Abstract
By the combined use of DNase I footprinting, electrophoretic mobility-shift assay, and methylation interference analysis, we have identified a series of sequence-specific protein-DNA interactions in the 5' flanking region of the rat osteocalcin gene. Stimulation of osteocalcin gene expression by 1,25-dihydroxyvitamin D3, a physiologic mediator of this bone-specific gene in vitro and in vivo, is associated with modifications in the binding of ROS 17/2.8 cell nuclear factors to two promoter segments that up-regulate transcription. One segment located between -462 and -437 exhibits a vitamin D-dependent increase in sequence-specific binding of nuclear factors. This element (CTGGGTGAATGAGGACATTACTGACC), identified at single nucleotide resolution, contains a region of hyphenated dyad symmetry and shares sequence homology with consensus steroid-responsive elements and with the sequence that has been identified as the vitamin D receptor binding site in the human osteocalcin gene. We have also observed that vitamin D stimulation of osteocalcin gene expression results in a 5-fold increase in protein binding to the region of the osteocalcin box, a 24-nucleotide segment in the proximal promoter with a CCAAT motif as the central core. Our results demonstrate protein-DNA interactions in a vitamin D-responsive element and in a second sequence, the osteocalcin box, both of which are involved in the physiologic regulation of the osteocalcin gene in response to 1,25-dihydroxyvitamin D3.
Full text
PDF




Images in this article
Selected References
These references are in PubMed. This may not be the complete list of references from this article.
- Augereau P., Chambon P. The mouse immunoglobulin heavy-chain enhancer: effect on transcription in vitro and binding of proteins present in HeLa and lymphoid B cell extracts. EMBO J. 1986 Aug;5(8):1791–1797. doi: 10.1002/j.1460-2075.1986.tb04428.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Celeste A. J., Rosen V., Buecker J. L., Kriz R., Wang E. A., Wozney J. M. Isolation of the human gene for bone gla protein utilizing mouse and rat cDNA clones. EMBO J. 1986 Aug;5(8):1885–1890. doi: 10.1002/j.1460-2075.1986.tb04440.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Demay M. B., Gerardi J. M., DeLuca H. F., Kronenberg H. M. DNA sequences in the rat osteocalcin gene that bind the 1,25-dihydroxyvitamin D3 receptor and confer responsiveness to 1,25-dihydroxyvitamin D3. Proc Natl Acad Sci U S A. 1990 Jan;87(1):369–373. doi: 10.1073/pnas.87.1.369. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Demay M. B., Roth D. A., Kronenberg H. M. Regions of the rat osteocalcin gene which mediate the effect of 1,25-dihydroxyvitamin D3 on gene transcription. J Biol Chem. 1989 Feb 5;264(4):2279–2282. [PubMed] [Google Scholar]
- Dignam J. D., Lebovitz R. M., Roeder R. G. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 1983 Mar 11;11(5):1475–1489. doi: 10.1093/nar/11.5.1475. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hauschka P. V., Lian J. B., Cole D. E., Gundberg C. M. Osteocalcin and matrix Gla protein: vitamin K-dependent proteins in bone. Physiol Rev. 1989 Jul;69(3):990–1047. doi: 10.1152/physrev.1989.69.3.990. [DOI] [PubMed] [Google Scholar]
- Kerner S. A., Scott R. A., Pike J. W. Sequence elements in the human osteocalcin gene confer basal activation and inducible response to hormonal vitamin D3. Proc Natl Acad Sci U S A. 1989 Jun;86(12):4455–4459. doi: 10.1073/pnas.86.12.4455. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lian J., Stewart C., Puchacz E., Mackowiak S., Shalhoub V., Collart D., Zambetti G., Stein G. Structure of the rat osteocalcin gene and regulation of vitamin D-dependent expression. Proc Natl Acad Sci U S A. 1989 Feb;86(4):1143–1147. doi: 10.1073/pnas.86.4.1143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Minghetti P. P., Gibbs P. E., Norman A. W. Computer analysis of 1,25-dihydroxyvitamin D3-receptor regulated promoters: identification of a candidate D3-response element. Biochem Biophys Res Commun. 1989 Jul 31;162(2):869–875. doi: 10.1016/0006-291x(89)92390-5. [DOI] [PubMed] [Google Scholar]
- Pan L. C., Price P. A. The effect of transcriptional inhibitors on the bone gamma-carboxyglutamic acid protein response to 1,25-dihydroxyvitamin D3 in osteosarcoma cells. J Biol Chem. 1984 May 10;259(9):5844–5847. [PubMed] [Google Scholar]
- Pauli U., Chrysogelos S., Nick H., Stein G., Stein J. In vivo protein binding sites and nuclease hypersensitivity in the promoter region of a cell cycle regulated human H3 histone gene. Nucleic Acids Res. 1989 Mar 25;17(6):2333–2350. doi: 10.1093/nar/17.6.2333. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pauli U., Chrysogelos S., Stein G., Stein J., Nick H. Protein-DNA interactions in vivo upstream of a cell cycle-regulated human H4 histone gene. Science. 1987 Jun 5;236(4806):1308–1311. doi: 10.1126/science.3035717. [DOI] [PubMed] [Google Scholar]
- Theofan G., Haberstroh L. M., Price P. A. Molecular structure of the rat bone Gla protein gene and identification of putative regulatory elements. DNA. 1989 Apr;8(3):213–221. doi: 10.1089/dna.1.1989.8.213. [DOI] [PubMed] [Google Scholar]
- Thomas P. S. Hybridization of denatured RNA transferred or dotted nitrocellulose paper. Methods Enzymol. 1983;100:255–266. doi: 10.1016/0076-6879(83)00060-9. [DOI] [PubMed] [Google Scholar]
- Tushinski R. J., Sussman P. M., Yu L. Y., Bancroft F. C. Pregrowth hormone messenger RNA: glucocorticoid induction and identification in rat pituitary cells. Proc Natl Acad Sci U S A. 1977 Jun;74(6):2357–2361. doi: 10.1073/pnas.74.6.2357. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Westin G., Schaffner W. Heavy metal ions in transcription factors from HeLa cells: Sp1, but not octamer transcription factor requires zinc for DNA binding and for activator function. Nucleic Acids Res. 1988 Jul 11;16(13):5771–5781. doi: 10.1093/nar/16.13.5771. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yoon K. G., Rutledge S. J., Buenaga R. F., Rodan G. A. Characterization of the rat osteocalcin gene: stimulation of promoter activity by 1,25-dihydroxyvitamin D3. Biochemistry. 1988 Nov 15;27(23):8521–8526. doi: 10.1021/bi00423a003. [DOI] [PubMed] [Google Scholar]
- van Wijnen A. J., Wright K. L., Lian J. B., Stein J. L., Stein G. S. Human H4 histone gene transcription requires the proliferation-specific nuclear factor HiNF-D. Auxiliary roles for HiNF-C (Sp1-like) and HiNF-A (high mobility group-like). J Biol Chem. 1989 Sep 5;264(25):15034–15042. [PubMed] [Google Scholar]









