Abstract
A multilocus sequence typing (MLST) scheme has been developed for Pseudomonas aeruginosa which provides molecular typing data that are highly discriminatory and electronically portable between laboratories. MLST data confirm the data from previous studies that suggest that P. aeruginosa is best described as nonclonal but as having an epidemic population. The index of association was 0.17, indicating a freely recombining population; however, there was evidence of clusters of closely related strains or clonal complexes among the members of this population. It is apparent that the sequence types (STs) from single isolates, representing each of the present epidemic clones in the United Kingdom from Liverpool, Manchester, and the West Midlands, are not closely related to each other. This suggests distinct evolutionary origins for each of these epidemic clones in the United Kingdom. Furthermore, these clones are distinct from European clone C. Comparison of the results of MLST with those of toxA typing and serotyping revealed that strains with identical STs may possess different toxA types and diverse serotypes. Given that recombination is important in the population of P. aeruginosa, the lack of a linkage between toxA type and serotype is not surprising and reveals the strength of the MLST approach for obtaining a better understanding of the epidemiology of P. aeruginosa.
Pseudomonas aeruginosa is a gram-negative rod which is reported to be ubiquitous in the natural environment, humans, and animals. The species thrives in moist and wet conditions and is able to utilize a wide range of organic compounds. It can cause severe infections that may be associated with high rates of mortality in immunocompromised patients (3, 8, 24), and it is a frequent cause of infections acquired by patients during hospitalization (4). Almost any type of hospital equipment or utensil has been implicated as a reservoir for P. aeruginosa, and these sources may serve as foci for the dissemination of the organism in common-source outbreaks (9).
Infections are most often self-limiting in healthy individuals, such as folliculitis in association with contamination of swimming pools and hot tubs (21). However, occasionally, acute infection of the eyes of contact lens wearers (2) may result in P. aeruginosa ocular infections (1).
P. aeruginosa is the most common organism isolated from the lungs of approximately 80% of adult patients with cystic fibrosis (CF). The presence and persistence of the organism correlate with the deterioration of lung function and the clinical decline of the patient (7). Most patients appear to acquire the organism from the natural environment and not from other patients (25), but there is gathering evidence that some clonal lineages are widespread among the CF patient population, apparently contracted through cross infection from other CF patients (12, 15). Indeed, a highly widespread clonal complex, clone C, has been associated with a wide range of different infections in CF and non-CF patients and has been found in the natural environment (6, 20).
The genome size of P. aeruginosa varies from 5.2 to 7.1 Mbp (22). This degree of variation has important implications for the methods used to study the evolution and epidemiology of this organism. Recent work suggests that more than 80% of the genome of the sequenced strain (strain PAO1) is shared (with only 0.5% nucleotide divergence) by CF and environmental strains (26). Denamur et al. (5) and Picard et al. (16) considered that the species had a panmictic population structure, but Kiewitz and Tummler (13) proposed a net-like structure characterized by high frequencies of recombination. An epidemic structure was favored by Lomholt et al. (14) and Pirnay et al. (17), who used sequencing-based techniques, such as sequencing of the outer membrane lipoprotein, combined with serotyping and pyoverdine type determination in a polyphasic approach to reveal extensive genetic mosaicism, particularly in the oprD gene.
A variety of molecular genetic methods have been used to type P. aeruginosa strains (10), but these vary in their discriminatory potentials. Many investigators have considered pulsed-field gel electrophoresis of DNA macrodigests to represent the “gold standard” against which newer methods are measured. However, the lack of a discriminating and portable scheme suitable for population genetics analysis and an exceptionally variable phenotype (18) have hindered epidemiological and population biology studies. We describe the development and use of a multilocus sequence typing (MLST) scheme to characterize a diverse collection of clinical and environmental isolates of P. aeruginosa, including representatives of clone C and recently identified epidemic clones from the United Kingdom.
MATERIALS AND METHODS
P. aeruginosa culture collection.
P. aeruginosa strains were obtained from the Hajo Grundmann collection (10), deposited at the Health Protection Agency, Colindale, London, United Kingdom. Six isolates were from mushroom compost at one experimental mushroom farm and were provided by Alun Morgan Horticulture Research International. In addition, ∼100 isolates were collected from hospitals across the United Kingdom. See Table 1 for a summary of all 143 isolates. Strains were identified as P. aeruginosa as described previously (10), and DNA fingerprinting of toxA and serotyping were also performed.
TABLE 1.
Properties of the P. aeruginosa strains used for validationa
| Strain | ST | BURST group | Allelic profile | Sero- type | toxA type | Hospital, center, or geographic source | Isolation site | Date of isolation (mo-yr) |
|---|---|---|---|---|---|---|---|---|
| Soil isolate (n = 2) | 145 | 17, 35, 36, 3, 14, 4, 7 | NA | Wellesbourne, UK | Soil | Jan-99 | ||
| Midlands 1 epidemic | 116 | 17, 20, 1, 3, 13, 6, 7 | NA | NA | Sputum | |||
| 8623 | 110 | 15, 5, 1, 3, 2, 12, 7 | NA | 07.06.06 T6 | NA | NA | ||
| PA0093 | 83 | 1 | 11, 5, 1, 3, 14, 17, 7 | PA | Folkestone, UK | Tissue sample | Nov-01 | |
| PA0092 | 82 | 1 | 32, 5, 24, 3, 14, 17, 7 | O11 | Wycombe, UK | Blood | Nov-01 | |
| 1353 M | 100 | 33, 3, 3, 3, 4, 12, 7 | NA | Wellesbourne, UK | Mushroom compost | |||
| 7874 | 129 | 2 | 6, 5, 6, 7, 2, 6, 7 | O3 | 07.03.22 T31 | West Yorkshire, UK | NA | |
| 7916 | 119 | 2 | 6, 5, 6, 7, 3, 6, 7 | O11 | 10.08.10 T13 | Bristol, UK | NA | |
| 8184 | 27 | 2 | 6, 5, 6, 7, 4, 6, 7 | O11 | 04.08.10 T5 | Queen Mary's, UK | NA | |
| 8101 | 27 | 2 | 6, 5, 6, 7, 4, 6, 7 | O11 | 10.08.17 T7 | Stourbridge, UK | NA | |
| 6954 | 27 | 2 | 6, 5, 6, 7, 4, 6, 7 | O4 | 04.06.11 T10 | Glasgow, UK | NA | |
| 6338 | 27 | 2 | 6, 5, 6, 7, 4, 6, 7 | O12 | 02.02.02 T17 | NA | NA | |
| 4587 | 27 | 2 | 6, 5, 6, 7, 4, 6, 7 | O11 | 10.08.09 T14 | Boston, UK | NA | |
| 7627 | 11 | 2 | 6, 5, 6, 7, 4, 6, 3 | O4 | 01.01.01 T1 | Croydon, UK | NA | |
| 2359 Canada | 7 | 2 | 6, 5, 6, 7, 4, 6, 1 | NA | Canada | Oil-contaminated aquifer | Jan-87 | |
| 8281 | 15 | 2 | 12, 5, 6, 7, 4, 6, 7 | NA | NA | NA | ||
| 8122 | 128 | 2 | 6, 5, 6, 8, 21, 6, 7 | O1 | 03.10.15. T12 | Mid-Glamorgan, UK | NA | |
| 5798 | 122 | 2 | 6, 5, 6, 8, 2, 6, 7 | NA | NA | NA | ||
| 6563 | 10 | 8, 5, 8, 8, 4, 6, 7 | O3 | 01.01.01 T1 | Blackburn, UK | NA | ||
| PA0051 | 44 | 4, 5, 6, 7, 1, 16, 7 | O9 | Luton, UK | Sputum | Aug-02 | ||
| PA0074 | 66 | 30, 10, 23, 5, 4, 2, 7 | O4 | Dorset, UK | Blood | Mar-02 | ||
| PA0050 | 43 | 25, 5, 17, 5, 4, 15, 7 | O11 | Chelsea, UK | Wound swab | Sep-02 | ||
| PA0040 | 33 | 19, 5, 15, 3, 4, 12, 7 | O11 | Birmingham, UK | NA | Nov-02 | ||
| PA0029 | 25 | 19, 5, 12, 7, 4, 10, 7 | O6 | Manchester, UK | Sputum | Jan-03 | ||
| Clone C | 142 | 3 | 11, 5, 1, 7, 9, 26, 7 | NA | Sputum | |||
| 8735 | 17 | 3 | 11, 5, 1, 7, 9, 4, 7 | O1 | 01.01.01 T1 | Birmingham, UK | NA | |
| 8277 | 14 | 3 | 11, 5, 1, 7, 9, 8, 7 | O1 | 01.01.01 T1 | Durham, UK | NA | |
| Clone C genotype | ||||||||
| P10118 | 117 | 3 | 11, 20, 1, 7, 9, 4, 32 | NA | NA | Sputum | ||
| Clone C genotype | ||||||||
| P10119 | 115 | 3 | 11, 20, 1, 7, 9, 4, 7 | NA | NA | Sputum | ||
| PA0100 | 90 | 39, 25, 9, 7, 9, 20, 7 | O1 | Northampton, UK | NA | Sep-01 | ||
| PA0072 | 64 | 28, 4, 22, 7, 9, 10, 7 | O15 | Ormskirk, UK | Urine | Apr-02 | ||
| Melbourne | 141 | 11, 33, 11, 31, 23, 4, 7 | NA | NA | Sputum | |||
| PA0105 | 95 | 7, 4, 7, 5, 2, 7, 7 | O6 | London, UK | NA | Aug-01 | ||
| PA0049 | 42 | 4, 13, 16, 5, 2, 7, 7 | O11 | London, UK | Bronccoalveolar lavage fluid | Sep-02 | ||
| PA0075 | 67 | 31, 4, 6, 5, 2, 6, 7 | O11 | Birmingham, UK | NA | Mar-02 | ||
| PA0057 | 50 | 26, 17, 11, 5, 2, 4, 7 | O6 | Newcastle, UK | Blood | Jul-02 | ||
| Manchester | 143 | 17, 34, 11, 18, 4, 13, 3 | NA | NA | Sputum | |||
| PA0044 | 37 | 23, 16, 11, 4, 4, 6, 3 | O7 | Leeds, UK | Blood | Oct-02 | ||
| PA0036 | 124 | 4 | 20, 8, 5, 4, 4, 4, 3 | O6 | Cheshire, UK | NA | Dec-02 | |
| 8756 | 113 | 4 | 17, 5, 5, 4, 19, 4, 3 | O12 | 06.04.00 T4 | France | NA | |
| 8722 | 111 | 4 | 17, 5, 5, 4, 4, 4, 3 | O12 | 06.04.00 T4 | Belfast, UK | NA | |
| 6950 | 102 | 4 | 15, 5, 5, 3, 4, 4, 3 | O12 | 06.04.00 T4 | Southport, UK | NA | |
| PA0108 | 97 | 4 | 11, 5, 1, 4, 4, 20, 3 | O1 | Bristol, UK | NA | Jul-01 | |
| PA0061 | 53 | 4 | 11, 5, 19, 4, 4, 4, 3 | PA | Brighton, UK | Sputum | Jun-02 | |
| 1330 M | 4 | 3, 3, 4, 4, 4, 4, 3 | NA | Wellesbourne, UK | Mushroom compost | |||
| 8103 | 133 | 1, 20, 32, 3, 4, 25, 3 | O3 | 07.08.17 T34 | St. Mary's, UK | NA | ||
| 7272 | 134 | 23, 20, 7, 30, 4, 4, 10 | O6 | 04.08.05 T24 | Cumbria, UK | NA | ||
| PA0098 | 88 | 22, 4, 17, 7, 4, 13, 7 | PA | London, UK | Blood | Oct-01 | ||
| PA0068 | 60 | 28, 4, 17, 15, 4, 4, 3 | O4 | Nottingham, UK | Tissue sample | May-02 | ||
| 8440 | 132 | 6, 20, 1, 3, 4, 4, 2 | O6 | 10.08.03 T41 | Carmarthen, UK | NA | ||
| PA0094 | 84 | 6, 11, 1, 5, 4, 4, 27 | O4 | Bristol, UK | NA | Nov-01 | ||
| PA0107 | 96 | 6, 5, 1, 11, 17, 7, 2 | O6 | Leicester, UK | Sputum | Aug-01 | ||
| PA0020 | 18 | 6, 4, 1, 11, 4, 7, 10 | PA | Stafford, UK | NA | Feb-03 | ||
| 7306 | 135 | 6, 20, 11, 7, 1, 12, 19 | 6 | 06.09.13 T25 | Queen Elizabeth II | NA | ||
| 8113 | 106 | 22, 20, 11, 23, 1, 3, 3 | O11 | 10.08.09 T4 | Conquest | NA | ||
| PA0076 | 68 | 32, 20, 24, 3, 1, 17, 15 | O11 | Dublin, Ireland | Blood | Mar-02 | ||
| PA0043 | 36 | 11, 15, 11, 3, 1, 14, 15 | O1 | York, UK | NA | Oct-02 | ||
| PA0034 | 28 | 15, 10, 11, 3, 2, 7, 12 | NT | London, UK | Blood | Dec-02 | ||
| PA0022 | 20 | 15, 5, 11, 3, 1, 7, 11 | O6 | Cheshire, UK | Sputum | Feb-03 | ||
| Liverpool a | 114 | 11, 20, 11, 3, 4, 23, 1 | NA | Liverpool, UK | Sputum | |||
| PA0067 | 59 | 11, 4, 11, 11, 4, 12, 20 | O11 | London, UK | NA | May-02 | ||
| 8364 | 130 | 5, 8, 25, 28, 4, 24, 34 | O3 | 01.02.18 T38 | University College, UK | NA | ||
| PA0097 | 87 | 5, 24, 25, 21, 4, 4, 7 | O3 | London, UK | Bronccoalveolar lavage fluid | Oct-01 | ||
| 8405 | 127 | 43, 30, 31, 26, 4, 24, 32 | O8 | Atyp 4 T49 | Bangor, UK | NA | ||
| 5973 | 131 | 6, 5, 11, 29, 11, 15, 1 | NA | NA | NA | |||
| 8734 | 112 | 6, 5, 1, 25, 1, 12, 1 | O6 | 06.03.14 T11 | Stoke/Trent, UK | NA | ||
| PA0089 | 125 | 36, 1, 28, 1, 1, 7, 1 | PA | London, UK | NA | Dec-01 | ||
| NCTC 10662 | 1 | 1, 1, 1, 1, 1, 1, 1 | NA | NA | NA | Apr-69 | ||
| 7186 | 103 | 17, 5, 12, 22, 14, 22, 29 | O11 | 04.08.10 T5 | Truro, UK | NA | ||
| PA0084 | 76 | 17, 21, 12, 5, 1, 17, 1 | O4 | London, UK | Blood | Jan-02 | ||
| PA0024 | 21 | 16, 5, 12, 11, 1, 2, 1 | O3 | Bedford, UK | Skin | Jan-03 | ||
| PA0026 | 123 | 17, 5, 5, 1, 10, 12, 2 | O6 | Sheffield, UK | NA | Jan-03 | ||
| PA0101 | 91 | 17, 5, 5, 1, 1, 21, 1 | O11 | Windsor, UK | Blood | Sep-01 | ||
| PA0054 | 47 | 17, 5, 5, 12, 1, 10, 16 | PA | London, UK | Sputum | Aug-02 | ||
| PA0070 | 62 | 2, 5, 5, 16, 3, 1, 19 | O11 | London, UK | Blood | May-02 | ||
| PA0062 | 54 | 2, 5, 5, 11, 4, 4, 16 | O11 | Leeds, UK | Hospital sink | Jun-02 | ||
| 8386 | 121 | 11, 5, 7, 27, 1, 7, 33 | O1 | 09.11.10 T40 | Wexham, UK | NA | ||
| 5670 | 8 | 7, 5, 7, 3, 7, 1, 6 | O11 | 10.08.04 T16 | Scunthorpe, UK | NA | ||
| PA0102 | 92 | 40, 5, 30, 3, 1, 4, 8 | O9 | London, UK | NA | Sep-01 | ||
| PA0053 | 46 | 5 | 4, 5, 16, 3, 1, 17, 13 | O9 | Lincoln, UK | Urine | Aug-02 | |
| PA0045 | 38 | 5 | 4, 5, 16, 3, 1, 4, 13 | O3 | Wolverhampton, UK | Blood | Oct-02 | |
| PA0046 | 39 | 5 | 18, 5, 5, 3, 1, 6, 13 | O11 | Folkestone, UK | Blood | Oct-02 | |
| PA0038 | 31 | 5 | 21, 5, 5, 3, 1, 4, 13 | O14 | Ashton under Lyme, UK | NA | Nov-02 | |
| PA0037 | 30 | 5 | 15, 12, 5, 3, 1, 4, 13 | O10 | London, UK | Blood | Nov-02 | |
| PA0090 | 81 | 37, 5, 29, 3, 4, 4, 26 | O6 | Folkestone, UK | NA | Nov-01 | ||
| 8318 | 108 | 39, 5, 20, 5, 1, 6, 31 | O6 | 01.01.23 T3 | Sutton, UK | NA | ||
| PA0081 | 73 | 33, 5, 25, 20, 1, 6, 24 | O10 | London, UK | Blood | Jan-02 | ||
| PA0104 | 94 | 24, 5, 3, 5, 16, 6, 28 | O6 | Leicester, UK | Hospital floor | Aug-01 | ||
| PA0111 | 126 | 5, 27, 5, 13, 1, 13, 4 | O6 | Nottingham, UK | Blood | Jul-01 | ||
| PA0095 | 85 | 5, 11, 3, 13, 1, 4, 4 | O4 | London, UK | Blood | Oct-01 | ||
| PA0103 | 93 | 22, 5, 11, 13, 1, 15, 4 | O14 | Leeds, UK | Blood | Sep-01 | ||
| PA0066 | 58 | 4, 5, 16, 13, 1, 2, 4 | O4 | Nottingham, UK | NA | May-02 | ||
| PA0055 | 48 | 6, 5, 4, 13, 1, 4, 4 | PA | Newcastle on Tyne, UK | Blood | Jul-02 | ||
| PA0063 | 55 | 27, 5, 20, 13, 1, 2, 8 | O6 | Bedford, UK | Blood | Jun-02 | ||
| PA0083 | 75 | 17, 5, 26, 13, 1, 17, 25 | O6 | Brompton, UK | NA | Jan-02 | ||
| PA0099 | 89 | 13, 8, 5, 13, 1, 7, 25 | O7 | Folkestone, UK | Sputum | Sep-01 | ||
| 8297 | 16 | 13, 8, 9, 3, 1, 9, 9 | O11 | 10.08.17 T7 | Ports; mouth, UK | NA | ||
| 8382 | 109 | 6 | 4, 4, 16, 24, 1, 6, 3 | O10 | 05.03.05 T2 | Whippscross, UK | NA | |
| 8202 | 107 | 6 | 4, 4, 16, 21, 1, 6, 1 | O10 | 05.03.05 T2 | St. Thomas, UK | NA | |
| 7215 | 104 | 6 | 4, 4, 16, 3, 1, 6, 30 | O11 | 05.03.05 T2 | Bath, UK | NA | |
| 8237 | 13 | 10, 4, 5, 10, 1, 6, 3 | O10 | 05.03.05 T2 | St. Bar, UK | NA | ||
| PA0077 | 69 | 7 | 28, 4, 3, 3, 1, 6, 11 | O11 | Dudley, UK | Sputum | Mar-02 | |
| PA0069 | 61 | 7 | 13, 4, 9, 3, 1, 6, 11 | O15 | Gloucester, UK | Sputum | May-02 | |
| PA0096 | 86 | 38, 4, 3, 3, 15, 15, 3 | PA | London, UK | Blood | Oct-01 | ||
| PA0087 | 79 | 34, 11, 3, 12, 1, 13, 3 | O11 | London, UK | Staff hands, intensive care | Dec-01 | ||
| PA0056 | 49 | 8 | 24, 5, 3, 12, 1, 6, 3 | NT | Surrey, UK | NA | Jul-02 | |
| 1346 M | 41 | 8 | 24, 3, 3, 12, 1, 7, 3 | NA | Wellesbourne, UK | Mushroom compost | ||
| PA0065 | 57 | 8 | 11, 5, 1, 12, 1, 12, 3 | O12 | London, UK | Blood | May-02 | |
| PA0060 | 52 | 8 | 11, 19, 12, 12, 1, 6, 3 | O11 | Wycombe, UK | Sputum | Jun-02 | |
| PA0052 | 45 | 8 | 11, 5, 12, 12, 1, 6, 3 | O9 | Lincoln, UK | Sputum | Aug-02 | |
| PA0085 | 77 | 17, 22, 12, 12, 1, 18, 3 | O4 | Nottingham, UK | Hospital floor | Jan-02 | ||
| PA0073 | 65 | 29, 4, 16, 12, 1, 18, 21 | O10 | London, UK | Blood | Apr-02 | ||
| PA0082 | 74 | 4, 5, 1, 19, 13, 7, 23 | O3 | Wycombe, UK | Blood | Jan-02 | ||
| PA0080 | 72 | 4, 4, 16, 19, 13, 10, 23 | PA | York, UK | Sputum | Feb-02 | ||
| PA0047 | 40 | 4, 5, 16, 11, 11, 7, 14 | O7 | Chelsea, UK | Wound swab | Sep-02 | ||
| PA0041 | 34 | 4, 5, 16, 3, 3, 7, 3 | O9 | Luton, UK | Sputum | Nov-02 | ||
| PA0078 | 70 | 4, 4, 16, 17, 10, 12, 22 | PA | London, UK | Sputum | Feb-02 | ||
| 7193 | 120 | 17, 22, 5, 3, 4, 14, 3 | O4 | 09.08.11 T22 | Milton Keynes, UK | NA | ||
| 4785 | 101 | 7, 22, 5, 3, 3, 14, 19 | O4 | 04.06.11 T10 | Kings College, UK | NA | ||
| PA0064 | 56 | 13, 17, 5, 14, 3, 6, 19 | O6 | Telford, UK | Wound swab | Jun-02 | ||
| 8420 | 118 | 9 | 6, 6, 4, 3, 20, 4, 7 | O1 | 01.13.15 T15 | Hope, UK | NA | |
| 5757 | 9 | 9 | 6, 6, 4, 3, 3, 4, 7 | O1 | 01.01.01 T1 | Toulouse, France | NA | |
| 7433 | 105 | 42, 28, 4, 3, 18, 4, 7 | O1 | 03.10.15 T12 | Leicester, UK | NA | ||
| PA0109 | 98 | 41, 12, 4, 3, 3, 4, 14 | O10 | Cheshire, UK | Blood | Jul-01 | ||
| PA0110 | 99 | 17, 26, 5, 3, 3, 4, 7 | O11 | Brighton, UK | NA | Jul-01 | ||
| PA0079 | 71 | 28, 4, 5, 18, 3, 4, 7 | O11 | Bristol, UK | NA | Feb-02 | ||
| PA0086 | 78 | 11, 11, 11, 3, 3, 19, 19 | PA | Stoke, UK | Catheter | Dec-01 | ||
| PA0042 | 35 | 22, 14, 17, 3, 3, 6, 7 | O6 | Glasgow, UK | Sputum | Oct-02 | ||
| PA0035 | 29 | 7, 11, 14, 3, 3, 2, 7 | O11 | London, UK | Blood | Dec-02 | ||
| PA0030 | 26 | 16, 8, 1, 3, 3, 13, 3 | PA | Cheshire, UK | NA | Dec-02 | ||
| PA0025 | 22 | 6, 4, 4, 3, 3, 11, 2 | O4 | Northampton, UK | Tissue sample | Jan-03 | ||
| 1329 M | 3 | 1, 2, 3, 3, 3, 3, 2 | NA | Wellesbourne, UK | Mushroom compost | 1997 | ||
| PA0059 | 51 | 24, 19, 3, 3, 11, 10, 18 | NT | Luton, UK | Eye | Jul-02 | ||
| PA0088 | 80 | 35, 23, 27, 6, 6, 4, 5 | O1 | London, UK | Trachea | Dec-01 | ||
| PA0021 | 19 | 14, 9, 10, 6, 6, 10, 5 | PA | Dudley, UK | Vaginal swab | Feb-03 | ||
| 2351 M | 6 | 5, 4, 5, 6, 6, 5, 5 | NA | Wellesbourne, UK | Mushroom compost | |||
| PA0071 | 63 | 5, 4, 21, 5, 12, 10, 15 | O15 | Ormskirk, UK | Urine | Apr-02 | ||
| PA0027 | 23 | 10 | 18, 4, 5, 5, 5, 4, 4 | O15 | Tyne and Wear, UK | Urine | Jan-03 | |
| 1349 M | 5 | 10 | 4, 3, 5, 5, 5, 4, 4 | NA | Wellesbourne, UK | Mushroom compost | ||
| PA0039 | 32 | 18, 13, 13, 11, 11, 4, 14 | O11 | London, UK | Venous line | Nov-02 | ||
| PA0028 | 24 | 18, 5, 13, 11, 2, 6, 2 | PA | Tyne and Wear, UK | Urine | Jan-03 | ||
| 8079 | 12 | 9, 7, 2, 9, 8, 7, 8 | NA | NA | NA | |||
| 1327 M | 2 | 2, 2, 2, 2, 2, 2, 2 | NA | Wellesbourne, UK | Mushroom compost |
Symbols and abbreviations: NA, not available; NT, nontypeable; UK, United Kingdom; boldface, epidemic clones.
Culture of isolates and preparation of chromosomal DNA.
Bacterial strains were maintained at −80°C in 12% (vol/vol) glycerol in brain heart infusion (BHI) broth, streaked to single colonies, and cultured on BHI agar at 37°C under aerobic conditions. Chromosomal DNA was extracted from these purified strains with a DNeasy kit (Qiagen).
Locus selection.
Several potential loci were identified by using the P. aeruginosa PAO1 genome database (http://www.pseudomonas.com/) (27). Criteria governing locus selection included biological role (e.g., a diverse range of different central housekeeping roles, such as mismatch repair, DNA replication, and amino acid biosynthesis), size (>600 bp), location (i.e., a minimum of 6 kbp upstream or downstream from known virulence factors, lysogenic phage, or insertion sequence elements), and suitability for nested primer design and sequence diversity (ideally, the possession of conserved domains flanking a variable central core). The seven genes finally selected for use with the MLST scheme were acsA, aroE, guaA, mutL, nuoD, ppsA, and trpE (Table 2).
TABLE 2.
Functions and genome positions of the seven loci used in the P. aeruginosa typing scheme
| Locus | Putative function of gene (strain) | Position in PAO1 genome (base pair) |
|---|---|---|
| acsA | Acetyl coenzyme A synthetase (PA0887) | 969670 |
| aroE | Shikimate dehydrogenase (PA0025) | 26711 |
| guaA | GMP synthase (PA3769) | 4227237 |
| mutL | DNA mismatch repair protein (PA4946) | 5551681 |
| nuoD | NADH dehydrogenase I chain C, D (PA2639) | 2983963 |
| ppsA | Phosphoenolpyruvate synthase (PA1770) | 1914037 |
| trpE | Anthralite synthetase component I (PA0609) | 670980 |
Amplification and sequencing of loci.
PCR primers were designed for the loci listed above by using the published P. aeruginosa sequences (27). The primers used, all of which had a common melting temperature, are shown in Table 3. The 50-μl amplification reaction mixture comprised ∼10 ng of chromosomal DNA, 1 μM each primer, 1× PCR buffer (Qiagen), 1.5 mM MgCl2, 2 mM each deoxynucleoside triphosphate, and 2.5 U of Taq DNA polymerase (Qiagen). The reaction conditions were denaturation at 96°C for 1 min, primer annealing at 55°C for 1 min, and extension at 72°C for 1 min for 35 cycles. The amplification product was purified with MinElute UF (Qiagen), according to the protocol of the manufacturer. The nucleotide sequences were determined by using internal nested primers and 2 μl of BigDye Terminator Ready Reaction Mix (version 3.1) with standard sequencing conditions, according to the protocol of the manufacturer. Unincorporated dye terminators were removed by precipitation with 95% alcohol. The reaction products were separated and detected on an ABI PRISM 3100 genetic analyzer by using a standard sequencing module with Performance Optimized Polymer Applera UK, Warrington, United Kingdom) and a 50-cm array.
TABLE 3.
Dideoxyoligonucleotide primers used for P. aeruginosa MLST
| Locus and function | Primer sequence (5′ to 3′)
|
Amplicon size (bp) | |
|---|---|---|---|
| Forward | Reverse | ||
| acsA | |||
| Amplification | ACCTGGTGTACGCCTCGCTGAC | GACATAGATGCCCTGCCCCTTGAT | 842 |
| Sequencing | GCCACACCTACATCGTCTAT | GTGGACAACCTCGGCAACCT | 390 |
| aroE | |||
| Amplification | TGGGGCTATGACTGGAAACC | TAACCCGGTTTTGTGATTCCTACA | 825 |
| Sequencing | ATGTCACCGTGCCGTTCAAG | TGAAGGCAGTCGGTTCCTTG | 495 |
| guaA | |||
| Amplification | CGGCCTCGACGTGTGGATGA | GAACGCCTGGCTGGTCTTGTGGTA | 940 |
| Sequencing | AGGTCGGTTCCTCCAAGGTC | TCAAGTCGCACCACAACGTC | 372 |
| mutL | |||
| Amplification | CCAGATCGCCGCCGGTGAGGTG | CAGGGTGCCATAGAGGAAGTC | 940 |
| Sequencing | AGAAGACCGAGTTCGACCAT | ATGACTTCCTCTATGGCACC | 441 |
| nuoD | |||
| Amplification | ACCGCCACCCGTACTG | TCTCGCCCATCTTGACCA | 1,042 |
| Sequencing | ACGGCGAGAACGAGGACTAC | TTCACCTTCACCGACCGCCA | 366 |
| ppsA | |||
| Amplification | GGTCGCTCGGTCAAGGTAGTGG | GGGTTCTCTTCTTCCGGCTCGTAG | 989 |
| Sequencing | GGTGACGACGGCAAGCTGTA | TCCTGTGCCGAAGGCGATAC | 369 |
| trpE | |||
| Amplification | GCGGCCCAGGGTCGTGAG | CCCGGCGCTTGTTGATGGTT | 811 |
| Sequencing | TTCAACTTCGGCGACTTCCA | GGTGTCCATGTTGCCGTTCC | 441 |
Allele and ST assignment.
An arbitrary number was given to each distinct allele within a locus. Each isolate was therefore given seven numbers that represented its sequence type (ST). Each sequence type was numbered in order of appearance (ST1, ST2, etc.). Allele profiles and STs can be found at http://pubmlst.org/paeruginosa.
Phylogenetic analysis.
The number of polymorphic nucleotide sites, calculation of the ratio of the number of nonsynonymous substitutions to the number of synonymous substitutions (the dN/dS ratio), and construction of a dendrogram by the unweighted pair group method with arithmetic averages (UPGMA) were performed with the START program (http://www.mlst.net) (11).
RESULTS
Allelic variation in P. aeruginosa.
Among the 143 isolates investigated, the number of housekeeping gene alleles ranged from 21 for nuoD to 43 for acsA (Table 4). There were between 23 and 37 variable sites within each locus; i.e., 5 to 8% of base pairs represented variable sites.
TABLE 4.
Analysis of the seven loci in the P. aeruginosa population sampled
| Locus | Fragment size (bp) | No. of alleles | No. of variable sites | % Variable sites | dN/dS |
|---|---|---|---|---|---|
| acsA | 390 | 43 | 32 | 8.2 | 0.03 |
| aroE | 495 | 35 | 33 | 6.7 | 0.087 |
| guaA | 372 | 36 | 24 | 6.5 | 0.02 |
| mutL | 441 | 31 | 26 | 5.9 | 0.051 |
| nuoD | 366 | 23 | 25 | 6.8 | 0.033 |
| ppsA | 369 | 26 | 25 | 6.8 | 0.06 |
| trpE | 441 | 35 | 37 | 8.4 | 0.017 |
The dN/dS ratio indicates the presence or absence of a selection pressure on the locus. Usually, most nonsynonymous changes would be expected to be eliminated by purifying selection, but under certain conditions Darwinian selection may lead to their retention. Investigation of the number of synonymous and nonsynonymous substitutions may therefore provide information about the degree of selection operating on a system. The low dN/dS ratios in Table 4 indicate the absence of a strong positive selective pressure at these loci and the suitability of these loci for population genetic studies.
Relatedness of P. aeruginosa isolates.
A total of 139 different STs were assigned to the 143 isolates investigated (Table 1). The rank order of isolates within Table 1 was derived from a UPGMA dendrogram of ST allelic profiles. Ten lineages or clonal complexes were identified among these isolates, and these were composed of strains with either identical STs or STs that varied at one or two loci (single- or double-locus variants), with founder strains indicated below with an asterisk. A founder strain has the ST to which all other STs in the clonal group are related (at least for that sample of strains examined). The compositions of these groups were as follows: group 1, 2 isolates; STs 82 and 83; group 2, 12 isolates, STs 7, 11, 15, 27*, 119, 122, 128, and 129; group 3, 5 isolates, STs 14, 17*, 115, 117, and 142; group 4, 6 isolates; STs 53, 97, 102, 111, 113, and 124; group 5, 5 isolates, STs 30, 31, 38, 39, and 46; group 6, 3 isolates, STs 104, 107, and 109; group 7, 2 isolates, STs 61 and 69; group 8, 5 isolates, STs 41, 45, 49, 52, and 57; group 9, 2 isolates, STs 9 and 118; group 10, 2 isolates; STs 5 and 23.
The environmental isolates (from mushroom compost, soil, and an oil-contaminated aquifer) were unrelated to each other but did cluster among the clinical isolates. In fact, mushroom compost isolates 1349 M (ST5, group 10) and 1346 M (ST41, group 8) clustered with clinical isolates from around the United Kingdom; and isolate 2359 (ST7, group 2), which was from a Canadian oil-contaminated aquifer, clustered with 11 clinical isolates from hospitals around the United Kingdom.
Isolates previously identified as members of the Liverpool, Manchester, Midlands, and Melbourne epidemic clones (Table 1) were found to be unrelated, sharing few if any alleles. Previously reported clone C was also unrelated to the United Kingdom epidemic isolates, although two isolates from the United Kingdom, isolates 8277 (ST14) and 8735 (ST17), from Durham and Birmingham, respectively, were identified here by MLST as belonging to clone C. In fact, from this small data set, ST17, the Birmingham isolate, was identified by BURST (based upon related STs) as the founder member of this small group of clone C isolates. BURST is a novel clustering algorithm designed for use with microbial MLST data. The approach specifically examines the relationships within clonal complexes.
The index of association (23) for all 143 isolates was found to be 0.288, and that for the 139 individual STs was found to be 0.17, indicating that P. aeruginosa has a nonclonal population structure. This statistical test attempts to measure the extent of linkage equilibrium within a population by quantifying the amount of recombination among a set of sequences and detecting associations between alleles at different loci. Comparisons of the topologies of neighbor-joining trees for the nucleotide sequences of individual loci (data not presented) revealed that there was little, if any, congruence between the trees. This is further evidence of the importance of recombination in the evolution of P. aeruginosa and indicates that the long-term phylogenetic inference of interstrain relationships, beyond the closely related groups identified, is relatively meaningless. For this reason we have not presented a dendrogram; however, as mentioned previously, the order of strains in Table 1 is the same as that derived from a UPGMA tree of allelic profiles (STs).
Relationship between ST, serotype, and toxA type.
The serotypes of 118 of the isolates included in this study had been determined previously, and the toxA types had been determined for 38 isolates. Individual serotypes were found to be widely distributed across the dendrogram generated from the allelic profiles rather than solely associated with closely related clusters of strains (Table 1). Within the BURST groups of closely related isolates, 7 of 10 BURST groups possessed more than one serotype. Group 2 had five different serotypes among the nine isolates that had previously been serotyped, and the ST27 isolates from group 2 had four different serotypes.
Although fewer data were available for toxA types, a picture similar to that for serotypes was also found for toxA types. BURST group 2 contained multiple toxA types, and each of the five ST27 isolates possessed a different toxA type.
Both of these data sets reveal that there is a weak linkage between ST, serotype, and toxA type, which could be expected from the population structure. There is evidence that strains possess identical serotypes and toxA types but different STs (e.g., ST8277 and ST8735 members of clone C BURST group 2 and ST102, ST111, and ST113 members of BURST group 4), and there are examples of strains with identical STs but different serotypes and toxA types (e.g., members of ST27 in BURST group 2).
DISCUSSION
At present there is a great need for a universal technique for P. aeruginosa typing that is unambiguous and reproducible and that can be used for epidemiological studies of the organism. It has been shown here that MLST fulfills these criteria and effectively types all strains from a diverse collection of P. aeruginosa strains.
Analysis of these data has further confirmed that P. aeruginosa has a nonclonal population structure punctuated by highly successful epidemic clones or clonal complexes. Recombination is therefore likely to play an important role in shaping the evolution of P. aeruginosa. The weak association between serotypes, toxA types, and MLST STs is a probable result of the effect of recombination on the evolution of P. aeruginosa. The isolates with identical STs examined usually possessed different serotypes and different toxA types. However, further analysis of toxA type and serotype stability is required, ideally with a different collection of isolates with a predetermined association in space and time, to better understand the value of the toxA type and the serotype for the local epidemiology of P. aeruginosa over different periods of time.
Included within the strain collection evaluated in the present study were representative isolates of each of the recently identified clinical epidemic isolates from across the United Kingdom, examples of European clone C, and an epidemic isolate from Melbourne, Australia. It is interesting from the allele profiles in Table 1 that the epidemic clones are not closely related to each other, suggesting that they have evolved independently. Furthermore, some of the clone C isolates had different alleles for the trpE locus, which lies within a region of the chromosome that has been inverted within some clone C isolates (19). This suggests that the inversions in these isolates were independent events and not that they arose once and were then subsequently transferred between strains. Additional work with large numbers of representatives of each epidemic clone is required to understand better how these clinically important organisms have evolved and to understand more about clonal stability within P. aeruginosa.
Finally, environmental isolates from soil, an oil-contaminated aquifer, and mushroom compost did not cluster away from clinical isolates. In fact, some of these environmental isolates were members of clones or clonal complexes that possessed isolates from cases of invasive disease. This corroborates assumptions based on previous studies which found no correlations between habitat and particular clones (17, 20).
The MLST scheme described here shows that P. aeruginosa has a nonclonal epidemic population structure. Further work is required to better understand the evolution of epidemic clones; to compare MLST with typing systems that rely upon genome fragment analysis, such as pulsed-field gel electrophoresis and amplified fragment length polymorphism analysis; and to characterize the genetic diversity and assess the risk of environmental reservoirs of P. aeruginosa.
Acknowledgments
We thank Micropathology Ltd., Coventry, United Kingdom, and BBSRC for sponsoring B. Curran and the Walsgrave UHCW for contributing toward MLST costs. Part of this study was supported by a grant (grant 01KI9907 to D.J.) from the German Bundesministerium für Bildung und Forschung.
We thank Alun Morgan of HRI Wellsbourne for providing access to mushroom compost isolates. We thank Keith Jolley, Peter Medwar Pathogen Research Building, University of Oxford, for creating the website. We are grateful to the Molecular Biology Service, University of Warwick, for DNA sequencing.
REFERENCES
- 1.Baltch Aldona, L., and P. Smith Raymond. 1994. Pseudomonas aeruginosa infections and treatment. Marcel Dekker, Inc., New York, N.Y.
- 2.Belin, M. W., and P. Zloty. 1993. Accuracy of the PAR corneal topography system with spatial misalignment. CLAO J. 19:64-68. [DOI] [PubMed] [Google Scholar]
- 3.Chitkara, Y. K., and T. C. Feierabend. 1981. Endogenous and exogenous infection with Pseudomonas aeruginosa in a burns unit. Int. Surg. 66:237-240. [PubMed] [Google Scholar]
- 4.Cross, A., J. R. Allen, J. Burke, G. Ducel, A. Harris, J. John, D. Johnson, M. Lew, B. MacMillan, P. Meers, et al. 1983. Nosocomial infections due to Pseudomonas aeruginosa: review of recent trends. Rev. Infect. Dis. 5(Suppl. 5):S837-S845. [DOI] [PubMed] [Google Scholar]
- 5.Denamur, E., B. Picard, G. Decoux, J. B. Denis, and J. Elion. 1993. The absence of correlation between allozyme and rrn RFLP analysis indicates a high gene flow rate within human clinical Pseudomonas aeruginosa isolates. FEMS Microbiol. Lett. 110:275-280. [DOI] [PubMed] [Google Scholar]
- 6.Dinesh, S. D., H. Grundmann, T. L. Pitt, and U. Romling. 2003. European-wide distribution of Pseudomonas aeruginosa clone C. Clin. Microbiol. Infect. 9:1228-1233. [DOI] [PubMed] [Google Scholar]
- 7.Doring, G., S. P. Conway, H. G. Heijerman, M. E. Hodson, N. Hoiby, A. Smyth, and D. J. Touw. 2000. Antibiotic therapy against Pseudomonas aeruginosa in cystic fibrosis: a European consensus. Eur. Respir. J. 16:749-767. [DOI] [PubMed] [Google Scholar]
- 8.Fagon, J. Y., J. Chastre, A. J. Hance, P. Montravers, A. Novara, and C. Gibert. 1993. Nosocomial pneumonia in ventilated patients: a cohort study evaluating attributable mortality and hospital stay. Am. J. Med. 94:281-288. [DOI] [PubMed] [Google Scholar]
- 9.Grundmann, H., A. Kropec, D. Hartung, R. Berner, and F. Daschner. 1993. Pseudomonas aeruginosa in a neonatal intensive care unit: reservoirs and ecology of the nosocomial pathogen. J. Infect. Dis. 168:943-947. [DOI] [PubMed] [Google Scholar]
- 10.Grundmann, H., C. Schneider, D. Hartung, F. D. Daschner, and T. L. Pitt. 1995. Discriminatory power of three DNA-based typing techniques for Pseudomonas aeruginosa. J. Clin. Microbiol. 33:528-534. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Jolley, K. A., E. J. Feil, M. S. Chan, and M. C. Maiden. 2001. Sequence type analysis and recombinational tests (START). Bioinformatics 17:1230-1231. [DOI] [PubMed] [Google Scholar]
- 12.Jones, A. M., J. R. Govan, C. J. Doherty, M. E. Dodd, B. J. Isalska, T. N. Stanbridge, and A. K. Webb. 2001. Spread of a multiresistant strain of Pseudomonas aeruginosa in an adult cystic fibrosis clinic. Lancet 358:557-558. [DOI] [PubMed] [Google Scholar]
- 13.Kiewitz, C., and B. Tummler. 2000. Sequence diversity of Pseudomonas aeruginosa: impact on population structure and genome evolution. J. Bacteriol. 182:3125-3135. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Lomholt, J. A., K. Poulsen, and M. Kilian. 2001. Epidemic population structure of Pseudomonas aeruginosa: evidence for a clone that is pathogenic to the eye and that has a distinct combination of virulence factors. Infect. Immun. 69:6284-6295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.McCallum, S. J., M. J. Gallagher, J. E. Corkill, C. A. Hart, M. J. Ledson, and M. J. Walshaw. 2002. Spread of an epidemic Pseudomonas aeruginosa strain from a patient with cystic fibrosis (CF) to non-CF relatives. Thorax 57:559-560. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Picard, B., E. Denamur, A. Barakat, J. Elion, and P. Goullet. 1994. Genetic heterogeneity of Pseudomonas aeruginosa clinical isolates revealed by esterase electrophoretic polymorphism and restriction fragment length polymorphism of the ribosomal RNA gene region. J. Med. Microbiol. 40:313-322. [DOI] [PubMed] [Google Scholar]
- 17.Pirnay, J. P., D. De Vos, C. Cochez, F. Bilocq, A. Vanderkelen, M. Zizi, B. Ghysels, and P. Cornelis. 2002. Pseudomonas aeruginosa displays an epidemic population structure. Environ. Microbiol. 4:898-911. [DOI] [PubMed] [Google Scholar]
- 18.Pitt, T. L. 1988. Epidemiological typing of Pseudomonas aeruginosa. Eur. J. Clin. Microbiol. Infect. Dis. 7:238-247. [DOI] [PubMed] [Google Scholar]
- 19.Romling, U., K. D. Schmidt, and B. Tummler. 1997. Large chromosomal inversions occur in Pseudomonas aeruginosa clone C strains isolated from cystic fibrosis patients. FEMS Microbiol. Lett. 150:149-156. [DOI] [PubMed] [Google Scholar]
- 20.Romling, U., J. Wingender, H. Muller, and B. Tummler. 1994. A major Pseudomonas aeruginosa clone common to patients and aquatic habitats. Appl. Environ. Microbiol. 60:1734-1738. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Schlech, W. F., III, N. Simonsen, R. Sumarah, and R. S. Martin. 1986. Nosocomial outbreak of Pseudomonas aeruginosa folliculitis associated with a physiotherapy pool. Can. Med. Assoc. J. 134:909-913. [PMC free article] [PubMed] [Google Scholar]
- 22.Schmidt, K. D., B. Tummler, and U. Romling. 1996. Comparative genome mapping of Pseudomonas aeruginosa PAO with P. aeruginosa C, which belongs to a major clone in cystic fibrosis patients and aquatic habitats. J. Bacteriol. 178:85-93. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Smith, D. L., E. G. Smith, L. B. Gumery, D. E. Stableforth, L. M. Dalla Costa, and T. L. Pitt. 1993. Epidemiology of Pseudomonas aeruginosa infection in cystic fibrosis and the use of strain genotyping. J. Infect. 26:325-331. [DOI] [PubMed] [Google Scholar]
- 24.Speert, D. P. 2002. Molecular epidemiology of Pseudomonas aeruginosa. Frontiers Biosci. 7:e354-e361. [DOI] [PubMed] [Google Scholar]
- 25.Speert, D. P., M. E. Campbell, D. A. Henry, R. Milner, F. Taha, A. Gravelle, A. G. Davidson, L. T. Wong, and E. Mahenthiralingam. 2002. Epidemiology of Pseudomonas aeruginosa in cystic fibrosis in British Columbia, Canada. Am. J. Respir. Crit. Care Med. 166:988-993. [DOI] [PubMed] [Google Scholar]
- 26.Spencer, D. H., A. Kas, E. E. Smith, C. K. Raymond, E. H. Sims, M. Hastings, J. L. Burns, R. Kaul, and M. V. Olson. 2003. Whole-genome sequence variation among multiple isolates of Pseudomonas aeruginosa. J. Bacteriol. 185:1316-1325. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Stover, C. K., X. Q. Pham, A. L. Erwin, S. D. Mizoguchi, P. Warrener, M. J. Hickey, F. S. Brinkman, W. O. Hufnagle, D. J. Kowalik, M. Lagrou, R. L. Garber, L. Goltry, E. Tolentino, S. Westbrock-Wadman, Y. Yuan, L. L. Brody, S. N. Coulter, K. R. Folger, A. Kas, K. Larbig, R. Lim, K. Smith, D. Spencer, G. K. Wong, Z. Wu, I. T. Paulsen, J. Reizer, M. H. Saier, R. E. Hancock, S. Lory, and M. V. Olson. 2000. Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen. Nature 406:959-964. [DOI] [PubMed] [Google Scholar]