reaction plates (MicroAmp Optical, ABI, Foster City, CA, USA) in 10 μL volume/well containing 5.25 μL of the reaction mix (5 μL of 2× Maxima Probe qPCR Master Mix, Fermentas Thermo Fisher Scientific Inc, and 0.25 μL of 40× concentrated oligonucleotide mixture) and 4.75 μL of the sample DNA (approximately 20 ng) diluted in demineralized water. Primers were purchased from Invitrogen Life Technologies, Carlsbad, CA, USA, and probes from Metabion, Martinsried, Germany. Plates were sealed with optical adhesive film (ABI), briefly centrifuged at high speed and thereafter placed into the thermocycler (Mastercycler ep realplex 2, Eppendorf, Hamburg, Germany). The thermal cycling conditions were 95°C for 4 minutes, followed by 40 cycles that were run for 15 seconds at 95°C, 1 minute at 55°C, and for 20 seconds at 68°C. Fluorescence readings were done at 68°C.

Statistical analysis

Comparison between genotype and allele frequencies in different populations was performed using the Chi‐square test. All results were tested for Hardy–Weinberg equilibrium.

Results

Genotype and allele frequencies for IFN‐γ+874T/A SNP in a healthy Serbian population are shown in Table 2. All genotype frequencies were in Hardy–Weinberg equilibrium (p < 0.05).

Table 2.

Genotype and allele frequency of IFN‐γ+874T/A polymorphism in a healthy Serbian population.

	Number	%
Genotype
AA	48	28.9
AT	82	49.4
TT	36	21.7
Allele
A	178	53.6
T	154	46.4

The frequencies of AA, AT, and TT genotypes were 28.9%, 49.4%, and 21.7%, respectively. The A and T allele frequencies were 53.6% and 46.4%. Genotype and allele frequencies of IFN‐γ+874T/A SNP in healthy subjects from different populations are presented in Table 3.

Table 3.

Genotype and allele frequencies (%) for IFN‐γ+874T/A polymorphism across different populations.

Population	AA	AT	TT	p1	A	T	p2
Serbian	28.9	49.4	21.7	NA	53.6	46.4	NA
Thai12	60.1	31.7	8.2	<0.0001	75.9	24.1	0.0015
North Chinese 13	18.9	71.6	9.5	0.004	54.7	45.3	1
Taiwanese 14	70.1	27	2.9	0.0001	83.6	16.4	<0.0001
Egyptian 15	5.1	50.8	44.1	<0.0001	30.1	69.9	0.0012
Italian 16	23.9	53.5	22.6	0.72	50.7	49.3	0.79
Native Canadian 17	93	7	0	<0.0001	97	3	0.0001
Danish 18	22	47.5	30	0.31	45.7	54.3	1
Turkish 10	27	50	23	0.95	52.2	47.8	1
Croatian 19	25.8	54.3	19.8	0.77	53	47	1
Bulgarian 20	25.6	51.2	23.2	0.86	51.2	48.8	0.84
Hong Kong Chinese 21	45.7	42.1	12.2	0.03	66.7	33.3	0.08
South African 22	59	31	10	<0.0001	75	25	0.0025
British 23	22.1	57.1	20.8	0.38	50.6	49.4	0.77

p1 = chi square for genotypes; p2 = chi square for alleles; NA = not applicable.

Genotype and allele frequencies for IFN‐γ+874T/A SNP between Serbian and several other populations were compared. As shown in Table 3, the observed distribution of alleles at +874 within IFN‐γ gene of healthy Serbian population was similar to European populations. The results showed highly significant differences for frequencies of genotypes and alleles in comparison with several populations in Asia and Africa.

Discussion

This is the first report on genotype and allele frequencies for IFN‐γ+874T/A polymorphism in a Serbian population. We demonstrate that the distribution of alleles at position +874 within IFN‐γ gene in Serbian healthy subjects was similar to most European populations. Our results show highly significant differences for frequencies of genotypes and alleles in comparison with some populations in Asia and Africa. In general, the A allele is significantly more common in Asian populations than in the Serbian population or in other Caucasian populations. An unstable history and its geographical location on the intersection of West and East defined the Serbian population as open to the genetic influences of neighboring and other European ethnicities. Also, some ethnically unique groups like Canadian natives ¹⁷ were extremely different to any of Caucasian populations including Serbian population (T allele 3% vs. 46.4%, A allele 97% vs. 53.6%).

The predisposition to produce certain amount of cytokine may be influenced by polymorphism within the encoding gene. This, in turn, may contribute to the susceptibility, severity, and clinical outcome of various infectious and chronic inflammatory diseases. Because IFN‐γ is a multipotent pleiotropic cytokine that plays an important role in both the innate and adaptive immune response, the polymorphism +874T/A of the IFN‐γ gene has been associated with susceptibility to several diseases including pulmonary tuberculosis, ¹¹ Hashimoto’s thyroiditis and Graves’ disease, ²⁴ psoriasis vulgaris, ²⁵ and oral lichen planus. ¹² Accordingly, in certain populations susceptibility to tuberculosis, a disease in which IFN‐γ serves a protective role, correlates with higher frequency of the IFN‐γ low‐producing genotype. ¹¹ , ¹⁷ However, further studies are needed to elucidate whether this immunogenetic trait may be involved in increased risk of developing immune‐mediated disease in certain populations.

Conclusion

In this study, for the first time, we demonstrate the frequency of IFN‐γ+874 polymorphism in the Serbian population. Our results could be relevant to further investigations of the role of IFN‐γ SNPs as potential biomarkers for susceptibility to certain inflammatory diseases.